Regulation and control application based on BHMT and PPAR gamma methylation in liver cancer cells

Abstract

The invention provides regulation and control application in liver cancer cells based on BHMT and PPAR gamma methylation, and relates to the technical field of biological medicines. The invention verifies that the content of the BHMT in liver cancer tissues is obviously reduced, and the content of the BHMT in cancer tissues of MVI patients is obviously reduced, which indicates that the BHMT can be used as a biomarker for predicting and evaluating the MVI occurrence probability of the liver cancer patients. The invention also verifies that the overexpressed BHMT can significantly inhibit the proliferation and transfer ability of hepatoma carcinoma cells in vivo, and verifies that the knockout of BHMT leads to enrichment of PPAR signal pathways in hepatoma carcinoma cells and the expression of PPAR gamma is significantly increased by researching the action relationship between BHMT and PPAR gamma signal pathways; the expression level of SAM can be remarkably improved by overexpressing BHMT, so that the methylation level of a PPAR gamma promoter is up-regulated, and the purpose of inhibiting PPAR gamma expression is achieved. The results show that in the development stage of liver cancer after formation, the drug over-expressing BHMT can inhibit proliferation and migration of liver cancer cells by inhibiting the expression level of PPAR gamma. The invention provides a new treatment thought and method for treating liver cancer and predicting postoperative metastasis and recurrence.

Description

Technical Field

[0001] The present invention relates to the field of biomedicine technology, and in particular to the regulation and application of BHMT and PPARγ methylation in liver cancer cells. Background Art

[0002] Hepatocellular carcinoma (HCC) is one of the most common malignant tumors in clinical practice, accounting for 5.6% of all cancers. Although a lot of progress has been made in the basic and clinical research of liver cancer in recent years, there is still a lack of effective means for early prevention and screening of liver cancer. The treatment of liver cancer is mainly based on early surgical resection, supplemented by interventional therapy, ablation therapy and drug therapy, but all of them have disadvantages such as uncertain efficacy and easy recurrence after treatment, which is related to the unclear molecular biological mechanism of liver cancer occurrence and development. Liver cancer has a high mortality rate, and recurrence, invasion and metastasis are the most important factors affecting prognosis. Therefore, studying the invasion and metastasis mechanism of liver cancer is extremely important for the treatment of liver cancer and is also a hot topic in recent research. Serum alpha-fetoprotein (AFP) plays a vital role in the diagnosis and recurrence monitoring of liver cancer and is regarded as the "gold standard". However, 30% of liver cancer patients have normal AFP levels in clinical practice. Due to its low sensitivity and specificity, this has obvious limitations in the diagnosis of liver cancer. Therefore, it is very meaningful to explore new biomarkers for clinical diagnosis of liver cancer patients or as targets for new drug development.

[0003] Peroxisome proliferator-activated receptor (PPAR)γ is one of the subtypes of the ligand-dependent nuclear receptor transcription factor PPAR. It is highly expressed in adipose tissue and the immune system. It can use its four different protein domains to participate in the regulation of various inflammatory diseases and metabolic-related diseases in the body in multiple ways. In the precancerous stage of liver cancer, PPARγ can improve liver inflammation and inhibit the formation and development of liver fibrosis and liver cancer stem cells. At the same time, it also promotes the expression of related tumor suppressor genes (such as p53 and p21), playing a significant tumor suppressor role in the precancerous stage of HCC. In the development stage after the formation of liver cancer, PPARγ can promote cancer cell glucose and lipid metabolism, induce angiogenesis, and promote the formation of solid tumors. At the same time, PPARγ can also promote M2 TAM polarization and inhibit immune cells such as DS and CTL, thereby promoting immunosuppression and inducing immune escape. Therefore, how to reasonably apply PPARγ agonists or inhibitors in different stages of HCC so that they can accurately play a role in inhibiting tumor development deserves further thinking and exploration.

[0004] Betaine homocysteine ​​methyltransferase (BHMT) is a Zn-containing 2+ The methyltransferase is composed of 406AA and has a relative molecular mass of 44.998×10 3 , involved in the metabolic regulation of S-adenosylhomocysteine ​​(SAH) and homocysteine, and is specifically overexpressed in hepatocytes. Studies have shown that BHMT is significantly downregulated in liver cancer tumor tissues, and BHMT gene knockout mice are more likely to develop precancerous lesions. The above indicates that the reduction of BHMT may play a very important role in the occurrence of liver cancer. There is no relevant report on whether there is a relationship between BHMT and PPARγ in liver cancer cells. It is very necessary and urgent to explore the regulatory application of BHMT and PPARγ methylation in liver cancer cells to provide new methods for the treatment of liver cancer. Summary of the invention

[0005] 1. Technical issues to be resolved

[0006] In view of the deficiencies of the prior art, the present invention provides a regulatory application based on BHMT and PPARγ methylation in liver cancer cells.

[0007] (II) Technical solution

[0008] To achieve the above objectives, the present invention is implemented through the following technical solutions:

[0009] In a first aspect, the present invention provides a regulatory application based on BHMT and PPARγ methylation in liver cancer cells, wherein the application method is: overexpressing BHMT in liver cancer cells, upregulating SAM expression level and PPARγ promoter methylation, and thereby inhibiting PPARγ expression level.

[0010] In a second aspect, the present invention provides the use of BHMT in the preparation of a drug for inhibiting the transcription level of PPARγ in liver cancer cells.

[0011] In a third aspect, the present invention provides the use of BHMT in the preparation of a drug for upregulating the methylation level of the PPARγ promoter in liver cancer cells.

[0012] As in the above application, the drug contains any one of a vector, a recombinant plasmid, a lentivirus, and a fusion protein that overexpresses the BHMT gene or protein.

[0013] In a fourth aspect, the present invention provides the use of BHMT as a biomarker in predicting and evaluating MVI of liver cancer.

[0014] (III) Beneficial effects

[0015] The present invention detects the protein expression of BHMT in liver cancer tissue and corresponding adjacent tissues, and finds that the content of BHMT in liver cancer tissue is significantly reduced, and at the same time finds that the content of BHMT in cancer tissue of MVI patients is significantly reduced, indicating that BHMT can be used as a biomarker to predict and evaluate the probability of MVI in liver cancer patients. Further, we injected the subcutaneous and tail vein of BALB / c nude mice with stably overexpressed liver cancer cell lines, and verified that overexpression of BHMT can significantly inhibit the proliferation and metastasis ability of liver cancer cells in vivo. We also further studied the relationship between BHMT and the PPARγ signaling pathway. The experimental results showed that knocking out BHMT led to enrichment of the PPAR signaling pathway in liver cancer cells, among which PPARγ expression was significantly increased; overexpression of BHMT can significantly increase the expression level of SAM, and then upregulate the methylation level of PPARγ promoter, so as to achieve the purpose of inhibiting the expression of PPARγ; after treating liver cancer cells with PPARγ antagonists, the increased transcription and secretion of chemokine CCL2 caused by BHMT knockout can be reversed. The above results show that in the development stage after liver cancer is formed, drugs that overexpress BHMT can inhibit the proliferation and migration of liver cancer cells by inhibiting the expression level of PPARγ. The present invention provides a new treatment idea and method for the treatment of liver cancer and the prediction of postoperative metastasis and recurrence. BRIEF DESCRIPTION OF THE DRAWINGS

[0016] Figure 1 Patients with low expression of BHMT in liver cancer tissues are prone to MVI. (A) Expression levels of BHMT in cancerous tissues and adjacent tissues of liver cancer patients (N=40); (B) Expression levels of BHMT in liver cancer tissues without MVI (N=34) and with MVI (N=6); (C) Frequency distribution of liver cancer patients with and without MVI in the BHMT high expression group and low expression group; (D) Immunohistochemical staining of BHMT in liver cancer tissues with and without MVI; Statistical differences between the two groups were analyzed using paired sample t test (A) or student's-t test (B) or chi-square test (C), and P<0.05 was considered statistically significant.

[0017] Figure 2 BHMT in liver cancer cells can inhibit the proliferation and metastasis of liver cancer cells in vivo. (A) The tumorigenicity and proliferation of liver cancer cells knocked out by BHMT were significantly enhanced in vivo; (B) Overexpression of BHMT in liver cancer cells can inhibit the tumorigenicity and proliferation of liver cancer cells in vivo; (C, D) HuH7 (C) and HepG2 (D) liver cancer cells overexpressing BHMT had significantly reduced lung metastasis in vivo; The statistical differences between the two groups were tested by student's t test, *P<0.05, **P<0.01, P<0.05 was considered statistically significant.

[0018] Figure 3 BHMT and tumor microenvironment Density and M2 type (A) Analysis of the correlation between BHMT and immune cell infiltration in the tumor microenvironment based on TCGA database data; (B, C) Expression of BHMT in human liver cancer tissue (B) and BALB / c nude mouse lung metastasis tissue (C) Density and M2 type Polarization; (D, E) The relationship between the expression of BHMT and the expression of M1 and M2 markers in human liver cancer tissue (D) and nude mouse lung metastasis tissue (E); The statistical difference between the two groups was tested by student's t test, and P<0.05 was considered statistically significant.

[0019] Figure 4 Knockout of BHMT leads to enrichment of PPAR signaling pathway, and PPARγ expression is significantly upregulated. (A) Volcano plot of differentially expressed genes between wild-type and BHMT-knockout HuH7 cells. (B) KEGG pathway enrichment analysis of differentially expressed genes in BHMT-knockout liver cancer cells; (C) RT-qPCR verification of expression changes of PPAR pathway-related genes; (D) WB verification that knockout of BHMT in HuH7 cells leads to significant upregulation of PPARγ expression; Statistical differences between the two groups were tested by student's-t test, *P<0.05, **P<0.01, ***P<0.001, P<0.05 was considered statistically significant.

[0020] Figure 5 BHMT inhibits PPARγ expression by increasing the methylation of PPARγ promoter region. (A) CpG islands exist in the promoter region of PPARγ in humans and mice; (B) The levels of methylation and unmethylation of PPARγ promoter in human liver cancer and adjacent tissues; (C) The levels of methylation and unmethylation of PPARγ promoter in HuH7 cells knocked out or overexpressed by BHMT; (D) The content of methyl donor SAM in HuH7 cells knocked out or overexpressed by BHMT. The statistical difference between the two groups was tested by student's t test, and ***P<0.001 and P<0.05 were considered statistically significant.

[0021] Figure 6 Blocking CCL2 signaling can significantly inhibit the BHMT knockout-induced Recruitment and M2 polarization. (A) GO analysis of differentially expressed genes in HuH7 cells with BHMT knockout; (B) RT-qPCR verification (C) Verification of the successful construction of shCCL2 and CCL2 lentiviral packaging plasmids; (D) Overexpression of CCL2 in HepG2 cells offsets the effects of overexpression of BHMT on the expression of chemokines related to recruitment and polarization. Knockdown of CCL2 reversed the inhibitory effect of BHMT knockdown on migration. (E) Blocking CCL2 signaling in HepG2 cells can inhibit the M2-type migration promoted by BHMT knockout. Polarization; the statistical difference between the two groups was tested by student's t test, *P<0.05, **P<0.01, ***P<0.001, P<0.05 was considered statistically significant.

[0022] Figure 7 Antagonizing PPARγ activation can inhibit the increase in CCL2 transcription and secretion caused by BHMT knockout. (A) After treatment with the PPARγ antagonist T0070907, the transcription and secretion of CCL2 in HuH7 cells were significantly reduced; (B) After treatment with T0070907, the increase in CCL2 transcription level and secretion in HuH7 cells caused by BHMT knockout were offset; the statistical difference between the two groups was tested by student's t test, **P<0.01, ***P<0.001, P<0.05 was considered statistically significant. DETAILED DESCRIPTION

[0023] In order to make the purpose, technical solution and advantages of the embodiments of the present invention clearer, the technical solution in the embodiments of the present invention will be clearly and completely described below in combination with the embodiments of the present invention. Obviously, the described embodiments are part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0024] Example

[0025] 1 Experiments and Methods

[0026] 1.1 Patient information and tissue specimens

[0027] This study was approved by the First Affiliated Hospital of Zhengzhou University and histopathological studies were performed on 40 samples from liver cancer tissues and 40 samples from paired adjacent paracancerous tissues. All specimens were confirmed by pathology in the same hospital.

[0028] 1.2 Construction of BHMT knockout (BHMT - / - ) hepatoma cell line and BHMT overexpression (BHMT) hepatoma cell line

[0029] HuH7 cells and HepG2 cells were cultured in 6-well plates, and the culture medium used was DMEM medium containing 10% fetal bovine serum (FBS, Gibco), 100 μg / mL streptomycin, and 100 units / mL penicillin. CRISPR / Cas9 technology was used to specifically knock out the BHMT gene in liver cancer cells.

[0030] For the knockout of BHMT, three sgRNAs (SEQ ID NO.1: GATCCTAGAACGTTTTAAATGCTGG, SEQ ID NO.2: GAAGAGGGCTACGTAAAGGCAGG, SEQ ID NO.3: GTCTATTGTAAGTTCTCATAAAGG) and two PCR detection primers (SEQ ID NO.4: TCTGGTTGTTTGTCTTATAGATAGCCATA, SEQ ID NO.5: GGTTTTCCATCAATTCAGCTACCAC) were designed. pLenti CMV GFP Puro (658-5) was purchased from the Public Protein / Plasmid Library (PPL, Nanjing, China). BHMT cDNA was synthesized by Sangon Biotech Co., Ltd and cloned into the plenti CMV GFP puro (658-5) vector. The lentiviral plasmid was transfected into 293T cells by calcium transfection, and the virus solution was collected at 48h and 72h after transfection. Infect liver cancer cells with viral fluid to construct BHMT - / - and BHMT cell lines.

[0031] 1.3 Subcutaneous xenograft liver cancer model

[0032] All animal experiments were performed in accordance with the Guide for the Care and Use of Laboratory Animals of the National Institutes of Health and approved by the Animal Ethics Committee. BALB / C nude mice (male, 5 weeks old) were randomly divided into groups (N=5 per group). - / - or BHMT cells at 5×10 6 The cells were injected subcutaneously into the subcutaneous tissue on the right and left upper abdomen of the mice. The length and width of the tumor were measured every two days, and the tumor volume was calculated as length × width × width / 2. Four weeks after subcutaneous injection, the mice were euthanized and the tumor tissues were dissected.

[0033] 1.4 Liver cancer lung metastasis model

[0034] All animal experiments were performed in accordance with the Guide for the Care and Use of Laboratory Animals of the National Institutes of Health and approved by the Animal Ethics Committee. BALB / C nude mice (male, 5 weeks old) were randomly divided into groups (N = 5 per group). WT and BHMT - / - or BHMT cells at 5×10 5 The cells were injected into nude mice via the tail vein. Three weeks after the tail vein injection, the mice were euthanized and the lung tissues were dissected for gross observation and pathological examination of liver cancer metastasis in the lung tissues.

[0035] 1.5 Construction of CCL2 knockdown (LV-shCCL2) and CCL2 overexpression (CCL2) liver cancer cell lines

[0036] HepG2 cells were cultured in 6-well plates, and the culture medium used was DMEM medium containing 10% fetal bovine serum (FBS, Gibco), 100 μg / mL streptomycin, and 100 units / mL penicillin. Three shRNAs were designed based on the CDS region and 3'UTR region of CCL2, and their target sequences were SEQ ID NO.6: GATGTGAAACATTATGCCTTA, SEQ ID NO.7: GCTCGCGAGCTATAGAAGAAT, and SEQ ID NO.8: GCTGTGATCTTCAAGACCATT. The above three shRNAs were cloned into the pLKO-1 vector. The cDNA of CCL2 was synthesized by Sangon Biotech Co., Ltd. and cloned into the Plenti CMV GFP puro (658-5) vector. The lentiviral overexpression plasmid and shRNA plasmid were transfected into 293T cells by calcium transfection, and the virus fluid was collected at 48h and 72h after transfection. The virus solution was used to infect liver cancer cells to construct stable liver cancer cell lines with CCL2 knockdown and overexpression.

[0037] 1.6 Determination of the content of S-adenosylmethionine (SAM) and CCL2:

[0038] WT and BHMT - / - The WT and BHMT hepatoma cells were cultured in 6 cm dishes, and the cells were collected after 72 h of culture. The cells were homogenized on ice after adding pre-cooled 1× phosphate buffer solution (PBS), and centrifuged at 4000×g and 4°C for 15 min to obtain the supernatant. The concentration of SAM in the supernatant was detected by competitive ELISA. - / - Or BHMT liver cancer cells were cultured in a 6 cm dish, and the cell supernatant was collected after 72 h of culture, centrifuged at 4000×g and 4°C for 15 min, and the supernatant was obtained. The concentration of CCL2 in the supernatant was detected by competitive ELISA.

[0039] 1.7 Proteomic analysis

[0040] (1) Sample preparation: Protein was extracted from samples using the SDT lysis method.

[0041] (2) Protein digestion: Take an appropriate amount of protein from each sample and perform trypsin digestion using the Filter aided proteome preparation (FAS) method.

[0042] (3) Peptide separation and enrichment: Use reversed-phase HPLC to separate peptides to improve the sensitivity and resolution of the analysis; solidification extraction to purify and enrich peptides, remove impurities, and improve detection accuracy.

[0043] (4) Mass spectrometry analysis: The peptides were detected by mass spectrometry (LC-MS / MS) and the mass spectrometry data were recorded.

[0044] (5) Data analysis: The mass spectrometry data were processed using the Max Quant software.

[0045] (6) Protein identification and quantitative analysis: By comparing the database, the peptide mass spectrometry data is matched with the known protein sequence database to determine the protein identity; label-free protein quantification is used to compare the expression differences under different conditions; bioinformatics tools are used to analyze the function, interaction network and biological process of the protein.

[0046] 1.8 Western blot analysis

[0047] Proteins were extracted from liver or cells using RIPA buffer (High) or non-denaturing lysis buffer (SolarBio Life Sciences). After SDS-PAGE gel electrophoresis, transfer to membrane, blocking, incubation with primary antibody at 4°C overnight, and color development after secondary antibody incubation. The intensity of the bands was analyzed using software, and quantitative analysis was performed to compare the expression levels of target proteins in different samples.

[0048] 1.9 Immunohistochemistry

[0049] Immediately after liver resection, liver cancer tissue samples and their corresponding adjacent tissues were obtained from the patients. Subsequently, these tissue samples were precisely fixed in 10% formalin solution and embedded in paraffin following standard procedures. To ensure adequate exposure of the antigen, sodium citrate was used for antigen retrieval. Next, fetal bovine serum was used to carefully block nonspecific binding sites to reduce background staining. The samples were incubated with the primary antibody overnight at 4°C to ensure adequate binding of the antibody to the antigen. The next day, the samples were incubated with the secondary antibody at room temperature for 1 h to enhance the signal. Finally, the samples were developed with a colorimetric solution, and detailed histochemical scoring (H-Score evaluation) was performed based on the staining intensity and distribution.

[0050] 1.10 RNA sequencing

[0051] (1) RNA extraction and library preparation: First, total RNA is extracted from the target cells. Subsequently, the cDNA library for sequencing is prepared by specifically enriching mRNA molecules or removing rRNA. The key steps in this process include RNA quality detection and concentration determination to ensure that the quality and concentration of RNA meet the requirements of the sequencing experiment, thereby ensuring the accuracy and reliability of subsequent sequencing data.

[0052] (2) RNA fragmentation and library construction: RNA molecules are broken into shorter fragments by ultrasonication, and then cDNA is synthesized using reverse transcriptase and random primers or specific primers (such as oligo(dT)). Next, the cDNA is end-repaired, A-tailed, and connected to sequencing adapters to construct a sequencing library.

[0053] (3) Library quality control: The size distribution and concentration of the library were evaluated by agarose gel electrophoresis combined with Qubit 4.0 and QSep400 to ensure that the library was suitable for sequencing.

[0054] (4) Sequencing: Use a high-throughput sequencing platform (Illumina) to sequence the constructed library to generate a large number of short read sequences (reads).

[0055] (5) Data analysis: After completing the sequencing process, bioinformatics professional tools should be used for refined data processing. The specific steps include key links such as sequence alignment, quality control, transcript assembly, quantitative analysis, and differential expression analysis. Through these in-depth analyses, the patterns of gene expression and their functional relevance can be effectively identified, providing solid data support for subsequent research.

[0056] 1.11CCK-8 experiment:

[0057] (1) Cell preparation: Culture BHMT overexpression and control liver cancer cell lines; culture BHMT knockout and control liver cancer cell lines.

[0058] (2) Cell digestion: When using trypsin digestion solution to treat cells, it is necessary to ensure that the environmental conditions meet the standards, that is, cell digestion is performed under appropriate pH and temperature conditions. After cell digestion is completed, the cells are completely collected from the culture container by gentle blowing. Subsequently, the digestion solution containing the cells is transferred to a fresh test tube pre-filled with an appropriate amount of culture medium to effectively neutralize the activity of trypsin and ensure the smooth progress of the subsequent cell culture process.

[0059] (3) Centrifugation of cells: Centrifuge at 800 rpm / min for 5 min. After centrifugation, remove the digestion solution and resuspend the cells in fresh culture medium.

[0060] (4) Cell counting: Add the stained cell suspension to an automatic counting plate and insert the automatic counting plate into a cell counter for counting.

[0061] (5) Adjust the concentration of cell suspension: The concentration of the cell suspension was adjusted to 3 x 10 4 cells / mL.

[0062] (6) Plate: Using precision gun technology, the pre-prepared cell suspension is distributed in a uniform manner to a 96-well microplate to ensure that the cell density and volume in each microwell are highly consistent to meet the precise requirements of subsequent experiments and to ensure that 100 μL of cell suspension is accurately added to each well (note that six parallel wells should be set up for each group of experiments, and the number of cells in each well must be strictly controlled to 3000). At the same time, in order to ensure the rigor and accuracy of the experiment, six control groups are set up, each containing only 100 μL of complete culture medium without inoculating cells, in order to form a blank control. In order to eliminate the possible deviation of the experimental data caused by the edge effect, 100 μL of PBS is added to the wells around the experimental wells. Subsequently, the constructed 96-well microplate is smoothly transferred to a constant temperature incubator and incubated under standard cell culture conditions, i.e., 37°C and 5% carbon dioxide atmosphere, to promote cell reattachment and stable growth.

[0063] (7) After culturing for 6 hours and allowing the cells to completely adhere to the wall, mix the CCK-8 reagent with complete culture medium at a volume ratio of 1:10 to prepare the CCK-8 working solution. Subsequently, remove the original culture medium in the well plate, add the pre-prepared CCK-8 working solution to each well in a light-proof condition, ensure that each well is fully covered, and then incubate at a constant temperature of 37°C for 1.5 hours to fully stimulate cell activity. After the incubation process, remove the well plate cover and place the well plate in an ELISA reader. Under a strictly controlled environment, accurately measure the absorbance of each well at a wavelength of 450 nanometers, and record the data obtained in detail. The absorbance value measured at this moment is used as a quantitative benchmark for the initial proliferation state of the cells, that is, the starting point of cell proliferation after 6 hours of culture.

[0064] (8) After 24 h, 48 h, 72 h, 96 h, and 120 h of cell culture, prepare the CCK-8 working solution, remove the existing culture matrix in the well plate, and then add the pre-prepared CCK-8 working solution in a dark environment. Incubate at 37 °C for 1.5 h and then measure the absorbance.

[0065] (9) After statistically analyzing the absorbance values ​​of each experimental group, draw a line graph with 6 h of incubation as the origin.

[0066] 1.12 Clone formation experiment:

[0067] (1) Cell preparation: The specific method is the same as 1.11 CCK-8 experiment.

[0068] (2) Cell digestion: The specific method is the same as 1.11 CCK-8 experiment.

[0069] (3) Cell counting: The specific method is the same as 1.11 CCK-8 experiment.

[0070] (4) Preparation of cell suspension: According to experimental requirements, the cells were graded diluted with complete culture medium and the concentration was adjusted to 300 cells / mL.

[0071] (5) Add 2 mL of the prepared cell suspension to the 6-well plate, and then mix thoroughly to ensure uniform cell distribution. After confirming that the cells are completely evenly distributed in the wells under a microscope, transfer the 6-well culture plate to a constant temperature incubator (set at 37°C, 5% carbon dioxide concentration) for 14 days of continuous culture. During this period, strictly follow the established experimental operating procedures and replace the complete culture medium every four days to ensure the suitability and stability of the culture conditions.

[0072] (6) After 14 days, the cells were removed and washed twice with sterile PBS. The cells in the well plate were fixed with 4% paraformaldehyde at room temperature for 1 h and then washed twice with sterile PBS.

[0073] (7) Using 0.1% crystal violet dye, the cell population placed in the well plate was precisely stained for 15 minutes at standard room temperature. After discarding the dye, ultrapure double distilled water (ddH2O) was used to wash away the excess dye. After drying, images were collected and counted.

[0074] 1.13 Scratch test:

[0075] (1) Cell preparation: BHMT overexpression and control liver cancer cell lines, BHMT knockout and control liver cancer cell lines were seeded in 6-well plates.

[0076] (2) Creating scratches: When the cell confluence reaches 95% or more, use a 10 μL sterile pipette tip to make three even straight lines in each well of the 6-well plate and mark them.

[0077] (3) After removing the original culture medium, the sample is gently rinsed twice with PBS to remove nonspecific residues. Subsequently, 2 mL of serum-free culture medium is added to each independent well. Observe under a high-precision microscope and use professional imaging equipment to take pictures and record to ensure the accuracy and completeness of image acquisition. After completing the above steps, the entire well plate is smoothly transferred to a constant temperature incubator and set at 37°C and 5% carbon dioxide concentration to promote further culture and growth of cells.

[0078] (4) At 24 h after scratching, the original serum-free medium was removed again, and two rounds of washing were performed with PBS, and 2 mL of fresh serum-free medium was added. Observe carefully with the help of an optical microscope, and use imaging equipment to record the cell status.

[0079] 1.14 Transwell experiment:

[0080] (1) Cell preparation: The specific method is the same as 1.11 CCK-8 experiment.

[0081] (2) Cell digestion: The specific method is the same as that of 1.11 CCK-8 experiment, and serum-free culture medium is used for resuspension.

[0082] (3) Cell counting: The specific method is the same as 1.11 CCK-8 experiment.

[0083] (4) Preparation of cell suspension: Prepare cell suspensions of different concentrations using serum-free culture medium according to the characteristics of each cell line.

[0084] (5) Add complete culture medium containing serum components to the lower chamber of the transwell plate, and then add 200 μL of serum-depleted cell suspension to the upper chamber, which is prepared according to step (4) above. To avoid experimental errors, carefully confirm that there are no bubbles between the bottom of the chamber and the culture medium before smoothly transferring the plate to the incubator for culture. The specific conditions are set to a constant temperature of 37°C and a carbon dioxide concentration of 5% to simulate the in vivo environment and promote cell activity and experimental progress.

[0085] (5) After 48 hours of culture, the cells were removed and gently washed twice with PBS to remove surface impurities and ensure sample purity. The target cells were fixed with 4% paraformaldehyde solution at room temperature for 1 hour. Subsequently, the cells were washed twice with PBS to completely remove the residual fixative and ensure the accuracy and reliability of subsequent experiments. Finally, the cells inside the upper chamber were carefully wiped with a cotton swab to prepare for subsequent analysis.

[0086] (6) The fixative-treated chamber was stained with 0.1% crystal violet staining solution at standard room temperature for 15 min. After gentle washing with PBS, the residual dye in the upper chamber was wiped off with a cotton swab. After drying the chamber, images were collected under a 10x10 field of view under a microscope, and the collected data were then counted and statistically analyzed in detail.

[0087] 1.15 RT-qPCR experiments

[0088] (1) Extraction of mRNA from liver cancer cell lines: mRNA was extracted and purified from liver cancer cells through experimental steps such as cell lysis and transfer, mixing and stratification, centrifugation, precipitation, washing, and concentration determination, providing high-quality experimental materials for subsequent molecular biology research.

[0089] (2) Constructing a qRT-PCR reaction system: preparing the reagent combination required for quantitative real-time reverse transcription polymerase chain reaction (qRT-PCR) according to a predetermined ratio.

[0090] (3) qPCR reaction: Set up the reaction program on the ABI7500 PCR amplification instrument to perform qRT PCR.

[0091] (4) Data analysis: 2 -ΔΔCt Methods The relative transcriptional abundance of specific genes in cell lines was calculated, and the obtained data were visualized in the form of bar graphs after subsequent statistical tests.

[0092] 1.16 Methylation-specific PCR:

[0093] (1) Extraction of genomic DNA: Extract DNA from fresh human tissues and cells, perform cell digestion, lysis, protein removal, and DNA extraction and purification.

[0094] (2) Sodium bisulfite modification of DNA: The sodium bisulfite treatment technique can specifically convert unmethylated cytosine nucleotides into uracil nucleotides, while at the same time, those methylated cytosine nucleotides remain in their original state. This conversion process is specific and efficient, providing a key preliminary processing step for the accurate identification and quantification of DNA methylation status in subsequent high-throughput sequencing analysis.

[0095] (3) Purification of modified DNA: The treated DNA samples are purified to remove non-specific substances to ensure efficient amplification of the subsequent polymerase chain reaction (PCR).

[0096] (4) Preparation of PCR reaction system (50 μL in total): 5 μL of 10× PCR buffer was accurately added, 2.5 μL of a 25 mmol / L mixed solution of four deoxyribonucleoside triphosphates (NTPs) was added, 1 μL of each of the forward primer (concentration 300 ng / μL) and the reverse primer (concentration 300 ng / μL), the amount of DNA template was controlled at 2 μL, and ddH2O was added to 38.5 μL. Finally, to ensure the specificity and efficiency of the PCR reaction, 1.25 units (U) of Tag DNA polymerase was added.

[0097] (5) PCR reaction conditions were set as follows: pre-denaturation at 95°C for 5 min, addition of 1.25 U of Taq DNA polymerase; 95°C for 30 s, primer binding specific temperature for 30 s, 72°C for 30 s, 35 cycles; and final extension of the product at 72°C for 4 min.

[0098] (6) Analysis of PCR products: PCR products were analyzed by agarose gel electrophoresis to accurately detect and distinguish between methylated and unmethylated deoxyribonucleic acid (DNA) fragments.

[0099] (7) Data analysis: Based on the experimental data of electrophoresis analysis, this study adopted a systematic evaluation method to determine the methylation status of the target site. That is, by using methylation-specific primers and non-methylation-specific primers to perform PCR amplification on the target nucleic acid fragment, the methylation degree of the target site in the DNA sequence can be accurately determined.

[0100] 1.17 KEGG pathway enrichment analysis:

[0101] (1) KEGG pathway annotation

[0102] KAAS software was used to perform KEGG pathway annotation on the target gene set.

[0103] (2) Enrichment analysis of KEGG annotation

[0104] Fisher's Exact Test was used to compare the KEGG pathways in the target gene set and the overall gene set. KEGG pathway enrichment analysis was performed on a set of target genes.

[0105] 1.18 Gene Ontology (GO) analysis:

[0106] (1) GO functional annotation

[0107] By using the bioinformatics tool Blast2GO to perform functional annotation on the specified gene set, the entire process can be systematically summarized into four key steps: sequence alignment (Blast), ontology entry mapping (Mapping), gene ontology annotation (Annotation) and annotation enhancement (Annotation Augmentation) using InterProScan.

[0108] (2) Enrichment analysis of GO annotation

[0109] Fisher's Exact Test was used to compare the GO categories in the target gene set and the overall gene set to examine their distribution. Gene Ontology (GO) annotation enrichment analysis was performed on a set of target genes.

[0110] 2 Results

[0111] 2.1 Application of the biomarker BHMT in predicting and evaluating MVI of liver cancer

[0112] We performed proteomic analysis on cancer tissues and paired adjacent tissues from 40 patients with liver cancer and found that BHMT in liver cancer tissues was significantly lower than that in adjacent tissues ( Figure 1 A). The liver cancer patients were further divided into groups according to whether they had or did not have MVI. The results showed that the BHMT content in the cancer tissues of patients with MVI was significantly lower than that of patients without MVI ( Figure 1 B). The results showed that the incidence of MVI was higher in the group with low BHMT expression ( Figure 1 C). The results of BHMT immunohistochemical staining of liver cancer tissues also showed that the expression of BHMT in liver cancer tissues with MVI was significantly reduced ( Figure 1D). The above results show that BHMT can be used as a biomarker to predict and evaluate the probability of MVI in liver cancer patients, and to make early predictions and treatment preparations for the possibility of postoperative recurrence in liver cancer patients.

[0113] 2.2 Inhibitory effects of BHMT on proliferation and migration of liver cancer cells in vivo

[0114] We injected BALB / c nude mice subcutaneously with human liver cancer cell lines (HepG2 and HuH7) that stably overexpressed and knocked out BHMT. The results showed that knocking out BHMT significantly promoted the tumorigenicity and proliferation of liver cancer cells in vivo, while overexpressing BHMT significantly inhibited the tumorigenicity and proliferation of subcutaneous tumors in nude mice ( Figure 2 A, 2B). We further studied whether BHMT has the effect of inhibiting liver cancer cell metastasis in vivo by tail vein injection of wild-type liver cancer cell lines and liver cancer cell lines overexpressing BHMT. The results showed that the lung metastasis ability of the BALB / c nude mouse lung metastasis model injected with liver cancer cells overexpressing BHMT was significantly reduced ( Figure 2 C, 2D). The results showed that BHMT has the effect of inhibiting the metastasis of liver cancer cells to the lungs in vivo.

[0115] 2.3 Correlation between BHMT and immune cell infiltration in the tumor microenvironment

[0116] To further investigate the mechanism by which BHMT in liver cancer cells inhibits liver cancer metastasis in vivo, we analyzed the correlation between BHMT and immune cell infiltration in the tumor microenvironment. and M2 There is a significant negative correlation ( Figure 3 A). Immunohistochemistry was further used to detect the expression of BHMT, CD68 and CD206 in cancer tissue samples of liver cancer patients. The results showed that the expression level of BHMT in cancer tissue was significantly negatively correlated with the expression levels of CD68 and CD206 ( Figure 3 B) The results of immunohistochemical detection of lung metastasis tissues of BALB / c nude mice showed that the cancer tissues with low expression of BHMT had more and M2 infiltration( Figure 3 C). In addition, when BHMT expression was low in the above human liver cancer tissues and lung metastasis tissues, the mRNA levels of IL-12 and TNF were also low, while the mRNA levels of IL-10 and ARG1 were high ( Figure 3 D) The above results show that BHMT can affect Recruit and regulate M2 type polarization.

[0117] Effects of BHMT on PPAR signaling pathway

[0118] To study how BHMT affects liver cancer cells Recruitment and M2 type To investigate the mechanism of polarization, we performed RNA sequencing on BHMT knockout liver cancer cells (HuH7) and found that 382 genes were significantly upregulated and 186 genes were significantly downregulated compared with WT liver cancer cells ( Figure 4 A). KEGG pathway enrichment analysis of differentially expressed genes revealed that the PPAR signaling pathway was significantly enriched ( Figure 4 B). RT-qPCR experiments confirmed that BHMT significantly inhibited the expression of PPARγ, PPARα, PCK2, FABP1, FABP2, CYP27A1, ACOX2, CD36, and SLC27A4 ( Figure 4 C). Further WB experiments verified that knocking out BHMT in HuH7 cells could significantly promote the expression of PPARγ, while overexpression of BHMT significantly downregulated the expression of PPARγ ( Figure 4 D) The above results show that knocking out BHMT leads to enrichment of PPAR signaling pathway and significant increase in PPARγ expression. BHMT may affect Recruitment and M2 type polarization.

[0119] 2.5BHMT inhibits PPARγ expression by increasing PPARγ promoter methylation

[0120] To further determine the molecular mechanism of BHMT regulation of PPARγ transcription, we first analyzed whether the PPARγ promoter region contained typical CpG islands using the online software MethPrimer (http: / / www.urogene.org / methprimer). The results showed that both human and mouse promoter regions contained CpG islands ( Figure 5 A). The methylation-specific PCR method was used to detect the methylation level of PPARγ promoter in human liver cancer tissues and adjacent tissues. The results showed that the methylation level of PPARγ promoter in cancer tissues was increased ( Figure 5 B). We detected whether the methylation level of PPARγ promoter changed in HuH7 cells with BHMT knockout and overexpression. The results showed that the methylation level of PPARγ promoter decreased after BHMT knockout, while the methylation level of PPARγ promoter increased after BHMT overexpression ( Figure 5 C). The effects of knockout and overexpression of BHMT on the level of methyl donor SAM in HuH7 cells were then tested. The results showed that knockout of BHMT led to a significant decrease in the level of SAM, while overexpression of BHMT led to a significant increase in the level of SAM ( Figure 5D) This result suggests that BHMT may upregulate PPARγ promoter methylation through the production of SAM, thereby inhibiting PPARγ expression.

[0121] 2.6 Blocking CCL2 signaling can inhibit BHMT knockout-induced Recruitment and M2-type polarization

[0122] Gene ontology (GO) analysis was used to compare the differentially expressed genes in wild-type and BHMT knockout HuH7 cell transcriptome sequencing, and it was found that the differentially expressed genes were involved in innate immune activation, cytokine and chemokine activation ( Figure 6 A). RT-qPCR confirmed the The expression levels of recruitment and polarization-related chemokines CCL2, CCL3, CCL5, CCL7, CCL8, CCL13, CCL17, CCL22, CXCL1, CXCL9, CXCL10, CXCL11, EGF, and CSF1 in wild-type and BHMT knockout liver cancer cells were analyzed. The results showed that the expression level of CCL2 was most significantly increased in both BHMT knockout liver cancer cells ( Figure 6 B). CCL2 and shCCL2 lentiviral packaging plasmids were further constructed ( Figure 6 C) The lentiviral CCL2 packaging plasmid was transfected into HepG2 cells overexpressing BHMT. The results showed that BHMT overexpressing liver cancer cells transfected with CCL2 promoted the co-culture Migration ability and M2 type Polarization; on the contrary, blocking CCL2 signaling in BHMT liver cancer cells significantly reduced Migration ability and M2 type polarization( Figure 6 D, 6E). The above results indicate that blocking CCL2 signaling can inhibit the BHMT knockout-induced Recruitment and M2-type polarization.

[0123] 2.7 Antagonism of PPARγ inhibits the increase in CCL2 transcription and secretion caused by BHMT knockout

[0124] To investigate whether PPARγ is an important factor mediating BHMT inhibition of CCL2 transcription and secretion, we treated HuH7 cells with the PPARγ antagonist T0070907 to inhibit the PPARγ pathway. The results showed that after T0070907 treatment, both the transcription and secretion of CCL2 in wild-type hepatoma cells were inhibited ( Figure 7 A), and at the same time, the increase in CCL2 transcription and secretion levels caused by knocking out BHMT was also significantly reversed ( Figure 7 B). The above results indicate that antagonizing PPARγ can inhibit the increase in CCL2 transcription and secretion caused by BHMT knockout.

[0125] 3 Conclusion

[0126] The present invention detects the protein expression of BHMT in liver cancer tissue and corresponding adjacent tissues, and finds that the content of BHMT in liver cancer tissue is significantly reduced, and at the same time finds that the content of BHMT in cancer tissue of MVI patients is significantly reduced, which means that BHMT can be used as a biomarker to predict and evaluate the probability of MVI in liver cancer patients. Further, we injected the subcutaneous and tail vein of BALB / c nude mice with stably overexpressed liver cancer cell lines, and verified that overexpression of BHMT can significantly inhibit the proliferation and metastasis ability of liver cancer cells in vivo. We also further studied the relationship between BHMT and the PPARγ signaling pathway. The experimental results showed that knocking out BHMT led to enrichment of the PPAR signaling pathway in liver cancer cells, among which PPARγ expression was significantly increased; overexpression of BHMT can significantly increase the expression level of SAM, and then upregulate the methylation level of PPARγ promoter, so as to achieve the purpose of inhibiting the expression of PPARγ; after treating liver cancer cells with PPARγ antagonists, the transcription and secretion of chemokine CCL2 caused by BHMT knockout can be reversed. The above results show that in the development stage after liver cancer is formed, drugs that overexpress BHMT can inhibit the proliferation and migration of liver cancer cells by inhibiting the expression level of PPARγ, providing new treatment ideas and methods for the treatment of liver cancer and the prediction of postoperative metastasis and recurrence.

[0127] The above embodiments are only used to illustrate the technical solutions of the present invention, rather than to limit the same. Although the present invention has been described in detail with reference to the aforementioned embodiments, those skilled in the art should understand that the technical solutions described in the aforementioned embodiments may still be modified, or some of the technical features may be replaced by equivalents. However, these modifications or replacements do not deviate the essence of the corresponding technical solutions from the spirit and scope of the technical solutions of the embodiments of the present invention.

Claims

1. Based on the regulation and application of BHMT and PPARγ methylation in liver cancer cells, characterized in that: The application method is: overexpressing BHMT in liver cancer cells, upregulating the SAM expression level and PPARγ promoter methylation, and then inhibiting the PPARγ expression level.

2. Application of BHMT in the preparation of drugs that inhibit PPARγ transcription levels in liver cancer cells.

3. Application of BHMT in the preparation of drugs for upregulating the methylation level of PPARγ promoter in liver cancer cells.

4. The use according to any one of claims 2 to 3, characterized in that The drug contains any one of a vector, a recombinant plasmid, a lentivirus, and a fusion protein that overexpresses the BHMT gene or protein.

5. Application of BHMT as a biomarker in predicting and evaluating MVI of liver cancer.

Images