Yarrowia lipolytica engineering strain for efficiently producing eicosapentaenoic acid through cofactor strategy, construction method and application

Abstract

The invention belongs to the technical field of genetic engineering, and discloses a Yarrowia lipolytica engineering strain capable of efficiently producing eicosapentaenoic acid through a cofactor strategy, Yarrowia lipolytica Po1f is used as an original strain, and genes of delta 9 elongase, delta 8 desaturase, delta 5 desaturase and delta 17 desaturase are over-expressed, so that the eicosapentaenoic acid can be efficiently produced. And simultaneously overexpressing glucose-6-phosphate dehydrogenase (G6PDH) and malic enzyme (ME) to obtain the gene. The construction method is suitable for constructing a genetic engineering strain for producing eicosapentaenoic acid, the aim of simply, conveniently, effectively and accurately constructing the strain is achieved, the constructed engineering strain is further applied to production of eicosapentaenoic acid, and an effective way is provided for commercially producing eicosapentaenoic acid by applying yarrowia lipolytica.

Description

Technical Field

[0001] The invention belongs to the technical field of bioengineering, and relates to an engineering strain of Yarrowia lipolytica, in particular to an engineering strain of Yarrowia lipolytica capable of efficiently producing eicosapentaenoic acid through a cofactor strategy, a construction method and an application thereof. Background Art

[0002] Eicosapentaenoic acid (EPA) is a long-chain polyunsaturated fatty acid containing twenty carbon atoms and five double bonds, with a relative molecular mass of 302. It is an essential ω-3 polyunsaturated fatty acid for human health. Eicosapentaenoic acid is an essential fatty acid for human and animal health, and also has important physiological functions in preventing cancer, cardiovascular disease, diabetes and other diseases.

[0003] At present, a large amount of high-quality eicosapentaenoic acid is mainly extracted from deep-sea fish oil, but due to resource shortages and the unsustainability of deep-sea fish, the production of eicosapentaenoic acid is limited and cannot meet the growing market demand. Therefore, it is urgent to find new alternative sources to produce eicosapentaenoic acid.

[0004] Microbial fermentation has the advantages of being unrestricted by seasons, being able to be mass-produced, having stable yields, reliable quality, and having a wide range of fermentation materials at low prices. Yarrowia lipolytica contains abundant acetyl-CoA in its cells, and has high robustness and good growth performance, so it is considered to be an advantageous chassis strain for the industrial production of eicosapentaenoic acid. Currently, the use of Yarrowia lipolytica to produce polyunsaturated fatty acids has become a research hotspot.

[0005] The biosynthesis of eicosapentaenoic acid requires cofactors such as NADPH. NADPH used for fatty acid synthesis is mainly produced by malic enzyme (ME) and the pentose phosphate pathway (PPP). Malic enzyme is considered to be an important source of NADPH in fatty acid synthesis. Glucose-6-phosphate dehydrogenase (G6PDH), as a key enzyme in the pentose phosphate pathway (PPP), is also an important source of NADPH for fatty acid synthesis.

[0006] Currently, the existing technologies have only studied the effects of malic enzyme (ME) and glucose-6-phosphate dehydrogenase (G6PDH) separately, without exploring the combined effects of the two. Summary of the invention

[0007] The purpose of the present invention is to overcome the shortcomings of the prior art and provide an engineered strain of Yarrowia lipolytica for efficiently producing eicosapentaenoic acid through a cofactor strategy, a construction method and an application.

[0008] The technical solution adopted by the present invention to solve its technical problem is:

[0009] The invention discloses an engineered strain of Yarrowia lipolytica for efficiently producing eicosapentaenoic acid through a cofactor strategy. The engineered strain is obtained by taking Yarrowia lipolytica Po1f as a starting strain, overexpressing Δ9 elongase, Δ8 desaturase, Δ5 desaturase and Δ17 desaturase genes, and simultaneously overexpressing glucose-6-phosphate dehydrogenase (G6PDH) and malic enzyme (ME).

[0010] Furthermore, the Δ9 elongase is derived from Euglena gracilis (EgElo9), and its gene sequence is shown in SEQ ID No. 1;

[0011] The Δ8 desaturase is derived from Euglena gracilis (EgDes8), and its gene sequence is shown in SEQ ID No. 2;

[0012] The Δ5 desaturase is derived from Euglena gracilis (EgDes5), and its gene sequence is shown in SEQ ID No. 3;

[0013] The Δ17 desaturase is derived from Pythium aphanidermatum (PaDes17), and its gene sequence is shown in SEQ ID No. 4;

[0014] The glucose-6-phosphate dehydrogenase is derived from Yarrowia lipolytica (G6PDH), and its gene sequence is shown in SEQ ID No. 5;

[0015] The malic enzyme is derived from Yarrowia lipolytica (ME), and its gene sequence is shown in SEQ ID No.6.

[0016] Further, the following steps are included:

[0017] (1) Construction of recombinant plasmids pUC-SCP2-HUH-TE-EgElo9-EgDes8 and pUC-IntC-HUH-TE-EgDes5-PaDes17

[0018] Using pUC-SCP2-HUH-TE plasmid as a backbone, inserting EgElo9 and EgDes8 gene expression cassettes into the plasmid backbone, thus obtaining the recombinant plasmid pUC-SCP2-HUH-TE-EgElo9-EgDes8;

[0019] Using pUC-IntC-HUH-TE plasmid as a backbone, inserting EgDes5 and PaDes17 gene expression cassettes into the plasmid backbone, thus obtaining the recombinant plasmid pUC-IntC-HUH-TE-EgDes5-PaDes17;

[0020] (2) Construction of the genetically engineered strain Polf-D1 producing eicosapentaenoic acid

[0021] The recombinant plasmid pUC-SCP2-HUH-TE-EgElo9-EgDes8 was transferred into the uracil-deficient Yarrowia lipolytica Polf to obtain the Yarrowia lipolytica Polf-D0, and Polf-D0 was inoculated into the YPD-5FOA solid medium. After a single colony was grown, it was streaked and activated again in the YPD solid medium to obtain the Yarrowia lipolytica Polf-D0 (URA-); the recombinant plasmid pUC-IntC-HUH-TE-EgDes5-PaDes17 was transferred into the Yarrowia lipolytica Polf-D0 (URA-) to obtain the Yarrowia lipolytica engineered strain Polf-D1;

[0022] (3) Preparation of the engineered Yarrowia lipolytica strain Polf-D1 (URA-)

[0023] The engineered strain Polf-D1 of Yarrowia lipolytica was inoculated into YPD-5FOA solid medium, and after a single colony was grown, it was streaked and activated again in YPD solid medium to obtain the engineered strain Polf-D1 of Yarrowia lipolytica (URA-);

[0024] (4) Construction of recombinant plasmid pUC-intF3-HUH-TE-G6PDH

[0025] Using pUC-intF3-HUH-TE plasmid as a backbone, inserting the G6PDH gene expression cassette into the plasmid backbone, thus obtaining the recombinant plasmid pUC-intF3-HUH-TE-G6PDH;

[0026] (5) Preparation of the engineered strain Polf-D2 of Yarrowia lipolytica

[0027] The recombinant plasmid pUC-intF3-HUH-TE-G6PDH was transformed into the Yarrowia lipolytica engineering strain Polf-D1 (URA-) to obtain the Yarrowia lipolytica engineering strain Polf-D2;

[0028] (6) Construction of recombinant plasmid pUC-intF3-HUH-TE-ME

[0029] Using pUC-intF3-HUH-TE plasmid as a backbone, inserting the ME gene expression cassette into the plasmid backbone, thus obtaining the recombinant plasmid pUC-intF3-HUH-TE-ME;

[0030] (7) Preparation of the engineered strain Polf-D3 of Yarrowia lipolytica

[0031] The recombinant plasmid pUC-intF3-HUH-TE-ME was transformed into the Yarrowia lipolytica engineering strain Polf-D1 (URA-) to obtain the Yarrowia lipolytica engineering strain Polf-D3;

[0032] (8) Construction of recombinant plasmid pUC-intF3-HUH-TE-G6PDH-ME

[0033] Using pUC-intF3-HUH-TE plasmid as a skeleton, inserting the G6PDH gene expression cassette and the ME gene expression cassette into the plasmid skeleton, thus obtaining the recombinant plasmid pUC-intF3-HUH-TE-G6PDH-ME;

[0034] (9) Preparation of the engineered strain Polf-D4 of Yarrowia lipolytica

[0035] The recombinant plasmid pUC-intF3-HUH-TE-G6PDH-ME was transformed into the Yarrowia lipolytica engineering strain Polf-D1 (URA-) to obtain the Yarrowia lipolytica engineering strain Polf-D4.

[0036] Furthermore, in step (2), the method for constructing the uracil auxotrophic Yarrowia lipolytica Po1f is to knock out the uracil encoding gene in Yarrowia lipolytica Po1f by using CRISPR / Cas9 technology.

[0037] Furthermore, the construction method of the recombinant plasmids pUC-SCP2-HUH-TE-EgElo9-EgDes8 and pUC-IntC-HUH-TE-EgDes5-PaDes17 in step (1) is as follows: using the pUC-SCP2-HUH-TE plasmid with a uracil genetic marker as a backbone, inserting a Δ9 elongase gene expression cassette and a Δ8 desaturase gene expression cassette into the plasmid backbone, and obtaining pUC-SCP2-HUH-TE-EgElo9-EgDes8. Using the pUC-IntC-HUH-TE plasmid with a uracil genetic marker as a backbone, inserting a Δ5 desaturase gene expression cassette and a Δ17 desaturase gene expression cassette into the plasmid backbone, and obtaining

[0038] pUC-IntC-HUH-TE-EgDes5-PaDes17.

[0039] Furthermore, in step (1), the promoters of the Δ9 elongase gene expression cassette, the Δ8 desaturase gene expression cassette, the Δ5 desaturase gene expression cassette and the Δ17 desaturase gene expression cassette are derived from P TEF Promoter, P EXP Promoter, P FBAin Promoter or P YAT The terminator is T from Yarrowia lipolytica. CYC1t Terminator, T xpr2t Terminator or T lip2t One of the terminators;

[0040] In step (4) and step (8), the G6PDH gene expression cassette promoter is P derived from Yarrowia lipolytica. TEF Promoter, P EXP Promoter, P FBAin Promoter or P YAT The terminator is T from Yarrowia lipolytica. CYC1t Terminator, T xpr2t Terminator or T lip2t One of the terminators;

[0041] In step (6) and step (8), the ME gene expression cassette promoter is P derived from Yarrowia lipolytica TEF Promoter, P EXP Promoter, P FBAin Promoter or P YAT The terminator is T from Yarrowia lipolytica. CYC1t Terminator, T xpr2t Terminator or T lip2t A type of terminator.

[0042] Use of the engineered strain of Yarrowia lipolytica as described above in producing eicosapentaenoic acid.

[0043] A method for producing eicosapentaenoic acid by fermentation using the Yarrowia lipolytica engineered strain as described above, wherein the Yarrowia lipolytica engineered strain produces eicosapentaenoic acid by fermentation on a fermentation medium;

[0044] The formula of the fermentation medium is: 1.7 g / L YNB without amino acid and ammonium sulfate, 2.5 g / L yeast powder, 60 g / L glucose, the solvent is pure water, and sterilized at 115° C. for 30 minutes.

[0045] Further, the following steps are included:

[0046] (1) Preparation of seed solution

[0047] The Yarrowia lipolytica engineered strain was activated, inoculated into a YPD liquid medium, and cultured to a logarithmic growth phase to obtain a seed solution;

[0048] (2) Fermentation production of eicosapentaenoic acid

[0049] Inoculating the seed liquid into the fermentation medium at a volume ratio of 1% to 5%, fermenting at 28 to 30° C. and 200 to 240 rpm, and cultivating with ventilation for 96 to 120 hours to obtain the fermentation product eicosapentaenoic acid;

[0050] The formula of the fermentation medium is: 1.7 g / L YNB without amino acids and ammonium sulfate, 2.5 g / L yeast powder, 60 g / L glucose, the solvent is pure water, and sterilized at 115°C for 30 minutes.

[0051] Furthermore, the number of viable bacteria in the seed solution in step (1) is 1.5×10 8 ~2.5×10 8 CFU / mL.

[0052] The advantages and positive effects achieved by the present invention are:

[0053] 1. The present invention uses Yarrowia lipolytica as a starting strain, overexpresses Δ9 elongase, Δ8 desaturase, Δ5 desaturase and Δ17 desaturase genes, and simultaneously overexpresses glucose-6-phosphate dehydrogenase (G6PDH) and malic enzyme (ME) genes to increase the content of eicosapentaenoic acid; the present invention is suitable for constructing a genetically engineered strain that produces eicosapentaenoic acid, so as to achieve the goal of simply, effectively and accurately constructing the strain, and the constructed engineered strain is further used in the production of eicosapentaenoic acid, providing an effective way for the commercial production of eicosapentaenoic acid using Yarrowia lipolytica.

[0054] 2. The present invention constructs three recombinant plasmids containing uracil genetic markers, namely pUC-SCP2-HUH-TE-EgElo9-EgDes8, pUC-IntC-HUH-TE-EgDes5-PaDes17 and pUC-intF3-HUH-TE-G6PDH-ME, and then introduces them into the uracil auxotrophic Yarrowia lipolytica strain to improve the stability of the exogenous gene during the insertion process, thereby improving the stability of the engineered strain.

[0055] 3. The present invention screens the engineered strain intermediate by inoculating it into a solid culture medium containing 5-FOA. The cells discard uracil, and the engineered strain intermediate becomes a uracil-deficient strain, thereby realizing the recycling of the uracil screening marker.

[0056] 4. The Yarrowia lipolytica engineered strain constructed by the present invention can synthesize eicosapentaenoic acid in a fermentation medium, providing an eicosapentaenoic acid synthesis pathway with the advantages of no time limit, large-scale production, stable yield, reliable quality, wide source of fermentation substrates, and low cost.

[0057] 5. The present invention provides a genetically engineered strain for producing eicosapentaenoic acid, a construction method and an application thereof. First, Δ9 elongase, Δ8 desaturase, Δ5 desaturase genes from Euglena gracilis and Δ17 desaturase genes from Pythium aphanidermatum are expressed in Yarrowia lipolytica, and then the engineered strain overexpressing glucose-6-phosphate dehydrogenase and malic enzyme respectively or overexpressing glucose-6-phosphate dehydrogenase and malic enzyme simultaneously synthesizes eicosapentaenoic acid in a fermentation medium. The engineered bacteria have good stability, a high content of eicosapentaenoic acid in intracellular oil, a synthesis pathway is not limited by time, the yield is stable, and the cost of the fermentation substrate is low.

[0058] 6. The present invention is suitable for constructing a genetically engineered strain that produces eicosapentaenoic acid, and the constructed engineered strain is further used for producing eicosapentaenoic acid.

[0059] 7. The present invention increases the production of eicosapentaenoic acid by increasing the content of cofactors such as NADPH in Yarrowia lipolytica. NADPH plays an important role in the metabolic pathway of Yarrowia lipolytica. Increasing the content of NADPH can effectively increase the production of eicosapentaenoic acid, and ultimately constructs an engineered strain of Yarrowia lipolytica that efficiently produces eicosapentaenoic acid. BRIEF DESCRIPTION OF THE DRAWINGS

[0060] Figure 1 is a diagram of the mechanism for producing eicosapentaenoic acid in the context of the present invention;

[0061] Figure 2 is a skeleton diagram of the recombinant plasmid pUC-SCP2-HUH-TE-EgElo9-EgDes8 in Example 1 of the present invention;

[0062] Figure 3 is a skeleton diagram of the recombinant plasmid pUC-IntC-HUH-TE-EgDes5-PaDes17 in Example 1 of the present invention;

[0063] Figure 4 is a skeleton diagram of the recombinant plasmid pUC-intF3-HUH-TE-G6PDH in Example 2 of the present invention;

[0064] Figure 5 is a skeleton diagram of the recombinant plasmid pUC-intF3-HUH-TE-ME in Example 2 of the present invention;

[0065] Figure 6 is a skeleton diagram of the recombinant plasmid pUC-intF3-HUH-TE-G6PDH-ME in Example 2 of the present invention;

[0066] Figure 7 This is a diagram of oil yield after fermentation of the engineered strains Polf-D1, Polf-D2, Polf-D3 and Polf-D4 in Example 4 of the present invention;

[0067] Figure 8 This is a graph showing the eicosapentaenoic acid production after fermentation of the engineered strains Polf-D1, Polf-D2, Polf-D3 and Polf-D4 in Example 4 of the present invention;

[0068] Fig. 9 This is a graph showing the eicosapentaenoic acid content of the engineered strains Polf-D1, Polf-D2, Polf-D3 and Polf-D4 after fermentation in Example 4 of the present invention. DETAILED DESCRIPTION

[0069] The present invention will be further described below in conjunction with the embodiments. The following embodiments are descriptive rather than restrictive, and the protection scope of the present invention cannot be limited by the following embodiments.

[0070] The various experimental operations involved in the specific embodiments are all routine techniques in the art. For parts not specially annotated in this document, ordinary technicians in the art can implement them by referring to various commonly used reference books, scientific and technological literature or related instructions, manuals, etc. before the filing date of this invention.

[0071] A genetically engineered strain for efficiently producing eicosapentaenoic acid through a cofactor strategy, which uses Yarrowia lipolytica Po1f as a starting strain, expresses a Δ9 elongase gene, a Δ8 desaturase gene, a Δ5 desaturase gene, and a Δ17 desaturase gene, and synergistically overexpresses glucose-6-phosphate dehydrogenase (G6PDH) and malic enzyme (ME). Figure 1 shown.

[0072] As a limitation of the present invention, the Δ9 elongase gene is derived from Euglena gracilis (EgElo9), and the EgElo9 gene sequence is shown in SEQ ID No. 1, specifically:

[0073] ATGGAGGTCGTGAACGAAATCGTCTCCATTGGCCAGGAGGTTCTTCCCAAGGTCGACTATGCTCAGCTCTGGTCTGATGCCTCGCACTGCGAGGTGCTGTACCTCTCCATCGCCTTCGTCATCCTGAAGTTCACCCTTGGTCCTCTCGGACCCAAGGGTCAGTCTCGAATGAAGTTTGTGTTCACCAACTACAACCTGCTCATGTCCATCTACTCGCTGGGCTCCTTCCTCTCTATGGCCTACGCCATGTACACCATTGGTGTCATGTCCGACAACTGCGAGAAGGCTTTCGACAACAATGTCTTCCGAATCACCACTCAGCTGTTCTACCTCAGCAAGTTCCTCGAGTACATTGACTCCTTCTATCTGCCCCTCATGGGCAAGCCTCTGACCTGGTTGCAGTTCTTTCACCATCTCGGAGCTCCTATGGACATGTGGCTGTTCTACAACTACCGAAACGAAGCCGTTTGGATCTTTGTGCTGCTCAACGGCTTCATTCACTGGATCATGTACGGCTACTATTGGACCCGACTGATCAAGCTCAAGTTCCCTATGCCCAAGTCCCTGATTACTTCTATGCAGATCATTCAGTTCAACGTTGGCTTCTACATCGTCTGGAAGTACCGGAACATTCCCTGCTACCGACAAGATGGAATGAGAATGTTTGGCTGGTTTTTCAACTACTTCTACGTTGGTACTGTCCTGTGTCTGTTCCTCAACTTCTACGTGCAGACCTACATCGTCCGAAAGCACAAGGGAGCCAAAAAGATTCAGTGA

[0074] As a limitation of the present invention, the Δ8 desaturase gene is derived from Euglena gracilis (EgDes8), and the EgDes8 gene sequence is shown in SEQ ID No. 2, specifically:

[0075]

[0076] As a limitation of the present invention, the Δ5 desaturase gene is derived from Euglena gracilis (EgDes5), and the EgDes5 gene sequence is shown in SEQ ID No. 3, specifically:

[0077]

[0078] As a limitation of the present invention, the Δ17 desaturase gene is derived from Pythiumaphanidermatum (PaDes17), and the PaDes17 gene sequence is shown in SEQ ID No. 4, specifically:

[0079]

[0080] As a limitation of the present invention, the glucose-6-phosphate dehydrogenase (G6PDH) is derived from Yarrowialipolytica, and the G6PDH gene sequence is shown in SEQ ID No.5, specifically:

[0081]

[0082] As a limitation of the present invention, the malic enzyme (ME) is derived from Yarrowia lipolytica, and the ME gene sequence is shown in SEQ ID No.6, specifically:

[0083]

[0084] The present invention also provides a method for constructing the above strain, which comprises the following steps:

[0085] (1) Construction of recombinant plasmids pUC-SCP2-HUH-TE-EgElo9-EgDes8 and pUC-IntC-HUH-TE-EgDes5-PaDes17

[0086] Using pUC-SCP2-HUH-TE plasmid as a backbone, inserting EgElo9 and EgDes8 gene expression cassettes into the plasmid backbone, thus obtaining the recombinant plasmid pUC-SCP2-HUH-TE-EgElo9-EgDes8;

[0087] Using pUC-IntC-HUH-TE plasmid as a backbone, inserting EgDes5 and PaDes17 gene expression cassettes into the plasmid backbone, thus obtaining the recombinant plasmid pUC-IntC-HUH-TE-EgDes5-PaDes17;

[0088] (2) Construction of the genetically engineered strain Polf-D1 producing eicosapentaenoic acid

[0089] The recombinant plasmid pUC-SCP2-HUH-TE-EgElo9-EgDes8 was transferred into the uracil-deficient Yarrowia lipolytica Polf to obtain the Yarrowia lipolytica Polf-D0, and Polf-D0 was inoculated into the YPD-5FOA solid medium. After a single colony was grown, it was streaked and activated again in the YPD solid medium to obtain the Yarrowia lipolytica Polf-D0 (URA-); the recombinant plasmid pUC-IntC-HUH-TE-EgDes5-PaDes17 was transferred into the Yarrowia lipolytica Polf-D0 (URA-) to obtain the Yarrowia lipolytica engineered strain Polf-D1;

[0090] (3) Preparation of the engineered Yarrowia lipolytica strain Polf-D1 (URA-)

[0091] The engineered strain Polf-D1 of Yarrowia lipolytica was inoculated into YPD-5FOA solid medium, and after a single colony was grown, it was streaked and activated again in YPD solid medium to obtain the engineered strain Polf-D1 of Yarrowia lipolytica (URA-);

[0092] (4) Construction of recombinant plasmid pUC-intF3-HUH-TE-G6PDH

[0093] Using pUC-intF3-HUH-TE plasmid as a backbone, inserting the G6PDH gene expression cassette into the plasmid backbone, thus obtaining the recombinant plasmid pUC-intF3-HUH-TE-G6PDH;

[0094] (5) Preparation of the engineered strain Polf-D2 of Yarrowia lipolytica

[0095] The recombinant plasmid pUC-intF3-HUH-TE-G6PDH was transformed into the Yarrowia lipolytica engineering strain Polf-D1 (URA-) to obtain the Yarrowia lipolytica engineering strain Polf-D2;

[0096] (6) Construction of recombinant plasmid pUC-intF3-HUH-TE-ME

[0097] Using pUC-intF3-HUH-TE plasmid as a backbone, inserting the ME gene expression cassette into the plasmid backbone, thus obtaining the recombinant plasmid pUC-intF3-HUH-TE-ME;

[0098] (7) Preparation of the engineered strain Polf-D3 of Yarrowia lipolytica

[0099] The recombinant plasmid pUC-intF3-HUH-TE-ME was transformed into the Yarrowia lipolytica engineering strain Polf-D1 (URA-) to obtain the Yarrowia lipolytica engineering strain Polf-D3;

[0100] (8) Construction of recombinant plasmid pUC-intF3-HUH-TE-G6PDH-ME

[0101] Using pUC-intF3-HUH-TE plasmid as a skeleton, inserting the G6PDH gene expression cassette and the ME gene expression cassette into the plasmid skeleton, thus obtaining the recombinant plasmid pUC-intF3-HUH-TE-G6PDH-ME;

[0102] (9) Preparation of the engineered strain Polf-D4 of Yarrowia lipolytica

[0103] The recombinant plasmid pUC-intF3-HUH-TE-G6PDH-ME was transformed into the Yarrowia lipolytica engineering strain Polf-D1 (URA-) to obtain the Yarrowia lipolytica engineering strain Polf-D4;

[0104] As a limitation, the method for constructing the uracil auxotrophic Yarrowia lipolytica Po1f in step (2) is to knock out the uracil encoding gene in Yarrowia lipolytica Po1f by using CRISPR / Cas9 technology;

[0105] The specific construction method is prepared according to the method described in the Journal of Agricultural and Food Chemistry, Volume 69, Issue 46, 2021, Pages 13831-13837, and the paper title is "Harnessing Yarrowia lipolytica Peroxisomes as a Subcellular Factory for α-Humulene Overproduction".

[0106] The recombinant plasmid pUC-SCP2-HUH-TE-EgElo9-EgDes8 in step (1),

[0107] The construction method of pUC-IntC-HUH-TE-EgDes5-PaDes17 is as follows: using the pUC-SCP2-HUH-TE plasmid with a uracil genetic marker as a backbone, inserting a Δ9 elongase gene expression cassette and a Δ8 desaturase gene expression cassette into the plasmid backbone to obtain pUC-SCP2-HUH-TE-EgElo9-EgDes8. Using the pUC-IntC-HUH-TE plasmid with a uracil genetic marker as a backbone, inserting a Δ5 desaturase gene expression cassette and a Δ17 desaturase gene expression cassette into the plasmid backbone to obtain

[0108] pUC-IntC-HUH-TE-EgDes5-PaDes17.

[0109] As a further limitation, in step (1), the promoters of the Δ9 elongase gene expression cassette, the Δ8 desaturase gene expression cassette, the Δ5 desaturase gene expression cassette and the Δ17 desaturase gene expression cassette are derived from P TEF Promoter, P EXP Promoter, P FBAin Promoter or P YAT The terminator is T from Yarrowia lipolytica. CYC1t Terminator, T xpr2t Terminator or T lip2t A type of terminator.

[0110] In steps (4) and (8), the G6PDH gene expression cassette promoter is P derived from Yarrowia lipolytica. TEF Promoter, P EXP Promoter, P FBAin Promoter or P YAT The terminator is T from Yarrowia lipolytica. CYC1t Terminator, T xpr2t Terminator or T lip2tA type of terminator.

[0111] In steps (6) and (8), the ME gene expression cassette promoter is P derived from Yarrowia lipolytica. TEF Promoter, P EXP Promoter, P FBAin Promoter or P YAT The terminator is T from Yarrowia lipolytica. CYC1t Terminator, T xpr2t Terminator or T lip2t A type of terminator.

[0112] As a limitation to the application of the genetically engineered strain producing eicosapentaenoic acid, the fermentation comprises the following steps:

[0113] (1) Preparation of seed solution

[0114] activating the eicosapentaenoic acid-producing genetically engineered strain, inoculating it into a YPD liquid culture medium, and culturing it to a logarithmic growth phase to obtain a seed solution;

[0115] (2) Fermentation production of eicosapentaenoic acid

[0116] The seed liquid is inoculated into the fermentation medium at a volume ratio of 1% to 5%, and the culture is carried out under ventilation for 96 to 120 hours at 28 to 30° C. and 200 to 240 rpm to obtain the fermentation product eicosapentaenoic acid.

[0117] The formula of the fermentation medium is: YNB (without amino acids and ammonium sulfate) 1.7 g / L, yeast powder 2.5 g / L, glucose 60 g / L, sterilized at 115°C for 30 minutes.

[0118] As a further limitation of the above fermentation, in step (1), the number of viable bacteria in the seed solution is 1.5×10 8 ~2.5×10 8 CFU / mL;

[0119] Due to the adoption of the above technical solution, the present invention has the following technical advances compared with the prior art:

[0120] ① The present invention constructs three recombinant plasmids containing uracil genetic markers, namely pUC-SCP2-HUH-TE-EgElo9-EgDes8, pUC-IntC-HUH-TE-EgDes5-PaDes17 and pUC-intF3-HUH-TE-G6PDH-ME, and then introduces them into the uracil auxotrophic Yarrowia lipolytica strain to improve the stability of the exogenous gene during the insertion process, thereby improving the stability of the engineered strain;

[0121] ② The present invention screens the engineered strain intermediate by inoculating it into a solid culture medium containing 5-FOA, and the cells discard uracil, and the engineered strain intermediate becomes a uracil-deficient strain, thereby realizing the recycling of uracil screening markers;

[0122] ③ The Yarrowia lipolytica engineered strain constructed by the present invention can synthesize eicosapentaenoic acid in a fermentation medium, providing an eicosapentaenoic acid synthesis pathway with the advantages of no time limit, large-scale production, stable yield, reliable quality, wide source of fermentation substrates, and low cost.

[0123] In summary, the present invention provides a genetically engineered strain for producing eicosapentaenoic acid, a construction method and an application thereof. First, Δ9 elongase, Δ8 desaturase, Δ5 desaturase genes from Euglena gracilis and Δ17 desaturase genes from Pythium aphanidermatum are expressed in Yarrowia lipolytica, and then the engineered strain overexpressing glucose-6-phosphate dehydrogenase and malic enzyme respectively or overexpressing glucose-6-phosphate dehydrogenase and malic enzyme simultaneously synthesizes eicosapentaenoic acid in a fermentation medium. The engineered bacteria have good stability, high content of eicosapentaenoic acid in intracellular oil, the synthesis pathway is not limited by time, the yield is stable, and the cost of the fermentation substrate is low.

[0124] The invention is suitable for constructing a genetic engineering strain producing eicosapentaenoic acid, and the constructed engineering strain is further used for producing eicosapentaenoic acid.

[0125] Specifically, the relevant preparation and detection are as follows:

[0126] Although the present example uses Yarrowia lipolytica Po1f as the starting strain, any conventional uracil auxotrophic Yarrowia lipolytica can be used as the starting strain for transformation to carry out the experiments in the example.

[0127] The Yarrowia lipolytica used in the present application is capable of synthesizing C16 and C18 long-chain fatty acids. To this end, the Δ9 elongase, Δ8 desaturase, Δ5 desaturase from Euglena gracilis and the Δ17 desaturase from Pythiumaphanidermatum were transformed into the uracil-auxotrophic Yarrowia lipolytica Po1f to construct it.

[0128] Example 1 Construction of the Yarrowia lipolytica engineered strain Polf-D1 engineered strain for producing eicosapentaenoic acid

[0129] 1. Construction of the Uracil Auxotrophic Yarrowia lipolytica Polf

[0130] This section is about the construction of uracil-auxotrophic Yarrowia lipolytica Po1f. The construction method is as follows: 1200bp upstream and downstream of the gene sequence encoding uracil are selected as homology arms, and the gene sequence encoding uracil in Yarrowia lipolytica Po1f is knocked out using CRISPR / Cas9 technology to obtain uracil-auxotrophic Yarrowia lipolytica Po1f (URA-).

[0131] The specific construction method is prepared according to the method described in the Journal of Agricultural and Food Chemistry, Volume 69, Issue 46, 2021, Pages 13831-13837, and the paper title is "Harnessing Yarrowia lipolytica Peroxisomes as a Subcellular Factory for α-Humulene Overproduction".

[0132] 2. Construction of recombinant plasmids pUC-SCP2-HUH-TE-EgElo9-EgDes8 and pUC-IntC-HUH-TE-EgDes5-PaDes17

[0133] S1. The optimized Δ9 elongase gene, Δ8 desaturase gene, Δ5 desaturase gene from Euglena gracilis and the Δ17 desaturase gene from Pythium aphanidermatum were synthesized to obtain codon-optimized Δ9 elongase gene, Δ8 desaturase gene, Δ5 desaturase gene and Δ17 desaturase gene, whose nucleotide sequences are shown in the sequence listing SEQ ID No.1, SEQ ID No.2, SEQ ID No.3 and SEQ ID No.4.

[0134] S2. Amplification of target gene

[0135] S21. Using the Δ9 elongase gene, Δ8 desaturase gene, Δ5 desaturase gene and Δ17 desaturase gene synthesized in step S1 as templates, PCR amplification was performed using EgElo9-F (nucleotide sequence as shown in SEQ ID NO.19) and EgElo9-R (nucleotide sequence as shown in SEQ ID NO.20) as primers to obtain the amplified fragment EgElo9; PCR amplification was performed using EgDes8-F (nucleotide sequence as shown in SEQ ID NO.21) and EgDes8-R (nucleotide sequence as shown in SEQ ID NO.22) as primers to obtain the amplified fragment EgDes8; PCR amplification was performed using EgDes5-F (nucleotide sequence as shown in SEQ ID NO.23) and EgDes5-R (nucleotide sequence as shown in SEQ ID NO.24) as primers to obtain the amplified fragment EgDes5; PaDes17-F (nucleotide sequence as shown in SEQ ID NO.25) and PaDes17-R (nucleotide sequence as shown in SEQ ID PCR amplification was performed using primers (shown in Figure 26) to obtain the amplified fragment PaDes17;

[0136] S22. Using the Yarrowia lipolytica genome as a template and TEF-F and TEF-R genes as primers, PCR amplification was performed to obtain promoter P TEF , whose gene sequence is shown in SEQ ID NO.27;

[0137] S23. Using the Yarrowia lipolytica genome as a template and CYC1t-F and CYC1t-R genes as primers, PCR amplification was performed to obtain the terminator T CYC1t , whose gene sequence is shown in SEQ ID NO.28;

[0138] S24. Using the Yarrowia lipolytica genome as a template and EXP-F and EXP-R genes as primers, PCR amplification was performed to obtain promoter P EXP , whose gene sequence is shown in SEQ ID NO.29;

[0139] S25. Using the Yarrowia lipolytica genome as a template and xpr2t-F and xpr2t-R genes as primers, PCR amplification was performed to obtain the terminator T xpr2t , whose gene sequence is shown in SEQ ID NO.30;

[0140] S26. Using the Yarrowia lipolytica genome as a template and FBA-F and FBA-R genes as primers, PCR amplification was performed to obtain promoter P FBA , whose gene sequence is shown in SEQ ID NO.31;

[0141] S27. Using the Yarrowia lipolytica genome as a template and YAT-F and YAT-R genes as primers, PCR amplification was performed to obtain the promoter P YAT , whose gene sequence is shown in SEQ ID NO.32;

[0142] in,

[0143] ①The gene sequence of TEF-F is shown in SEQ ID NO.7, specifically:

[0144] ATTGACTGGAACAGCTTAATAGAGACCGGGTTTGGCGGCGT

[0145] ②The gene sequence of TEF-R is shown in SEQ ID NO.8, specifically:

[0146] ATTTCGTCACGACCTCCATTTTGAATGATTCTTATACTC

[0147] ③The gene sequence of CYC1t-F is shown in SEQ ID NO.9, specifically:

[0148] GAGCCAAAAAGATTCAGTGATCATGTAATTAGTTATGTCA

[0149] ④The gene sequence of CYC1t-R is shown in SEQ ID NO.10, specifically:

[0150] AAAAACGGGCGCCAAACTCCGCAAATTAAAGCCTTCGAGC

[0151] ⑤The gene sequence of EXP-F is shown in SEQ ID NO.11, specifically:

[0152] GCTCGAAGGCTTTAATTTGCGGAGTTTGGCGCCCGTTTTT

[0153] ⑥The gene sequence of EXP-R is shown in SEQ ID NO.12, specifically:

[0154] TGTCGCTTGGACTTCACCATTGCTGTAGATATGTCTTGTG

[0155] ⑦The gene sequence of xpr2t-F is shown in SEQ ID NO.13, specifically:

[0156] CCGCTGGCAAGGCTTCTAAGATCCAACTACGGAACTTGT

[0157] ⑧The gene sequence of xpr2t-R is shown in SEQ ID NO.14, specifically:

[0158] TTGAAGCTTGGTACCTTAATGACACGGGCATCTCACTTGC

[0159] ⑨The gene sequence of FBA-F is shown in SEQ ID NO.15, specifically:

[0160] ATTGACTGGAACAGCTTAATGTACGTAGCAACAACAGTGT

[0161] ⑩The gene sequence of FBA-R is shown in SEQ ID NO.16, specifically:

[0162] GTAGTAAGGGAGAGAGCCATTGTGTGATGTGTAGTTTAGA

[0163] The gene sequence of YAT-F is shown in SEQ ID NO.17, specifically:

[0164] GCTCGAAGGCTTTAATTTGCACATGGTTTTTAGGGGGTAC

[0165] The gene sequence of YAT-R is shown in SEQ ID NO.18, specifically:

[0166] GCAACGGTAGAGGAAGCCATTGTTGAACGAGCGACTTGGG

[0167] The PCR procedure was as follows: denaturation at 98°C for 10 s, annealing at 56°C for 10 s, extension at 72°C for 2 min (extension time = target fragment length / 1 kb, unit: min), and repeated for 35 cycles.

[0168] S3. Purify and recover each target gene (referring to the gene amplified by PCR) using AxyPrepTM DNAGel Extraction Kit (purchased from Corning Life Sciences Co., Ltd.);

[0169] S4. The pUC-SCP2-HUH-TE plasmid (the sequence of the pUC-SCP2-HUH-TE plasmid is shown below) carrying a uracil genetic marker was digested with BamH1 enzyme, and EgElo9 was connected to the pUC-SCP2-HUH-TE plasmid backbone after digestion, and the ClonExpress MultiS One Step Cloning Kit was used for one-step assembly to construct the recombinant plasmid pUC-SCP2-HUH-TE-EgElo9 carrying a uracil genetic marker;

[0170] The pUC-SCP2-HUH-TE-EgElo9 plasmid with a uracil genetic marker was digested with Pac1 enzyme, and EgDes8 was connected to the pUC-SCP2-HUH-TE-EgElo9 plasmid backbone after digestion. The recombinant plasmid pUC-SCP2-HUH-TE-EgElo9-EgDes8 with a uracil genetic marker was constructed by one-step assembly using ClonExpress MultiS OneStep Cloning Kit.

[0171] S5. The pUC-IntC-HUH-TE plasmid with a uracil genetic marker (the sequence of the pUC-IntC-HUH-TE plasmid is shown below) was digested with BamH1 enzyme, and EgDes5 was connected to the pUC-IntC-HUH-TE plasmid backbone after digestion, and the ClonExpress MultiS One Step Cloning Kit was used for one-step assembly to construct the recombinant plasmid pUC-IntC-HUH-TE-EgDes5 with a uracil genetic marker;

[0172] The pUC-IntC-HUH-TE-EgDes5 plasmid with a uracil genetic marker was digested with Pac1 enzyme, and PaDes17 was connected to the pUC-IntC-HUH-TE-EgDes5 plasmid backbone after digestion. The recombinant plasmid pUC-IntC-HUH-TE-EgDes5-PaDes17 with a uracil genetic marker was constructed by one-step assembly using ClonExpress MultiS OneStep Cloning Kit.

[0173] S6. The circular recombinant plasmid was transformed into Escherichia coli DH5a competent cells, and the positive recombinant plasmids pUC-SCP2-HUH-TE-EgElo9-EgDes8 and pUC-IntC-HUH-TE-EgDes5-PaDes17 were obtained by plate screening of ampicillin resistance (final concentration of 50 mg / L) and verification by colony PCR and sequencing. The skeleton diagram of the recombinant plasmid pUC-SCP2-HUH-TE-EgElo9-EgDes8 is shown in Figure 2 The skeleton diagram of the recombinant plasmid pUC-IntC-HUH-TE-EgDes5-PaDes17 is shown in Figure 3 shown.

[0174] in,

[0175] ① The EgElo9-F gene sequence is shown in SEQ ID NO.19, specifically:

[0176] GAGTATAAGAATCATTCAAAATGGAGGTCGTGAACGAAAT

[0177] ②The EgElo9-R gene sequence is shown in SEQ ID NO.20, specifically:

[0178] TGACATAACTAATTACATGATCACTGAATCTTTTTGGCTC

[0179] ③The gene sequence of EgDes8-F is shown in SEQ ID NO.21, specifically:

[0180] CACAAGACATATCTACAGCAATGGTGAAGTCCAAGCGACA

[0181] ④The gene sequence of EgDes8-R is shown in SEQ ID NO.22, specifically:

[0182] ACAAGTTCCGTAGTTGGATCTTAGAGAGCCTTGCCAGCGG

[0183] ⑤The gene sequence of EgDes5-F is shown in SEQ ID NO.23, specifically:

[0184] TCTAAACTACACATCACACAATGGCTCTCTCCCTTACTAC

[0185] ⑥ The gene sequence of EgDes5-R is shown in SEQ ID NO.24, specifically:

[0186] TGACATAACTAATTACATGATTAGGAATCCTGAGCGTCCT

[0187] ⑦The gene sequence of PaDes17-F is shown in SEQ ID NO.25, specifically:

[0188] CCCAAGTCGCTCGTTCAACAATGGCTCCTCTACCGTTGC

[0189] ⑧The PaDes17-R gene sequence is shown in SEQ ID NO.26, specifically:

[0190] ACAAGTTCCGTAGTTGGATCTTAGTTGGCTTTGGTCTTGG

[0191] ⑨P TEF The gene sequence of the promoter is shown in SEQ ID NO.27, specifically:

[0192] AGAGACCGGGTTGCGGCGTATTTGTGTCCCAAAAAACAGCCCCAATTGCCCCAATTGACCCCAAATTGACCCAGTAGCGGGCCCAACCCCGGCGAGAGCCCCCTTCACCCCACATATCAAACCTCCCCGTTCCCACACTTGCCGTTAAGGGCGTAGGGTACTGCAGTCTGGAATCTACGCTTGTTCAGACTTTGTACTAG TTTCTTTGTCTGGCCATCCGGGTAACCCATGCCGGACGCAAAATAGACTACTGAAAATTTTTTTGCTTTGTGGTTGGGACTTTAGCCAAGGGTATAAAAGACCACCGTCCCCGAATTACCTTTCCTCTTCTTTTCTCTCTCCTTGTCAACTCACACCCGAAATCGTTAAGCATTTCCTTCTGAGTATAAGAATCATTCAAA

[0193] ⑩T CYC1t The gene sequence of the terminator is shown in SEQ ID NO.28, specifically:

[0194] TCATGTAATTAGTTATGTCACGCTTACATTCACGCCCTCCCTCCACATCCGCTCTAACCGAAAAGGAAGGAGTTAGACAACCTGAAGTCTAGGTCCCTATTTATTTTTTTATAGTTATGTTAGTATTAAGAACGTTATTTATATTTCAAATTTTTCTTTTTTTTCTGTACAGACGCGTGTACGCATGTAACATTATACTGAAAACCTTGCTTGAGAAGGTTTTGGGACGCTCGAAGGCTTTAATTTGC

[0195] P EXP The gene sequence of the promoter is shown in SEQ ID NO.29, specifically:

[0196] GGAGTTTGGCGCCCGTTTTTTCGAGCCCCACACGTTTCGGTGAGTATGAGCGGCGGCAGATTCGAGCGTTTCCGGTTTCCGCGGCgGGACGAGAGCCCATGATGGGGGCTCCCACCACCAGCAATCAGGGCCCTGATTACACACCCACCTGTAATGTCATGCTGTTCATCGTGGTTAATGCTGCTGTGTGCTGTGTGTGTGTGTTGTTTGGCGCTCATTGTTGCGTTATGCAGCGTACACCACAATATTGGAAGCTTATTAGCCTTTCTATTTTTTCGTTTGCAAGGCTTAACAACATTGCTGTGGAGAGGGATGGGGATATGGAGGCCGCTGGAGGGAGTCGGAGAGGCGTTTTGGAGCGGCTTGGCCTGGCGCCCACTCGCGAAACGCACCTAGGACCCTTTGGCACGCCGAAATGTGCCACTTTTCAGTCTAGTAACGCCTTACCTACGTCATTCCATGCATGCATGTTTGCGCCTTTTTTCCCTTGCCCTTGATCGCCACACAGTACAGTGCACTGTACAGTGGAGGTTTTGGGGGGGTCTTAGATGGGAGCTAAAAGCGGCCTAGCGGTACACTAGTGGGATTGTATGGAGTGGCATGGAGCCTgGGTGGAGCCTGACAGGACGCACGACCGGCTAGCCCGTGACAGACGATGGGTGGCTCCTGTTGTCCACCGCGTACAAATGTTTGGGCCAAAGTCTTGTCAGCCTTGCTTGCGAACCTAATTCCCAATTTTGTCACTTCGCACCCCCATTGATCGAGCCCTAACCCCTGCCCATCAGGCAATCCAATTAAGCTCGCATTGTCTGCCTTGTTTAGTTTGGCTCCTGCCCGTTTCGGCGTCCACTTGCACAAACACAAACAAGCATTATATATAAGGCTCGTCTCTCCCTCCCAACCACACTCACTTTTTTGCCCGTCTTCCCTTGCTAACACAAAAGTCAAGAACACAAACAACCACCCCAACCCCCTTACACACAAGACATATCTACAGCA

[0197] T xpr2t The gene sequence of the terminator is shown in SEQ ID NO.30, specifically:

[0198] GATCCAACTACGGAACTTGTGTTGATGTCTTTGCCCCCGGCTCCGATATCATCTCTGCCTCTTACCAGTCCGACTCTGGTACTTTGGTCTACTCCGGTACCTCCATGGCCTGTCCCCACGTTGCCGGTCTTGCCTCCTACTACCTGTCCATCAATGACGAGGTTCTCACCCCTGCCCAGGTCGAGGCTCTTATTACTGAGTCCAACACCGGTGTTCTTCCCACCACCAACCTCAAGGGCTCTCCCAACGCTGTTGCCTACAACGGTGTTGGCATTTAGGCAATTAACAGATAGTTTGCCGGTGATAATTCTCTTAACCTCCCACACTCCTTTGACATAACGATTTATGTAACGAAACTGAAATTTGACCAGATATTGTTGTAAATAGAAAATCTGGCTTGTAGGTGGCAAAATCCCGTCTTTGTTCATCAATTCCCTCTGTGACTACTCGTCATCCCTTTATGTTCGACTGTCGTATTTTTATTTTCCATACATACGCAAGTGAGATGCCCGTGTC

[0199] T FBA The gene sequence of the promoter is shown in SEQ ID NO.31, specifically:

[0200] GTACGTAGCAACAACAGTGTACGCAGTACTATAGAGGAACAATTGCCCCGGAGAAGACGGCCAGGCCGCCTAGATGACAAATTCAACAACTCACAGCTGACTTTCTGCCATTGCCACTAGGGGGGGGCCTTTTTATATGGCCAAGCCAAGCTCTCCACGTCGGTTGGGCTGCACCCAACAATAAATGGGTAGGGTTGCACCAACAAAGGGATGGGATGGGGGGTAGAAGATACGAGGATAACGGGGCTCAATGGCACAAATAAGAACGAATACTGCCATTAAGACTCGTGATCCAGCGACTGACACCATTGCATCATCTAAGGGCCTCAAAACTACCTCGGAACTGCTGCGCTGATCTGGACACCACAGAGGTTCCGAGCACTTTAGGTTGCACCAAATGTCCCACCAGGTGCAGGCAGAAAACGCTGGAACAGCGTGTACAGTTTGTCTTAGCAAAAAGTGAAGGCGCTGAGGTCGAGCAGGGTGGTGTGACTTGTTATAGCCTTTAGAGCTGCGAAAGCGCGTATGGATTTGGCTCATCAGGCCAGATTGAGGGTCTGTGGACACATGTCATGTTAGTGTACTTCAATCGCCCCCTGGATATAGCCCCGACAATAGGCCGTGGCCTCATTTTTTTGCCTTCCGCACATTTCCATTGCTCGGTACCCACACCTTGCTTCTCCTGCACTTGCCAACCTTAATACTGGTTTACATTGACCAACATCTTACAAGCGGGGGGCTTGTCTAGGGTATATATAAACAGTGGCTCTCCCAATCGGTTGCCAGTCTCTTTTTTCCTTTCTTTCCCCACAGATTCGAAATCTAAACTACACATCACACA

[0201] T YAT The gene sequence of the promoter is shown in SEQ ID NO.32, specifically:

[0202]

[0203] The PCR enzyme used in the PCR reaction is TAKARA's PrimeSTAR MaxDNA polymerase, the PCR amplification system is shown in Tables 1, 2, 3 and 4, the BamH1 enzyme digestion system is shown in Table 5, the Pac1 enzyme digestion system is shown in Table 6, and the one-step assembly system is shown in Table 7.

[0204] Table 1 EgElo9 fragment PCR amplification system

[0205] Reagents Usage PrimeSTARMax(2×) 25μL Primer EgElo9-F 2μL Primer EgElo9-R 2μL template 1μL ddH2O 20μL

[0206] Table 2 EgDes8 fragment PCR amplification system

[0207] Reagents Usage PrimeSTARMax(2×) 25μL Primer EgDes8-F 2μL Primer EgDes8-R 2μL template 1μL ddH2O 20μL

[0208] Table 3 EgDes5 fragment PCR amplification system

[0209] Reagents Usage PrimeSTARMax(2×) 25μL Primer EgDes5-F 2μL Primer EgDes5-R 2μL template 1μL ddH2O 20μL

[0210] Table 4 PaDes17 fragment PCR amplification system

[0211] Reagents Usage PrimeSTARMax(2×) 25μL Primer PaDes17-F 2μL Primer PaDes17-R 2μL template 1μL ddH2O 20μL

[0212] Table 5 pUC-SCP2-HUH-TE plasmid restriction enzyme system

[0213] Components Recombination reaction Plasmid vector 2μg BamH1 enzyme 2μL 10xQCutBuffer 5μL ddH2O To50μL

[0214] Table 6 pUC-SCP2-HUH-TE plasmid restriction enzyme system

[0215]

[0216]

[0217] Table 7 One-step assembly system

[0218] Components Recombination reaction Linearized vector XμL N insert fragments Y1+Y2+…YnμL 2 × ClonExpressMix 5μL ddH2O To10μL

[0219] X = (0.02 × number of base pairs of cloning vector) ng (0.03 pmol)

[0220] Y = (0.02 × number of base pairs per fragment) ng (0.03 pmol)

[0221] 3. Construction of the Yarrowia lipolytica engineered strain Polf-D1

[0222] This section is a method for constructing a genetically engineered strain of Yarrowia lipolytica expressing a Δ9 elongase gene, a Δ8 desaturase gene, a Δ5 desaturase gene, and a Δ17 desaturase gene, comprising the following steps performed in sequence:

[0223] S1. Activation of Po1f in uracil-auxotrophic Yarrowia lipolytica

[0224] Take 5 μL of the uracil auxotrophic engineered strain obtained in Part 2 of this Example and streak it on YPD solid medium for activation, and wait for a single colony to grow;

[0225] S2. Preparation of competent cells of uracil-auxotrophic Yarrowia lipolytica Po1f

[0226] Pick a single colony and add it to 5 mL of YPD liquid medium. Incubate in a shaker at 28°C and 220 rpm until the absorbance of the bacterial solution at 600 nm is 0.8-1.0.

[0227] Take 1 mL of bacterial solution, centrifuge at 4°C, 4000 rpm for 3 min, collect the bacteria, and prepare the competent state according to the operating method of the yeast transformation kit Frozen-EZ Yeast Transformation IITM, the specific method is: resuspend with 1 mL of Frozen-EZ Solution 1, centrifuge at 4°C, 4000 rpm for 3 min to collect the bacteria again; discard the supernatant, use 100 μL of Frozen-EZ Solution 2 (Frozen-EZ Solution 1, Frozen-EZ Solution 2, Frozen-EZ Solution 3 are all components of the kit, all of which are prior art.) to suspend the bacteria, package each 50 μL, and store at -80°C to obtain Yarrowia lipolytica Po1f competent cells;

[0228] S3. Construction of Yarrowia lipolytica Po1f-D1

[0229] The Yarrowia lipolytica Po1f competent cells stored at -80°C were taken out and placed on ice for 10 min; 1 μg of the recombinant plasmid pUC-SCP2-HUH-TE-EgElo9-EgDes8 with a uracil genetic marker obtained in Example 1 was added to the Yarrowia lipolytica Po1f competent cells, gently pipetted to mix, and then 500 μL of Frozen-EZ Solution 3 was added to mix, incubated in a shaker at 28°C and 220 rpm for 60 min, and spread on YNB solid culture medium for screening, and the positive strain selected was the engineered strain Polf-D0.

[0230] 5 μL of the engineered strain Polf-D0 obtained above was streaked onto a YPD-5FOA solid medium, and the solid medium was placed in an incubator at 28° C. for culture. Under the action of 5FOA, the cells discarded uracil, and the recycling of the selection marker was realized. After a single colony was grown, it was streaked again onto a YPD solid medium for activation, and the solid medium was placed in an incubator at 28° C. for culture, thereby obtaining the engineered strain Polf-D0 (URA-);

[0231] 1 μg of the recombinant plasmid pUC-IntC-HUH-TE-EgDes5-PaDes17 with the uracil genetic marker obtained in Example 1 was added to the competent cells of Yarrowia lipolytica Polf-D0 (URA-), gently pipetted to mix, and then 500 μL of Roman-EZ Solution 3 was added to mix, incubated in a shaker at 28°C and 220 rpm for 60 min, and spread on YNB solid culture medium for screening. The positive strain selected was the engineered strain Polf-D1.

[0232] Among them, the YPD solid culture medium ratio table is shown in Table 8, and the solvent is pure water;

[0233] The proportion table of YPD liquid culture medium is shown in Table 9, and the solvent is pure water;

[0234] The proportion table of YNB solid culture medium is shown in Table 10, and the solvent is pure water.

[0235] The YPD-5FOA fermentation medium ratio table is shown in Table 11, and the solvent is pure water.

[0236] Table 8 YPD solid culture medium ratio table

[0237]

[0238] Table 9 YPD liquid culture medium ratio table

[0239] name Yeast extract Peptone glucose Content (g / L) 10 20 20

[0240] Table 10YNB solid culture medium ratio table

[0241] name YNB (amino acid and ammonium sulfate free) Ammonium sulfate glucose Agar Content (g / L) 1.7 5 20 30

[0242] Table 11YPD-5FOA solid culture medium ratio table

[0243]

[0244] Example 2 Construction of a recombinant plasmid for enhancing cofactor supply

[0245] 1. Construction of recombinant plasmid pUC-intF3-HUH-TE-G6PDH

[0246] S1. Amplification of target gene fragment

[0247] S11. Using the Po1f genome of Yarrowia lipolytica as a template, PCR amplification was performed using primers G6PDH-F (nucleotide sequence as shown in SEQ ID NO.33) and G6PDH-R (nucleotide sequence as shown in SEQ ID NO.34) as primers to obtain the amplified fragment G6PDH;

[0248] S12. Using the Yarrowia lipolytica genome as a template and TEF-F and TEF-R genes as primers, PCR amplification was performed to obtain promoter P TEF , whose gene sequence is shown in SEQ ID NO.27;

[0249] S13. Using the Yarrowia lipolytica genome as a template and CYC1t-F and CYC1t-R genes as primers, PCR amplification was performed to obtain the terminator T CYC1t , whose gene sequence is shown in SEQ ID NO.28;

[0250] The enzymes and systems used for PCR amplification are the same as those in Tables 1 to 4. The PCR program is as follows: denaturation at 98°C for 10 s, annealing at 56°C for 10 s, and extension at 72°C for 2 min (extension time = target fragment length / 1 kb, unit min), and repeated for 35 cycles.

[0251] S2. Construction of recombinant plasmid pUC-intF3-HUH-TE-G6PDH

[0252] S21. The plasmid pUC-intF3-HUH-TE with uracil genetic marker was digested by BamH1 enzyme, and the amplified fragment of G6PDH was connected to the pUC-intF3-HUH-TE plasmid backbone after digestion, and the recombinant plasmid pUC-intF3-HUH-TE-G6PDH was constructed by one-step assembly using ClonExpress MultiSOne Step Cloning Kit;

[0253] S22. Purify and recover each target gene using AxyPrepTM DNAGel Extraction Kit (purchased from Corning Life Sciences Co., Ltd.);

[0254] S23. The circular recombinant plasmid was transformed into E. coli DH5a competent cells, and the positive recombinant plasmid pUC-intF3-HUH-TE-G6PDH was obtained by plate screening of ampicillin resistance (final concentration of 50 mg / L) and verification by colony PCR and sequencing. The recombinant plasmid carries a uracil genetic marker. The skeleton diagram of the pUC-intF3-HUH-TE-G6PDH plasmid can be found in Figure 4 .

[0255] in,

[0256] ① The gene sequence of G6PDH-F is shown in SEQ ID NO.33, specifically:

[0257] GAGTATAAGAATCATTCAAAATGACTGGCACCTTACCCAA

[0258] ②The gene sequence of G6PDH-R is shown in SEQ ID NO.34, specifically:

[0259] TGACATAACTAATTACATGATCACGAGGAGCCCTTGGTGA

[0260] Among them, the BamH1 digestion system of plasmid pUC-intF3-HUH-TE is shown in Table 5, and the one-step assembly system is shown in Table 7.

[0261] 2. Construction of recombinant plasmid pUC-intF3-HUH-TE-ME

[0262] S1. Amplification of target gene fragment

[0263] S11. Using the Yarrowia lipolytica genome as a template, PCR amplification was performed using primers ME-F (nucleotide sequence as shown in SEQ ID NO.35) and ME-R (nucleotide sequence as shown in SEQ ID NO.36) as primers to obtain an amplified fragment ME;

[0264] S12. Using the Yarrowia lipolytica genome as a template and TEF-F and TEF-R genes as primers, PCR amplification was performed to obtain promoter P TEF , whose gene sequence is shown in SEQ ID NO.27;

[0265] S13. Using the Yarrowia lipolytica genome as a template and CYC1t-F and CYC1t-R genes as primers, PCR amplification was performed to obtain the terminator T CYC1t , whose gene sequence is shown in SEQ ID NO.28;

[0266] The enzymes and systems used for PCR amplification are the same as those in Tables 1 to 4. The PCR program is as follows: denaturation at 98°C for 10 s, annealing at 56°C for 10 s, and extension at 72°C for 2 min (extension time = target fragment length / 1 kb, unit min), and repeated for 35 cycles.

[0267] S2. Construction of recombinant plasmid pUC-intF3-HUH-TE-ME

[0268] S21. The plasmid pUC-intF3-HUH-TE with the uracil genetic marker was digested with BamH1 enzyme, and the amplified fragment of ME was connected to the pUC-intF3-HUH-TE plasmid backbone after digestion, and the recombinant plasmid pUC-intF3-HUH-TE-ME was constructed by one-step assembly using ClonExpress MultiS OneStep Cloning Kit;

[0269] S22. Purify and recover each fragment using AxyPrepTM DNA Gel Extraction Kit (purchased from Corning Life Sciences Co., Ltd.);

[0270] S23. The circular recombinant plasmid was transformed into E. coli DH5a competent cells, and the positive recombinant plasmid pUC-intF3-HUH-TE-ME was obtained by plate screening of ampicillin resistance (final concentration of 50 mg / L) and verification by colony PCR and sequencing. The recombinant plasmid carries a uracil genetic marker. The skeleton diagram of the pUC-intF3-HUH-TE-ME plasmid can be found in Figure 5 .

[0271] in,

[0272] ①The gene sequence of ME-F is shown in SEQ ID NO.35, specifically:

[0273] GAGTATAAGAATCATTCAAAATGCGACCCACACAGACCAG

[0274] ②The gene sequence of ME-R is shown in SEQ ID NO.36, specifically:

[0275] TGACATAACTAATTACATGACTAGTCGTAATCCCGCACAT

[0276] Among them, the BamH1 digestion system of plasmid pUC-intF3-HUH-TE is shown in Table 5, and the one-step assembly system is shown in Table 7.

[0277] 3. Construction of recombinant plasmid pUC-intF3-HUH-TE-G6PDH-ME

[0278] S1. Amplification of target gene fragment

[0279] S11. Using the Yarrowia lipolytica genome as a template, PCR amplification was performed using primers G6PDH-F (nucleotide sequence as shown in SEQ ID NO.33) and G6PDH-R (nucleotide sequence as shown in SEQ ID NO.34) as primers to obtain an amplified fragment G6PDH; PCR amplification was performed using primers ME-2F (nucleotide sequence as shown in SEQ ID NO.37) and ME-2R (nucleotide sequence as shown in SEQ ID NO.38) to obtain an amplified fragment ME;

[0280] S12. Using the Yarrowia lipolytica genome as a template and TEF-F and TEF-R genes as primers, PCR amplification was performed to obtain promoter P TEF , whose gene sequence is shown in SEQ ID NO.27;

[0281] S13. Using the Yarrowia lipolytica genome as a template and CYC1t-F and CYC1t-R as primers, PCR amplification was performed to obtain the terminator T CYC1t , whose gene sequence is shown in SEQ ID NO.28;

[0282] S14. Using the Yarrowia lipolytica genome as a template and EXP-F and EXP-R genes as primers, PCR amplification was performed to obtain promoter P EXP , whose gene sequence is shown in SEQ ID NO.29;

[0283] S15. Using the Yarrowia lipolytica genome as a template and xpr2t-F and xpr2t-R genes as primers, PCR amplification was performed to obtain the terminator T xpr2t , whose gene sequence is shown in SEQ ID NO.30;

[0284] The enzymes and systems used for PCR amplification are the same as those in Tables 1 to 4. The PCR program is as follows: denaturation at 98°C for 10 s, annealing at 56°C for 10 s, and extension at 72°C for 2 min (extension time = target fragment length / 1 kb, unit min), and repeated for 35 cycles.

[0285] S2. Construction of recombinant plasmid pUC-intF3-HUH-TE-G6PDH-ME

[0286] S21. The plasmid pUC-intF3-HUH-TE with uracil genetic marker was digested by BamH1 enzyme, and the amplified fragment of G6PDH was connected to the pUC-intF3-HUH-TE plasmid backbone after digestion, and the recombinant plasmid pUC-intF3-HUH-TE-G6PDH was constructed by one-step assembly using ClonExpress MultiSOne Step Cloning Kit;

[0287] The plasmid pUC-intF3-HUH-TE-G6PDH with uracil genetic marker was digested by Pac1 enzyme, and the amplified fragment of ME was connected to the pUC-intF3-HUH-TE-G6PDH plasmid backbone after digestion, and the recombinant plasmid pUC-intF3-HUH-TE-G6PDH-ME was constructed by one-step assembly using ClonExpress MultiS One Step Cloning Kit;

[0288] S22. Purify and recover each target gene using AxyPrepTM DNAGel Extraction Kit (purchased from Corning Life Sciences Co., Ltd.);

[0289] S23. The circular recombinant plasmid was transformed into E. coli DH5a competent cells, and the positive recombinant plasmid pUC-intF3-HUH-TE-G6PDH-ME was obtained by plate screening for ampicillin resistance and colony PCR and sequencing verification. The recombinant plasmid carries a uracil genetic marker. The skeleton diagram of the pUC-intF3-HUH-TE-G6PDH-ME plasmid can be found in Figure 6 .

[0290] in,

[0291] ①The gene sequence of ME-2F is shown in SEQ ID NO.37, specifically:

[0292] CACAAGACATATCTACAGCAATGCGACCCACACAGACCAG

[0293] ②The gene sequence of ME-2R is shown in SEQ ID NO.38, specifically:

[0294] ACAAGTTCCGTAGTTGGATCCTAGTCGTAATCCCGCACAT

[0295] Among them, the BamH1 digestion system of plasmid pUC-intF3-HUH-TE is shown in Table 5, the Pac1 digestion system is shown in Table 6, and the one-step assembly system is shown in Table 7.

[0296] Example 3 Construction of engineered strains of Yarrowia lipolytica Polf-D2, Polf-D3, and Polf-D4 for producing eicosapentaenoic acid

[0297] This section is a method for constructing a genetically engineered strain for producing eicosapentaenoic acid, comprising the following steps performed in sequence:

[0298] S1. Activation of engineered strain Polf-D1

[0299] 5 μL of the engineered strain Polf-D1 obtained above was streaked onto a YPD-5FOA solid medium, and the solid medium was placed in an incubator at 28°C for culture. Under the action of 5FOA, the cells discarded uracil, and the recycling of the selection marker was realized. After a single colony was grown, it was streaked again onto a YPD solid medium for activation, and the solid medium was placed in an incubator at 28°C for culture to obtain the engineered strain Polf-D1 (URA-);

[0300] S2. Preparation of competent cells of uracil auxotrophic Yarrowia lipolytica Polf-D1 (URA-)

[0301] Pick a single colony (Polf-D1(URA-)) and add it to 5 mL of YPD liquid medium. Incubate in a shaker at 28°C and 220 rpm until the absorbance of the bacterial solution at 600 nm is 0.8-1.0;

[0302] Take 1 mL of bacterial solution, centrifuge at 4°C and 4000 rpm for 3 min, collect the bacteria, and prepare competent cells according to the operating method of the yeast transformation kit Frozen-EZ Yeast Transformation IITM. The specific method is: resuspend with 1 mL of Frozen-EZ Solution 1, centrifuge at 4°C and 4000 rpm for 3 min to collect the bacteria again; discard the supernatant, suspend the bacteria with 100 μL of Frozen-EZ Solution 2, divide into 50 μL portions, and store at -80°C to obtain competent cells of the engineering strain Polf-D1 (URA-);

[0303] S3.

[0304] (1) Construction of the engineered strain Po1f-D2 of Yarrowia lipolytica

[0305] The Yarrowia lipolytica Po1f-D1 (URA-) competent cells stored at -80°C were taken out and placed on ice for 10 min; 1 μg of the recombinant plasmid pUC-intF3-HUH-TE-G6PDH with a uracil genetic marker obtained in Example 2 was added to the Yarrowia lipolytica Po1f competent cells, gently pipetted to mix, and then 500 μL of Frozen-EZ Solution 3 was added to mix, incubated in a shaker at 28°C and 220 rpm for 60 min, and spread on YNB solid culture medium for screening. The positive strain selected was the engineered strain Po1f-D2, and the engineered strain Po1f-D2 was a genetically engineered strain producing eicosapentaenoic acid.

[0306] (2) Construction of the engineered strain Po1f-D3 of Yarrowia lipolytica

[0307] The Yarrowia lipolytica Po1f-D1 (URA-) competent cells stored at -80°C were taken out and placed on ice for 10 min; 1 μg of the recombinant plasmid pUC-intF3-HUH-TE-ME with a uracil genetic marker obtained in Example 2 was added to the Yarrowia lipolytica Po1f competent cells, gently pipetted to mix, and then 500 μL of Frozen-EZ Solution 3 was added to mix, incubated in a shaker at 28°C and 220 rpm for 60 min, and spread on YNB solid culture medium for screening. The positive strain selected was the engineered strain Po1f-D3, and the engineered strain Po1f-D3 was a genetically engineered strain producing eicosapentaenoic acid.

[0308] (3) Construction of the engineered strain Po1f-D4 of Yarrowia lipolytica

[0309] The Yarrowia lipolytica Po1f-D1 (URA-) competent cells stored at -80°C were taken out and placed on ice for 10 min; 1 μg of the recombinant plasmid pUC-intF3-HUH-TE-G6PDH-ME with a uracil genetic marker obtained in Example 2 was added to the Yarrowia lipolytica Po1f competent cells, gently pipetted to mix, and then 500 μL of Frozen-EZ Solution 3 was added to mix, incubated in a shaker at 28°C and 220 rpm for 60 min, and spread on YNB solid culture medium for screening. The positive strain selected was the engineered strain Po1f-D4, and the engineered strain Po1f-D4 was a genetically engineered strain producing eicosapentaenoic acid.

[0310] Example 4 Synthesis of eicosapentaenoic acid and total oil by engineered strains Polf-D1, Polf-D2, Polf-D3 and Polf-D4 in fermentation medium

[0311] This example investigates the synthesis of eicosapentaenoic acid by the engineered strains Polf-D1, Polf-D2, Polf-D3 and Polf-D4 constructed in Example 3, with the aim of investigating the effects of first overexpressing Δ9 elongase, Δ8 desaturase, Δ5 desaturase and Δ17 desaturase and then overexpressing glucose-6-phosphate dehydrogenase, malic enzyme and overexpressing glucose-6-phosphate dehydrogenase and malic enzyme in fermentation medium on increasing eicosapentaenoic acid. The method comprises the following steps performed in sequence:

[0312] S1. Preparation of seed solution

[0313] The engineered strains Polf-D1, Polf-D2, Polf-D3 and Polf-D4 were inoculated into 10 mL of conventional YPD liquid medium, respectively, and cultured at 28 ° C and 220 rpm for 24 h to obtain first-level seeds; the first-level seeds were inoculated into 10 mL of YPD liquid medium, and cultured again at 28 ° C and 220 rpm for 24 h to obtain second-level seeds, that is, seed fermentation liquid, and the number of viable bacteria in the seed liquid was 1.5 × 10 8 ~2.5×10 8 CFU / mL.

[0314] S2. Fermentation of engineered strains

[0315] The engineered strain seed fermentation liquid was taken separately and inoculated into the fermentation medium at an inoculation rate of 1% to 5% by volume to ensure that the number of viable bacteria in the inoculated medium was the same. The culture was carried out under ventilation at 28° C. and 220 rpm for 96 hours to obtain the fermentation product.

[0316] Among them, the fermentation medium ratio table is shown in Table 12.

[0317] Table 12 Fermentation medium ratio table (solvent is pure water)

[0318] name YNB (amino acid and ammonium sulfate free) Yeast powder glucose Content (g / L) 1.7 2.5 60

[0319] S3. Analysis of fermentation products

[0320] The fermentation product was methylated: 500 μL of the fermentation product obtained above was taken and centrifuged at 12000 rpm for 1 min at room temperature. After centrifugation, the supernatant was removed and the bacterial cells were retained. 500 μL of 1 mol / L NaOH-methanol solution was added to the bacterial cells (the method for preparing 100 mL of 1 mol / L NaOH-methanol solution was: 4 g of NaOH solid was weighed and dissolved in 100 mL of methanol, that is, 100 mL of 1 mol / L NaOH-methanol solution was obtained), mixed, and shaken for 5 hours; then 40 μL of sulfuric acid, 100 μL of 2 g / L methyl heptadecanoate solution (internal standard) and 500 μL of chromatographic grade n-hexane were added to extract fatty acid methyl esters, shaken for 30 min, and then centrifuged at 12000 rpm for 2 min at room temperature, the upper layer was taken to remove impurities through a microporous filter membrane, injected into a gas chromatograph, and analyzed and calculated the eicosapentaenoic acid content.

[0321] The specific gas chromatography detection method is as follows:

[0322] Detection conditions: injection port temperature 100 °C, injection volume 1.0 μL, split ratio 69.8:1;

[0323] Chromatographic column: DB-23 (60.0m×0.25mm×0.25μm);

[0324] Chromatographic conditions: initial temperature 100°C, heating to 196°C at 25°C / min. Then, heating to 220°C at 2°C / min and keeping for 6 min;

[0325] Detector temperature: 280°C.

[0326] The oil yields of engineered strains Polf-D1, Polf-D2, Polf-D3 and Polf-D4 after fermentation are shown in Figure 7 As shown;

[0327] The eicosapentaenoic acid production of engineered strains Polf-D1, Polf-D2, Polf-D3 and Polf-D4 after fermentation is shown in Figure 8 As shown;

[0328] The eicosapentaenoic acid content of the engineered strains Polf-D1, Polf-D2, Polf-D3 and Polf-D4 after fermentation was as follows Fig. 9 As shown;

[0329] Depend on Figure 7It can be seen that considering the total oil yield of fermentation products, the engineered strain Po1f-D2 was significantly improved compared with the engineered strain Po1f-D1, specifically from 0.882g / L to 1.159g / L; the engineered strain Po1f-D3 was significantly improved compared with the engineered strain Po1f-D1, specifically from 0.882g / L to 0.999g / L; the engineered strain Po1f-D4 was significantly improved compared with the engineered strain Po1f-D1, specifically from 0.882g / L to 1.772g / L.

[0330] Depend on Figure 8 It can be seen that from the eicosapentaenoic acid production of the fermentation product, the engineered strain Po1f-D1 successfully produced eicosapentaenoic acid with a yield of 0.038 g / L; the engineered strain Po1f-D2 successfully produced eicosapentaenoic acid with a yield of 0.090 g / L; the engineered strain Po1f-D3 successfully produced eicosapentaenoic acid with a yield of 0.0704 g / L; the engineered strain Po1f-D4 successfully produced eicosapentaenoic acid with a yield of 0.150 g / L.

[0331] From the perspective of the eicosapentaenoic acid production of the fermentation product, the engineered strain Po1f-D4 is significantly higher than the engineered strains Po1f-D2 and Po1f-D3, and the eicosapentaenoic acid content in the fermentation broth of the engineered strain Po1f-D4 is about 3.92 times that in the fermentation broth of the engineered strain Po1f-D1. Therefore, the engineered strain Po1f-D4 is more suitable for producing eicosapentaenoic acid than the engineered strains Po1f-D2 and Po1f-D3.

[0332] From the perspective of the total oil content of the fermentation product, the engineered strain Po1f-D4 is significantly higher than the engineered strains Po1f-D2 and Po1f-D3, and the total oil content in the fermentation broth of the engineered strain Po1f-D4 is about 2.01 times the total oil content in the fermentation broth of the engineered strain Po1f-D1. Therefore, the engineered strain Po1f-D4 is more suitable for use as a strain for producing increased total oil production than the engineered strains Po1f-D2 and Po1f-D3.

[0333] The backbone of the plasmid sequence refers to patent CN 114606150A, inserting SCP2-up and SCP2-dn to obtain plasmid pUC-SCP2-HUH-TE; inserting IntC-up and IntC-dn to obtain plasmid pUC-IntC-HUH-TE; inserting intF3-up and intF3-dn to obtain plasmid pUC-intF3-HUH-TE. The gene sequences of SCP2-up, SCP2-dn, IntC-up, IntC-dn, intF3-up, and intF3-dn are as follows:

[0334] SCP2-up:

[0335] CCGACAGTCGTCTGCACCCCGCAAGTCTCGGTTCGTACCAGCACCAATGTTAGGCAGAACTAT

[0336] ACACAAGAGGGCGGACGATCACTTCGGCGTTAGGCAACTGAAGGCTATTTTCGGCTGGTACT

[0337] GTAGGGGACAGAGGAAACGCAAGTGATTAGTAAATCGGATAATAGGCCTGTTAGTTTACCGAA

[0338] ATGGTGGGGGAGGGGTTCCGTGGATATCTTGAAGTTATGGAGGCTGATCGTTATTTGTGGGGA

[0339] TGGATATCATTGTATGGACATACTGTAGCTACTGTATAAACAACGGATCTTACACCTGCCTCTTG

[0340] TATGCCCATTGCTTGATCATCTATCGTGTTACTGTACATATACAATAGATATAGGGAAGAAAAGC

[0341] CGGAAGTAGAGACCATAGTCTGGCAGAAGTAACGGCCTCGGGTCGAGAGAACTATAACAAAG

[0342] TCCAACGGCGGGTCTTAGAATAGCCCCAAGGATCACACAGTTCCGCAATCCAGTTTCACATGT

[0343] TCCGTTGCATGGACTTTTGCATGTCTACTGTTGCTACGATTCCCCCATTGCAACCACAGTTTGG

[0344] GGTTACCCCGCATTATATTAGCATGATTACGAAAGAGATAAGTATCATATGGAACATGTGAAGG

[0345] GTAGTATGCAGGTCCGGCGGAGAAAGAGAATGACGTTTTCATTAAGCGATTCGCTTGGCGGCT

[0346] TGTGGGGGATGTGACGATACTTACGGTAAAGACCCTGTGTGAGAGCTGGTACTCGCTCGTTAC

[0347] TTCGCTGATCTGTTGGGCCGTCAATCGAATCTCGTGGAACTTGCATTCTTCTTAACTGTGTCTA

[0348] TACAAGACACCTAATGAAACATACAAGCTACCGAAATCATTTTACTCGTACTGACCGGTACGG

[0349] TACTTGCACAAGTAGTGAAACTTCCGAAAATAGCCAGCCTCATGCATCATCGCTTCACCCCTT

[0350] CTGTTGACCTCAAAAGCATTCCAACGGTAAAAAATTATAACGCCGCCAACTGGATGGTTGTGA

[0351] CGGCGTTGACCACCAATGTGTGGGGGCTGGCGGTAGGACCGAGCTTATTCGTCCCAATAAGCT

[0352] CTTTGGATTTGATTCTTTGGGGTGTGTGGTAAAATTCACATGGGGAAGAACACGGTGGCAGTT

[0353] TGAGGCAGAGGCCCAGCGTGTAGTTCCTAGGGCATGAATATACCGAACTCATGGCGCAGAATT

[0354] GAGCTGAATGCGCAAAAAGCTACAGGATCAACCGCGTTAGAAATGCCGCAAATGTCCACTAA

[0355] TTCCCCGGACTGTTCCAAATGATTCTGTGGGGATAAATCTCAAACTGGGTTAGGCTTTGTCAC

[0356] GTTTCTTTGTGTCGTGTCGGTTCGTCCGGGGCAATGTGCCCACGCTTGGCTGTCTCCCTACAC

[0357] CTCGGTAAAAACTATCACATGCTGCCCCTCTCGAGCAAGCATTAAATGCATATAGTCAATCTAA

[0358] CGACATATATATAGGTAGGGTGCATCCTCCGGTTTAGCTCCCCAGAATATCTCTTATTCATTACA

[0359] CAAA

[0360] SCP2-dn:

[0361] CAAGTCCCCCAAGGGTGATGCTGACATCCAGCTCACTCTCTCTGACGACCACTTCCAGCAGCT

[0362] CGTTGAGGGTAAGGCTAACGCCCAGCGACTCTTCATGACCGGCAAGCTCAAGGTTAAGGGCA

[0363] ACGTCATGAAGGCTGCCGCCATTGAGGGTATCCTCAAGAACGCTCAGAACAACCTCTAAGCG

[0364] CATCATTTATTGATTAATTGATGATTTACTATATTGATTTCGCAACTGTAGTGTGATTGTATGTGA

[0365] TCTGGCTCGTAGGCTTCAGTAAATACTAGACGGGTATCGTACGTAGTTGTATCATACATCGAGC

[0366] CTGTGGTTACTTGTACAATAATTCGTAATGTAGAGATACCCCTTGATCCATTGCCTGTTTCTAAC

[0367] ATACAATGATCTCCACGCAATAATCCCACTCTTGACTAAAAGTTGCTACTCTTGCACGGTTACC

[0368] TCGGCATAGTCACGCCTCTCTTGTCTCGTCTCGAACGCACAAAGTCAATTGACAACGCCACTC

[0369] ACTCGAGTGTGCCCCAACAGGGCACCATATCGACTAATTTGAGGCCAACTAGGGTGATTTTGG

[0370] ATGGAATTTGATCGGAAAAAATAGCTGCAGAAATTCCTGGAGAGAAAAATTGACCGCATCCA

[0371] CATGGTTTGACCAAAAAATCGTCTCCATCTCTGTGCTCAACTCTCCTGACGAGATATGCGCGC

[0372] GCACCCCCACATGATGTGATTGATCTCAACAAACTTCACCCAGACCCTTATCTTTCCGGAAAA

[0373] CTTACTGTATAAGTGGTCGTGCGAACAGAAAGTGTGCGCACTTTAGGTGTCTAGATCCGATTG

[0374] TTCTCGTTCTGATAATGAGCCAGCCCCGCGAGGCAATGTTTTTTACAATTGAAAACTTCGTTAA

[0375] CCACTCACATTACCGTTTTTGCCCCATATTTACCCTCTGGTACACTCCCTCTTGCATACACACAC

[0376] ACTGCAGTGAAAATGCACTCCGTTAGCACCGTTGTGATTGGTTCAGGGCACGAGTTTGGTGG

[0377] TTTAAGGCGCAACTACATCAATATGAAAACAGGAGACGCTGAAAAGGGGTAATATCGGACTG

[0378] CTGCTATGTTGTATGTACTGCATGACGAATTGGTGTTATTCAAGACCGTGGCACAGGTTGCTGC

[0379] GGTACGAGACCTGGTAGCTTCTCTAAACGGCATGTCTAGGTGGACGAGTATGGAGAAGTTAG

[0380] GTACAGTACGTACGTATACGAGTACGAGTACGAGTACGTAGTACGATACAGGGTACGTAGTAC

[0381] GATACAGGGTACGTAGTACGATACAGGGTACGTAGTACGATACAGGGTACGTAGTACGATACA

[0382] GGGTACTTGTACGAAGACAACAGTAGAGTGCAAATATCAACCAACATGGCCAGAGCGACCAG

[0383] TTCAGCTTTCAGGGGGGCCTCTAGCACTTGTCACCATATGTAGCCGTGATAATTATGCAGTGAT

[0384] GTGATAACTACTGTACAAGTAGAAGTAATCCGGTGGTGCTGGTACCTTGAATTGAGTCTCACTA

[0385] TCGGTT

[0386] IntC-up:

[0387] AGGTTGTCGATGATATGCTGGACTACTCCGAGGGCGAGTCTCATCTTGGTAAGCCCGCTGGAG

[0388] CCGATCTCAAACTTGGTCTTGCCACTGCGCCCGTTCTGTTTGCCTGGGAAAAGTACCCCGAGC

[0389] TCGGAGACATGATCAAGCGAAAGTTTGACGGTCCCGGCGACGTGGAGCGGGCCCGATTCCTG

[0390] GTTCAGCAGGCAGACGGTCTGTCGCGAACCCGAGAGCTGGCCCAAAAGTACTGCGACGAGG

[0391] CTGTCGCCAACTTGGACCTGCTTCCCTACTCTGAGAGCAGAGAGGCTCTGAGAAACCTCACC

[0392] ATGAAGATGATGAACCGAAGCAAGTAATGTATATAGAGCATAGATTGAAAAGCAGGACAGGA

[0393] GGATGGGAGAGGACGCAGCTCTACTGTAGTTACAAGACGGTGAGTACGGTACTACCACAGTG

[0394] TAGCTAGTAGAGGTTGGGTAGCATGGTGTAGAAGACGAGGACCAGTGGTGAGTTGTACTTCA

[0395] ACGCAAAGTAGTAACTAGGTGATAGATTGATATTATATCTACTACTGTAATTGTACTTGTACTTT

[0396] AGTGATACAGCATGCTCCTGAAATTTACTATACTCTGTCAGATCACTCGATCTACACACTCAGG

[0397] ATAGGGGATAGAGCACAAGCAGATGAGTAGTTGGACATTATTTCGAGAAATTTCTTTAACAGGA

[0398] TATATTCCAACAAGTTACAAACACCATTTCTTGTCACTTTTCTGATTCGCCTCCGCCATTACTA

[0399] ATCACCTACAAGTACACTACATCTCATTGTGCAGGCAAACTCAGTTGTATCTGATCAACTACAC

[0400] TATGGTGCTACCGATTGTCATCGGAGTGGGAGTCACGTTGGTGGCGTTAGGGGTGAGTGAAA

[0401] GACGGACAAACAACCACGACATGTGTACTAACTACAGCTGCGGCCGGATTACGTGCGCGAG

[0402] CCCGATACAGCGGGGTTCCTGAGACGCTGCTCAACAGCAGGCATTATCTGGGCGGATTCCAGC

[0403] ATAATATGAGTCGCAAGGAGGCGCTGTTGATCCTGGGGTTTGCCCGGGAACACGGCTCGGTG

[0404] ACGCTCAACATGCTCAAGGACAAGCATCGAAAGGTGATGATGCTGAATCACCCCGATCGAGG

[0405] CGGATCACCGTTCATGGCCAAGAAAATCAACGAGGCCAAGGATATGCTGGAAAAGGAGGTAA

[0406] AAAAGTGAGCACGCGACAGAATCTTCATCGGTGGACAGCCAGCATCACCATAGACGTGTTGT

[0407] CCACTTTTAATTGTATATATTTAACTATTTTATGACCTAGGAGTGCGGTCTATAGATGCGGTAAA

[0408] GTGTCGACCAAAAGACACTGAGATAGGGCGTACGAGATGGGTTTTGGTATAAAAAGAGAAGG

[0409] ACTATGTCTCAGGAGTTGTCCT

[0410] IntC-dn:

[0411] CGTGGTTCATGTCCTTCATCTGGATCGAGATCCTCTTCCAGCTGCCCTTCTTTGTTTATGGAGC

[0412] CTACAAGCTGCTAACCAAGACCGCCACTCCCACGACATACCTGTGGATGCTGGTGTACGGTGT

[0413] CAATGCCAGCCTAACGACTCTGGCATGTCTCGCGGAGGTGTGGGCTCGAGCCGGTCTTACCGA

[0414] TGCCCTTCGATACAACCTGCTCGCTGTCTACGCCCCCTTTTTCTTCATTTCTGGCTACATTGTCA

[0415] TTGACGTATTCCAGCGGTTGCAGGGAGAGCTGAGAAAGGTCAAGACTGATTAAGCAACGAAT

[0416] TACTATAACCAAACCGCCAAACAAGTGATGCCACACGACTCACGCAGGAATGTACCGCATACT

[0417] ATGTACTGTGTACTGTTCTGGCAATACCCAATGGTTCAGCTTTCCAACATCCTCGACTAAGAAG

[0418] GAACTACTGTATTGGAACTGTCACTGGTGCTGACGACTTGTGTGTTTATTGTCAATGAGATTGG

[0419] ACTCGGTTACTTACTCCTCCGGGCACTACAAGTACCGTACCTCAAGTCCTGTGTGTATATATTAT

[0420] CCGTATTATGATTTCAAAACCATTACATTGTAAAGTCTCTCTCAATTGACTGATTCATATAGAAC

[0421] TACCAGTAGAAGCATCTCCGAAGGTGTTGTTTTTTCTAGTACCGTATGTACAGTATTCATACTA

[0422] GTTAGCTACAGTACATAACGCGCGCCCAGGCTAACATCATCACGGAACAACTTGTACTCATCA

[0423] TTCAGAGCCGAAATTTGAACAGAAACAAAAAGAATTGAATTTCCCATTATTCCAGTCACTACT

[0424] GGGAATCTTCACCAACATAAAAAACACCCACCTTGACGTCTATCACGTGCTTCATTCATACCG

[0425] TTATTCTGGCTCTTCCCCACACCCCACTTTTCACATTAACCTTGATGTCCGCCAAACTCTCTTTT

[0426] CTGCACGCTCCCTTAACCTCGGCCGACAGATCATAGTCATTCTTCTCTACAACACCACCACATC

[0427] GAGCATGCCGTCGATCAGCCACAAACCCATCACAGCCAAGCTGGTGGCTGCCCCGGATGCCA

[0428] CCAAGCTCGAGCTCTCGTCCTACCTGTACCAGCAGCTCTTTTCCGACAAGCCAGCCGAGCCAT

[0429] ATGTTGCGTTCGAAGCTCCTGGAATCAAGTGGGCTCTGTATCCTGCTTCTGAGGACCGATCTC

[0430] TGCCGCAGTACACTTGCAAGGCCGACATTCGCCACGTGGCAGGCAGTCTCAAAAAGTTCATG

[0431] CCCGTGGTGCTCAAACGGGTCAACCCTGTCACGATTGAGCATGCCATCGTGACCGTGCCTGCC

[0432] AGCCAGTACGAAACGCTTAACACACCCGAACAAGTGCTCAAGGCTCTCGAGCCGCAACTCG

[0433] AC

[0434] intF3-up:

[0435] TACGCGAGTTCCCAAAGCAGAAGGGATGGCCTGTGGGTACGTCCACCGTGAAATTATCGGAG

[0436] AAAAAATGCCAGCGTCGAGCCCGTAGCGATGAGCAATGAGTATCTCAAGGATAGTTCGGTGA

[0437] ATACACCGTGGTTCTTAGACATGAGACATTACATTAGAAACGACCCGTGCGGGACTTATTAAA

[0438] CCTATGATACATGTGTGAGTGGCTCCAGGGCACCGCCATCTTACGCCACTCGACGTTTCCCAAT

[0439] AACTATAATAATGTCTGGTGCCTGTATACAACTGTTTGTAGAATGCTTCTTAGCTCATCCTGCAC

[0440] TATACTGCATATATTAATTTCGCTAAACACTCTACCCCCCAAGATCCGGCAGTTGTCATGCACCCC

[0441] GAATGGGCTCGGCTAGGATACGGAGATGCACAAGTCGGATGGCTGTGGGTGGAAAAAGAACT

[0442] GTCGTAAATGAGAAGACTCAAAAGGAGCAAGTCTGAAACTTGTGTGTCTCACGGCAAAG

[0443] ATTCCATGGATTGATGGGCGGGGTTGATGGACGCAGCCCACGTACGTGCGTCGCTAATAAGGT

[0444] ACGTACTATTTTTTTTACCCTTTTTTGTATCCTTTTTTTTACCCCAAAAAAACGCAACCCCGT

[0445] ATAAGCCTATCGAGGCGCGAGCATGTATCTATATGGGAGCTTTACGGGCACAGTAGTCGTATCG

[0446] CAAGAGCAAGATCCAGATGCCAAGGTCGGGTCTCCGGAGCATATTGTGTTTTGCACGCGCGGC

[0447] TCGTCCAAGAGTGGCCCGGTGGATCTGTCGGAATACGAGCGGGGAGATTGTTGTGTCTTACA

[0448] GCCACGACGTATTCCATACGGACACCAGCGTGGTCGGGGACAGTTGAGGACATGTCTCACCC

[0449] ACTTTTCGAAGCTCGCGATTTAGATCTAGGGAGGAGTAGCGTATTGGCAGATGGTGGGTACGT

[0450] TGGTGAGTTGGTGGAGTAGCTCCGTAGACGGATAGCAGAGCAGTAACAAACATTGGCAGTAG

[0451] GCGGTCTGTCAATCCGACCGCATCCCCTATAGGTTGCATCGGCCCTCAAGGGTCGACACATAC

[0452] CACTCTCAATCTTGCTCCAGAGACTTCCAGTAGTTTAGATACAACAATGGCAATGAAGATACA

[0453] AGTATGTACAGTAGATACGGGTACAAGAACTGATAACGAAGACAATGATTGTATGGGGTCTTG

[0454] ATGTATGTAGTACGAGTATGGACTACGCTGTTATTCTTTGAAGAACTTGTCTTGCTGGACAACA

[0455] CCATCTGCACACACCACGACAAATATATACAATATTCTATCGCTCATATTTACAATATTCTATCGC

[0456] TCATATTTACAATATTCTATTTCTCATATTTCTTTCAGTTTTTTTGCATTATCAATAATCATGTAAA

[0457] GTATGTGCTGTACAATACTGAAAGATAGTACATAGATACGACTATCGTACAAACTGGTAGTACT

[0458] TACACTGGTAGTACAAGTACAAGTAGAAGACAATCAATATTCTCAGACTCAACAAACGACGAT

[0459] CATGGTTACTACAAGGTACGTACTCGCACTCGTACCACCTGTACTTAGTTATACAACCGACACT

[0460] TGTACTGGCACTCGCACTCCTAACACGTCGACGCGTTTGACTCGCACGGCGGAATGTACCATG

[0461] CGCCAAAACAGTAATGATTTTGTCGAAATGGGGTGATTTCTGCAAGAAAAAATATATAAATAA

[0462] GCCACAATCTTCTCATTTAATCATGTGTAAAAAAACAGGACCTTTACCACGTCATTTTGAGTGC

[0463] CTGTCGTTCCCTTTCGCGTGGCTCGCGTTGCTGTCAGAACTATTTCACACCGCCAAATACACTT

[0464] CCTGCTTCAAGGCTGAACAACACCACATTACGCTTTCAGCGAAGAGATCTATATCTGAAGAGA

[0465] ACGGTGGAGATGGGGATGTATTGAACGAGTAGAAGGGGCAAAGGAGGGTGGAAAATTTACT

[0466] GGACGGTAAAATTATTTGTTTGAGGGGCCTCGTACCCTAGCCCTGATCTATATTGGTCTGTTAAT

[0467] CTCGTCTGTTGCCACCCAACCACCCCTCCCCTTAGATTCACGTGACTCTTACGTGGCATTACCC

[0468] GGCCGGCTTCTGAACAGCACA

[0469] intF3-dn:

[0470] TGGGGCGCTCCAGTGGGCCGAATGGAACGGGAGTTTGGGGGAATCAATGCTGTGACCCCCCA

[0471] GCTGCCCATACCCGCAAGAATATGGCCCCTCTTCAACCCCCATGGCGCCACCTGGTGGACTGT

[0472] TATTTTTTTTCTCCTCCAAACTTTCTCTAGGTTCACCTTTATTTAAGAAGTTACCAAGCGCTGAG

[0473] TCTAATGCCTGTCAACCCTAACGCTGCACTTTTGGAGAGAGCAGAACAAGGGAGCCCAAAA

[0474] ACAAGCATGTCACTTTTTCTTTTTTAGCGAAAACGACGGAACAAAAAACAAAGACCGGGAGCT

[0475] ATAAAGAAGAAGAAGAAGCGTCCGATTCGAAGAGCTGTATGAGCGACATTTCAGACCCCAAACAT

[0476] GGCTTCTATCTCGTGCGAGACAAAAATCAAACAAATAAAACCGATAACCGAAAAGCTATGAA

[0477] ACGAAACCCTACTGTTGTCGCCCTTGTTGCGCTTCTCCAAATCACATACAAGTTGACCTCAAC

[0478] TCCGTTCCGTTTGGCTTTGCCCTAAGAAAGGAAACGGCCCGGATACACGTTTATTTTCTTTGGT

[0479] TTCGCAGTTCTTTTGGCACAAAGTCTGGAATGGGCGGGGGGGCTTGAGAGAGGGACGAAAAA

[0480] AGGAGGCTCGCCATTGTCGTGCTGCTCATTTTGCGTGTCGGACTATCGATACTCAAACAGCA

[0481] ACAAAACCCTGTAAATACCGTTGCAAAACTGGTGATTGCTTCTTCCAACCCCTTCTTTCGTG

[0482] CCCTCGCTCTGTGAAAACTTTCCCCCAACCATTGAGGGATCAACACTCGGTTGCTTTTGGTTT

[0483] CGGTGTACTCTTGGTGCACTGTAGAGTATCGCACTTCAAGGGTCGGGTCTCCACAGGTGAAC

[0484] ACGTACGATGGACTAGCTAGAGCTACAGTACCGAAACCTCTACAAGTGACCAAACACGTGGA

[0485] GTTGCTGGCAACGATGGGAAAGTCCAAATGCGATGGTCACGTGTGATTTTCCATGCTTTTTCG

[0486] GCTCAAGTTTCACTGTTTTTGGCCGTCGTTTCGCGCAGGTTGTCTACAGGTTTTCCTCCAGGTT

[0487] TCGAGACTCGCCAAAGATTGCTGGAGAGACCGAAAAAGGGGAGGAGCAGCCAAAGATATGA

[0488] AAAATAGAATTCAATAAGGGAGAAACAAAGACCATGATATGAAATTAACCGCAACTAGATTAG

[0489] AATTAGTTTCATATATCATAGCAGACTCACATGCGACGGGGTACATCAAGGAAGACCACGAGG

[0490] ACTCCGCCACTGCAGTCGCTAGCCTCCAGCCAAGCCCTAACCGAAGCCTGCCGAAGCACTCC

[0491] GACGTCTCCCTTGCATACAAGACCTCATGTCATGATTGTTGGTGAGGTGCAGCTTATCAGCTCG

[0492] TACCGACGGGAAAAGACACGGTTGGGCGGCTCCGCCACGTGCAGATCTGATCTAAAGCTCAT

[0493] GTTCATGGACCTCTGTAATAATAACAATGGGACGGCGTCTCTGGCGAAGATAAAACTTTTCCA

[0494] ACTCATATTTGGTCGTCGCCCAACAAGTGCAACGCGGCCGACAGGGGTTTGTAGGCTTTTTCC

[0495] GCCCGCTGCCGCTGAGGTAAGCAGTGGACATCGAGCCGTGAGTGAAGCACGACAAGTGAGA

[0496] ATATACAAGTAGCCGTCTTCTACAGGCGTCTTCTACAGGCGTCTTCTACAGGCGTCTTCTACAG

[0497] GCACTAGTAGTTCTTTACATGGCATATGATTTTAGACCGTCTGCTTGATGTCTTATGTGTCAAAG

[0498] AGCTCAGACATTGCCAGAGTTTAGGAGGTGCCAAGATCGTCCAATGGTGAGACTGCATTGAC

[0499] ATTTTCAAATTGACAGCTTCCAGTGATGTGTGCTAGTGCAAATCTGGCATATTATAGCGTCATCT

[0500] GGTATCGCACCCGCCTTTGGCATGCTATACCTACGTCGCGCTCGTGTATAGTAGCTGCGGTAGA

[0501] TGCCCACTAAAGAACAAGCCTTGCGCTAGCATCAACACTAATTCTCGGTCCCCAGAA

[0502] Although the embodiments of the present invention are disclosed for illustrative purposes, those skilled in the art will appreciate that various substitutions, changes and modifications are possible without departing from the spirit and scope of the present invention and the appended claims. Therefore, the scope of the present invention is not limited to the contents disclosed in the embodiments.

Claims

1. An engineered strain of Yarrowia lipolytica for efficiently producing eicosapentaenoic acid through a cofactor strategy, characterized in that: The engineered strain is obtained by taking Yarrowia lipolytica Po1f as the starting strain, overexpressing Δ9 elongase, Δ8 desaturase, Δ5 desaturase and Δ17 desaturase genes, and simultaneously overexpressing glucose-6-phosphate dehydrogenase (G6PDH) and malic enzyme (ME).

2. The Yarrowia lipolytica engineered strain according to claim 1, characterized in that: The Δ9 elongase is derived from Euglenagracilis (EgElo9), and its gene sequence is shown in SEQ ID No. 1; The Δ8 desaturase is derived from Euglenagracilis (EgDes8), and its gene sequence is shown in SEQ ID No. 2; The Δ5 desaturase is derived from Euglenagracilis (EgDes5), and its gene sequence is shown in SEQ ID No. 3; The Δ17 desaturase is derived from Pythium aphanidermatum (PaDes17), and its gene sequence is shown in SEQ ID No. 4; The glucose-6-phosphate dehydrogenase is derived from Yarrowia lipolytica (G6PDH), and its gene sequence is shown in SEQ ID No. 5; The malic enzyme is derived from Yarrowia lipolytica (ME), and its gene sequence is shown in SEQ ID No.

6.

3. The method for constructing an engineered strain of Yarrowia lipolytica according to claim 1 or 2, characterized in that: The steps include: (1) Construction of recombinant plasmids pUC-SCP2-HUH-TE-EgElo9-EgDes8 and pUC-IntC-HUH-TE-EgDes5-PaDes17 Using pUC-SCP2-HUH-TE plasmid as a backbone, inserting EgElo9 and EgDes8 gene expression cassettes into the plasmid backbone, thus obtaining the recombinant plasmid pUC-SCP2-HUH-TE-EgElo9-EgDes8; Using pUC-IntC-HUH-TE plasmid as a backbone, inserting EgDes5 and PaDes17 gene expression cassettes into the plasmid backbone, thus obtaining the recombinant plasmid pUC-IntC-HUH-TE-EgDes5-PaDes17; (2) Construction of the genetically engineered strain Polf-D1 producing eicosapentaenoic acid The recombinant plasmid pUC-SCP2-HUH-TE-EgElo9-EgDes8 was transferred into the uracil-deficient Yarrowia lipolytica Polf to obtain the Yarrowia lipolytica Polf-D0, and Polf-D0 was inoculated into the YPD-5FOA solid medium. After a single colony was grown, it was streaked and activated again in the YPD solid medium to obtain the Yarrowia lipolytica Polf-D0 (URA-); the recombinant plasmid pUC-IntC-HUH-TE-EgDes5-PaDes17 was transferred into the Yarrowia lipolytica Polf-D0 (URA-) to obtain the Yarrowia lipolytica engineered strain Polf-D1; (3) Preparation of the engineered Yarrowia lipolytica strain Polf-D1 (URA-) The engineered strain Polf-D1 of Yarrowia lipolytica was inoculated into YPD-5FOA solid medium, and after a single colony was grown, it was streaked and activated again in YPD solid medium to obtain the engineered strain Polf-D1 of Yarrowia lipolytica (URA-); (4) Construction of recombinant plasmid pUC-intF3-HUH-TE-G6PDH Using pUC-intF3-HUH-TE plasmid as a backbone, inserting the G6PDH gene expression cassette into the plasmid backbone, thus obtaining the recombinant plasmid pUC-intF3-HUH-TE-G6PDH; (5) Preparation of the engineered strain Polf-D2 of Yarrowia lipolytica The recombinant plasmid pUC-intF3-HUH-TE-G6PDH was transformed into the Yarrowia lipolytica engineering strain Polf-D1 (URA-) to obtain the Yarrowia lipolytica engineering strain Polf-D2; (6) Construction of recombinant plasmid pUC-intF3-HUH-TE-ME Using pUC-intF3-HUH-TE plasmid as a backbone, inserting the ME gene expression cassette into the plasmid backbone, thus obtaining the recombinant plasmid pUC-intF3-HUH-TE-ME; (7) Preparation of the engineered strain Polf-D3 of Yarrowia lipolytica The recombinant plasmid pUC-intF3-HUH-TE-ME was transformed into the Yarrowia lipolytica engineering strain Polf-D1 (URA-) to obtain the Yarrowia lipolytica engineering strain Polf-D3; (8) Construction of recombinant plasmid pUC-intF3-HUH-TE-G6PDH-ME Using pUC-intF3-HUH-TE plasmid as a skeleton, inserting the G6PDH gene expression cassette and the ME gene expression cassette into the plasmid skeleton, thus obtaining the recombinant plasmid pUC-intF3-HUH-TE-G6PDH-ME; (9) Preparation of the engineered strain Polf-D4 of Yarrowia lipolytica The recombinant plasmid pUC-intF3-HUH-TE-G6PDH-ME was transformed into the Yarrowia lipolytica engineering strain Polf-D1 (URA-) to obtain the Yarrowia lipolytica engineering strain Polf-D4.

4. The construction method according to claim 3, characterized in that: The method for constructing the uracil auxotrophic Yarrowia lipolytica Po1f in step (2) is to knock out the uracil encoding gene in Yarrowia lipolytica Po1f by using CRISPR / Cas9 technology.

5. The construction method according to claim 3, characterized in that: The construction method of the recombinant plasmids pUC-SCP2-HUH-TE-EgElo9-EgDes8 and pUC-IntC-HUH-TE-EgDes5-PaDes17 in step (1) is as follows: using the pUC-SCP2-HUH-TE plasmid with a uracil genetic marker as a backbone, inserting a Δ9 elongase gene expression cassette and a Δ8 desaturase gene expression cassette into the plasmid backbone to obtain pUC-SCP2-HUH-TE-EgElo9-EgDes8. Using the pUC-IntC-HUH-TE plasmid with a uracil genetic marker as a backbone, inserting a Δ5 desaturase gene expression cassette and a Δ17 desaturase gene expression cassette into the plasmid backbone to obtain pUC-IntC-HUH-TE-EgDes5-PaDes17.

6. The construction method according to claim 3, characterized in that: In step (1), the promoters of the Δ9 elongase gene expression cassette, the Δ8 desaturase gene expression cassette, the Δ5 desaturase gene expression cassette and the Δ17 desaturase gene expression cassette are derived from P TEF Promoter, P EXP Promoter, P FBAin Promoter or P YAT The terminator is T from Yarrowia lipolytica. CYC1t Terminator, T xpr2t Terminator or T lip2t One of the terminators; In step (4) and step (8), the G6PDH gene expression cassette promoter is P derived from Yarrowia lipolytica. TEF Promoter, P EXP Promoter, P FBAin Promoter or P YAT The terminator is T from Yarrowia lipolytica. CYC1t Terminator, T xpr2t Terminator or T lip2t One of the terminators; In step (6) and step (8), the ME gene expression cassette promoter is P derived from Yarrowia lipolytica TEF Promoter, P EXP Promoter, P FBAin Promoter or P YAT The terminator is T from Yarrowia lipolytica. CYC1t Terminator, T xpr2t Terminator or T lip2t A type of terminator.

7. Use of the engineered strain of Yarrowia lipolytica as claimed in claim 1 or 2 in producing eicosapentaenoic acid.

8. A method for producing eicosapentaenoic acid by fermentation using the engineered strain of Yarrowia lipolytica as claimed in claim 1 or 2, characterized in that: The engineered strain of Yarrowia lipolytica produces eicosapentaenoic acid by fermentation on a fermentation medium; The formula of the fermentation medium is: 1.7 g / L YNB without amino acid and ammonium sulfate, 2.5 g / L yeast powder, 60 g / L glucose, the solvent is pure water, and sterilized at 115° C. for 30 minutes.

9. The method according to claim 8, characterized in that: The steps include: (1) Preparation of seed solution The Yarrowia lipolytica engineered strain was activated, inoculated into YPD liquid medium, and cultured to the logarithmic growth phase to obtain seed liquid; (2) Fermentation production of eicosapentaenoic acid Inoculating the seed liquid into the fermentation medium at a volume ratio of 1% to 5%, fermenting at 28 to 30° C. and 200 to 240 rpm, and cultivating with ventilation for 96 to 120 hours to obtain the fermentation product eicosapentaenoic acid; The formula of the fermentation medium is: 1.7 g / L YNB without amino acids and ammonium sulfate, 2.5 g / L yeast powder, 60 g / L glucose, the solvent is pure water, and sterilized at 115°C for 30 minutes.

10. The method according to claim 9, characterized in that: The number of viable bacteria in the seed solution in step (1) is 1.5×10 8 ~2.5×10 8 CFU / mL.

Images