Recombinant strain NT1003 ycjQ-LS01, construction method thereof and application of recombinant strain NT1003 ycjQ-LS01 in production of 1, 5-pentanediol

Abstract

The invention discloses a recombinant strain NT1003 ycjQ-LS01, a construction method of the recombinant strain NT1003 ycjQ-LS01 and application of the recombinant strain NT1003 ycjQ-LS01 to production of 1, 5-pentanediol. The method comprises the following steps: screening a key enzyme on a path for synthesizing 1, 5-pentanediol, forming a new path by using lysine decarboxylase CadA, transaminase PatA, amine oxidase ECAO and aldehyde reductase YahK, and finally introducing plasmids carrying the four enzymes into a strain NT1003 of which an alcohol degradation gene ycjQ is knocked out, so as to obtain a strain NT1003 ycjQ-LS01 with high yield of 1, 5-pentanediol. When the recombinant strain NT1003 ycjQ-LS01 takes Lys as a substrate, cofactors (only two NADPHs are needed) are reduced in a synthesis path, a production path (only four steps are needed) is simplified, and metabolic burden caused by introduction of excessive genes is avoided; in addition, an alcohol degradation gene ycjQ is knocked out of the strain, and degradation of pentanediol can be greatly reduced.

Description

Technical Field

[0001] The invention belongs to the technical field of bioengineering, and specifically relates to a recombinant strain NT1003△ycjQ-LS01 and a construction method thereof, and application thereof in producing 1,5-pentanediol. Background Art

[0002] 1,5-Pentanediol is a five-carbon aliphatic diol. The length of the carbon chain and the two hydroxyl groups at the end give it the potential to become a polymer monomer. It is an important raw material for the synthesis of polyester, unsaturated polyester and polyurethane, and can also be used to produce plastics, cosmetics and food. At present, the market size of 1,5-pentanediol is gradually increasing, and the global 1,5-pentanediol market is expected to grow from 320 million yuan in 2023 to 370 million yuan in 2030. The domestic market has changed rapidly in recent years. The global production capacity is about 3,000 tons / year, and the domestic market demand for 1,5-PDO alone has reached 2,000 tons / year, with a selling price of about 30,000 yuan / ton. With the expansion of the industrial and consumer goods markets, its market space will further expand.

[0003] At present, 1,5-PDO is mainly produced by hydrogenation reduction of glutaric acid esters or their diesters. In addition, there are also foreign companies that use biomass raw materials to synthesize 1,5-pentanediol through the furfural method. However, these synthesis methods have problems such as limited raw materials, complex production processes and high costs. The de novo synthesis of 1,5-pentanediol using glucose as a raw material not only avoids the problems of chemical synthesis methods, but is also more in line with the trend of green development.

[0004] Due to the lack of natural biosynthetic pathways for 1,5-PDO, artificially designed 1,5-pentanediol synthesis pathways are an important part of the biosynthesis of 1,5-PDO. At present, there are several artificially constructed 1,5-pentanediol synthesis pathways that have achieved the production of 1,5-PDO. The main ones are: 1) Chen Zhen's team used the cadaverine derivatization pathway: the engineered bacteria produced 1,5-PDO 2.62 g / L by shake flask fermentation, and 1,5-PDO 9.25 g / L by fed-batch fermentation. 2) Associate Professor Ma Chunling of Qilu University of Technology: Based on the metabolic engineering strategy of Escherichia coli, the researchers identified and introduced key exogenous pathways, and increased the activity of key enzymes to increase the yield of L-lysine derivatives 5-AVA, 5-HV and 1,5-PDO, and successfully synthesized up to 9.70 g / L of 5-HV, 8.31 g / L of 5-AVA and 10.98 g / L of 1,5-PDO. Summary of the invention

[0005] In view of the deficiencies in the prior art, the object of the present invention is to provide a recombinant strain NT1003△ycjQ-LS01 and a construction method thereof and application thereof in producing 1,5-pentanediol.

[0006] In order to solve the problems of the prior art, the technical solution adopted by the present invention is: A recombinant strain NT1003△ycjQ-LS01 is used as a starting strain, wherein the alcohol dehydrogenase gene ycjQ is knocked out, and lysine decarboxylase CadA, transaminase PatA, amine oxidase ECAO and aldehyde reductase YahK are overexpressed in the form of a recombinant plasmid pCDFTrc(△lacO)-cadA-yahK and a recombinant plasmid pTrc99a(K)-patA-ecaO.

[0007] The construction method of the above recombinant strain NT1003△ycjQ-LS01 comprises the following steps: Step 1, using upstream primer 1 and downstream primer 2 to perform PCR amplification on gene fragment cadA; using upstream primer 3 and downstream primer 4 to perform PCR amplification on gene fragment yahK; using upstream primer 5 and downstream primer 6 to perform PCR amplification on gene fragment patA; using upstream primer 7 and downstream primer 8 to perform PCR amplification on gene fragment ecao; Step 2: select pCDFDuet-1, replace the promoter and multiple cloning site of pCDFDuet-1 with the pTrc99a plasmid sequence, and delete the lactose operon sequence, which is recorded as pCDFTrc (△lacO); then use the plasmid pCDFTrc (△lacO) as a vector, and use nucleases NCOⅠ and KpnⅠ to digest at 37°C for 1 h to obtain a linearized vector; The ClonExpress II One Step Cloning Kit was used to perform homologous recombination on the linearized vector and the homologous arms at both ends of the fragment, and the amplified gene fragment cadA was constructed on pCDFTrc (△lacO). Then BamHI and HindIII were selected to construct the amplified gene fragment yahK on the plasmid using the same method, and the recombinant plasmid pCDFTrc (△lacO)-cadA-yahK was obtained. pTrc99a(K) was used as a vector and digested with endonucleases SacI and SalI at 37°C for 1 h to obtain a linearized vector pTrc99a(K). The linearized vector pTrc99a(K) and the homology arms between the fragments and the fragments were used to construct the two amplified fragments patA and ecaO onto the plasmid pTrc99a(K) using the ClonExpress II One Step Cloning Kit to obtain the recombinant plasmid pTrc99a(K)-patA-ecaO. Step 3, select the Lys high-producing bacteria NT1003, use the CRISPR-Cas9 system to knock out the YcjQ gene in the Escherichia coli genome, and obtain the recombinant strain NT1003△ycjQ; then use the recombinant strain NT1003△ycjQ-LS01 as the chassis, introduce the recombinant plasmid pCDFTrc(△lacO)-cadA-yahK and the plasmid recombinant plasmid pTrc99a(K)-patA-ecaO, and obtain the recombinant strain NT1003△ycjQ-LS01.

[0008] As an improvement, the PCR amplification conditions in step 1 are: pre-denaturation at 95°C for 5 min, followed by 95°C for 15 s, 55°C for 15 s, and 72°C T s for 30 cycles, wherein T=the number of bases of each gene / 1000×45.

[0009] The above-mentioned recombinant strain NT1003△ycjQ-LS01 is used for producing 1,5-pentanediol.

[0010] As an improvement, the application is to produce 3.94 g / L of 1,5-pentanediol by fermentation in a shake flask.

[0011] Beneficial effects: Compared with the prior art, the present invention discloses a recombinant strain NT1003△ycjQ-LS01 and its construction method and application in the production of 1,5-pentanediol, screens key enzymes in the synthesis pathway of 1,5-pentanediol, and introduces these four enzymes into the strain NT1003 with the alcohol degradation gene ycjQ knocked out through the treated plasmid to obtain the strain NT1003△ycjQ-LS01. When the recombinant strain NT1003△ycjQ-LS01 uses Lys as a substrate, it has fewer steps in the production pathway, avoiding the metabolic burden caused by the introduction of too many genes; in addition, the strain knocks out the alcohol degradation gene ycjQ, which can greatly reduce the degradation of pentanediol. Compared with the synthetic pathway with the highest yield in the fermentation tank currently, which was published in the journal ACS Synthetic Biology by Associate Professor Ma Chunling of the School of Bioengineering at Qilu University of Technology in a research paper titled "Metabolic Engineering of High L-Lysine-Producing Escherichiacoli for de Novo Production of L-Lysine-Derived Compounds", this biosynthetic 1,5-PDO pathway has fewer reaction steps (4 steps), requires fewer cofactors (only 2 NADPH), and has good market prospects. BRIEF DESCRIPTION OF THE DRAWINGS

[0012] Figure 1This is a diagram of the production of 1,5-PDO by shake flask fermentation of the recombinant strain NT1003△ycjQ-LS01 of the present invention. DETAILED DESCRIPTION

[0013] LB liquid medium (g / L): peptone 10, yeast powder 5, NaCl 5, pH 7.0~7.2.

[0014] LB solid medium (g / L): peptone 10, yeast powder 5, NaCl 5, agar 20, pH 7.0~7.2.

[0015] Seed culture medium (g / L): ammonium sulfate 10; sucrose 5; sodium glutamate 5; peptone 5; yeast powder 10; dipotassium hydrogen phosphate 0.5; magnesium sulfate heptahydrate 1; ferrous sulfate heptahydrate 0.032; manganese sulfate monohydrate 0.077; sodium pyruvate 0.55; methionine 0.3; threonine 0.3.

[0016] Shake flask fermentation medium (g / L): glucose 20; ammonium sulfate 10; peptone 5; yeast powder 2; potassium chloride 0.5; magnesium sulfate heptahydrate 1.6; zinc sulfate heptahydrate 0.086; anhydrous copper sulfate 0.077; manganese sulfate monohydrate 0.032; ferrous sulfate heptahydrate 0.032; calcium carbonate 10; methionine 0.3; threonine 0.1; vitamin B1 0.06; nicotinamide 0.01; biotin 0.00003.

[0017] Culture conditions: Before induction in shake tubes and shake flasks, the culture was carried out at 37°C and 200rpm. The volume of shake flask medium was 100mL and the inoculation volume was 2%. The shake flask medium used for whole-cell catalytic protein expression was LB medium, which was induced overnight at OD600 of 0.6 and then transferred to 30°C and 200rpm for overnight culture. The shake flask fermentation medium was used for NT1003 to produce 1,5-PDO from glucose fermentation, and after induction, it was also transferred to 30°C and 200rpm for fermentation.

[0018] Determination of substrates, products and by-products: Glucose and lysine were determined using SBA-40E biosensor. 1,5-Pentanediol was determined using Agilent1290 high performance liquid chromatograph and Aminex HPX-87H column (300x7.88mm). The detection wavelength was 210 nm. The mobile phase was 8 mM sulfuric acid solution with a flow rate of 0.6 mL / min. The column temperature was maintained at 60°C. Example 1 Construction of recombinant plasmid

[0019] Step 1, PCR amplification The gene fragment cadA was amplified by PCR using the upstream primer 1 and the downstream primer 2; the gene fragment yahK was amplified by PCR using the upstream primer 3 and the downstream primer 4; the gene fragment patA was amplified by PCR using the upstream primer 5 and the downstream primer 6; the gene fragment ecao was amplified by PCR using the upstream primer 7 and the downstream primer 8; Upstream primer 1 is shown in SEQ ID NO.1: CAcacaggaaacagaccatgTGGAAGGAGATATACA Downstream primer 1 is shown in SEQ ID NO.2: actctagaggatccccggCTTAGTGGTGGTGGTGGTGGTGTT The gene fragment cadA is shown in SEQ ID NO.3: Upstream primer 3 is shown in SEQ ID NO.4: CCACCACTAAGccggggatccAAGGAGATATACCATGGGCAGC Downstream primer 4 is shown in SEQ ID NO.5: tccgccaaaacagccaagcttTCAGTCTGTTAGTGTGCGATTATCGATAACAAAACG The gene fragment yahK is shown in SEQ ID NO.6: Upstream primer 5 is shown in SEQ ID NO.7: gaaacagaccatggaattcgagctcATGAACAGGTTACCTTCGAGCG Downstream primer 6 is shown in SEQ ID NO.8: GTTAAACAAATTACGCTTCTTCGACACTTACTCGCA The gene fragment patA is shown in SEQ ID NO.9: Upstream primer 7 is shown in SEQ ID NO.10: AGAAGCGTAATTTGTTTAACTTTAAGAAGGAGATATACCATGGGC Downstream primer 9 is shown in SEQ ID NO.11: cttgcatgcctgcaggtcgacGGGCTTTTGTTAGCAGCC The gene fragment ecao is shown in SEQ ID NO.12: Step 2, plasmid construction pCDFDuet-1 was selected, and the promoter and multiple cloning site of pCDFDuet-1 were replaced with the pTrc99a plasmid sequence, and the lactose operon sequence was deleted, which was recorded as pCDFTrc (△lacO). Then, the plasmid pCDFTrc (△lacO) was used as a vector and digested with nucleases NCOⅠ and KpnⅠ (purchased from Beijing Quanshijin Biotechnology Co., Ltd.) at 37℃ for 1 h to obtain a linearized vector.

[0020] The ClonExpress II One Step Cloning Kit (purchased from Nanjing Novogene Biotechnology Co., Ltd.) was used to perform homologous recombination on the linearized vector and the homologous arms at both ends of the fragment, and the amplified gene fragment cadA was constructed on pCDFTrc (△lacO). Then, BamHI and HindIII were selected to construct the amplified gene fragment yahK on the plasmid using the same method, thus obtaining the recombinant plasmid pCDFTrc (△lacO)-cadA-yahK.

[0021] Using pTrc99a(K) as the vector, the DNA was digested with endonucleases SacI and SalI (purchased from Beijing Quanshijin Biotechnology Co., Ltd.) at 37°C for 1 h to obtain the linearized vector pTrc99a(K). The linearized vector pTrc99a(K) and the homology arms between the fragments and the fragments were used to construct the two amplified fragments patA and ecaO into the plasmid pTrc99a(K) using the ClonExpress II One Step Cloning Kit to obtain the recombinant plasmid pTrc99a(K)-patA-ecaO.

[0022] The recombinant plasmid pCDFTrc(△lacO)-cadA-yahK and the recombinant plasmid pTrc99a(K)-patA-ecaO were mixed with 45 μL of DH5α competent cells (purchased from Nanjing Qingke Biotechnology Co., Ltd.) in a 1.5 mL sterile centrifuge tube, placed on ice for 30 minutes, heat-shocked at 42°C for 45 seconds, and then ice-bathed for 2-3 minutes. 800 μL of LB liquid medium was added, and the cells were revived on a shaker at 37°C at 200 rpm for 1 hour, and then coated with streptomycin and kanamycin plates. Colony PCR was performed to verify the positive clones. The positive clones were inoculated into the shake tubes and the plasmids were extracted and sent to Anhui General Sequencing Company for sequencing. The plasmids with the correct sequencing sequence were used for subsequent experiments.

[0023] Take 2 μL of recombinant plasmid pCDFTrc (△ lacO) -cadA-yahK and plasmid recombinant plasmid pTrc99a (K) -patA-ecaO and 20 μL of BL21DE3 competent cells (purchased from Nanjing Qingke Biotechnology Co., Ltd.) and mix them in a 1.5 mL sterile centrifuge tube. Place on ice for 30 minutes, heat shock at 42 ° C for 45 seconds, then ice bath for 2-3 minutes, add 800 μL of LB liquid medium, shake at 37 ° C 200 rpm for 1 hour, and then spread on a plate containing streptomycin and kanamycin resistance. The single strain obtained by overnight culture at 37 ° C and 200 rpm was selected and placed in a 5 mL LB shake tube. After culturing at 37 ° C 200 rpm for 12 hours, it was inoculated into a 100 mL LB shake flask and grown to OD at 37 ° C 200 rpm. 600 =0.6, and then induced and transferred to a 30°C 200rpm shaker for overnight culture. The cultured cells were collected, washed with 100mM pH=8 phosphate buffer, and the recombinant strains were collected for subsequent whole-cell catalytic verification.

[0024] The whole-cell catalytic reaction was carried out in a 50 ml shake flask. The system was set to 5 mL, with substrates Lys 50 mM, Glc 50 mM, α-ketoglutarate 50 mM, PLP 0.1 mM, Cu 2+ 20μM. Bacterial OD 600 The reaction was set to 20. The reaction was carried out in a shaker at 30°C and 200 rpm. Samples were taken every 4 hours, centrifuged and stored at -20°C. Lys was determined using an SBA-40E biosensor, and the production of the product 1,5-pentanediol was analyzed using high performance liquid chromatography.

[0025] The results showed that this pathway can catalyze the synthesis of 1,5-pentanediol using Lys as a substrate. The whole-cell catalytic yield reached a maximum of 0.493 g / L at 4 h, and then degradation occurred as time went on.

[0026] Table 1 Whole cell reaction products of recombinant strains

[0027] The yield is calculated as follows: Yield = yield / substrate consumption Example 2

[0028] The Lys high-producing strain NT1003 (strain NT1003 from CN202311274548.0) was selected, and the YcjQ gene was knocked out on the Escherichia coli genome using the CRISPR-Cas9 system to obtain the recombinant strain NT1003△ycjQ. The recombinant strain NT1003△ycjQ was then used as the chassis, and the recombinant plasmid pCDFTrc(△lacO)-cadA-yahK and the plasmid recombinant plasmid pTrc99a(K)-patA-ecaO were introduced into it according to the construction method described in Example 1 to obtain the recombinant strain NT1003△ycjQ-LS01.

[0029] A single colony of the recombinant NT1003△ycjQ-LS01 was inoculated into the seed culture medium, and after culturing at 37°C 200rpm for 24h, it was inoculated into a 500mL shake flask containing 30mL shake flask fermentation medium at a 2% inoculum. When OD600 reached 1.5, IPTG was added for induction and the culture was transferred to 30°C 200rpm for fermentation. Glucose was added during the fermentation. Samples were taken every 12h, and the products were detected by HPLC. The results are shown in Figure 1 shown.

[0030] As can be seen from the figure, the fermentation yield reached a maximum of 3.94 g / L at 120 hours and stabilized at 3.33 g / L at 155 hours.

[0031] In summary, compared with the synthesis pathway with the highest yield in the fermenter currently disclosed by Associate Professor Ma Chunling of the School of Bioengineering of Qilu University of Technology in a research paper entitled "Metabolic Engineering of High L-Lysine-Producing Escherichia coli for de Novo Production of L-Lysine-Derived Compounds" published in the journal ACS Synthetic Biology, the biosynthetic 1,5-PDO pathway of the present invention has fewer reaction steps (4 steps), requires fewer cofactors (only 2 NADPH), and has good market prospects.

Claims

1. A recombinant strain NT1003△ycjQ-LS01, characterized in that: The lysine high-yield strain NT1003 was used as the starting strain, the alcohol dehydrogenase gene ycjQ was knocked out, and the recombinant strains overexpressed lysine decarboxylase CadA, transaminase PatA, amine oxidase ECAO, and aldehyde reductase YahK in the form of recombinant plasmids pCDFTrc(△lacO)-cadA-yahK and pTrc99a(K)-patA-ecaO.

2. The construction method of the recombinant strain NT1003ΔycjQ-LS01 according to claim 1, characterized in that: The following steps are involved: Step 1, using upstream primer 1 and downstream primer 2 to perform PCR amplification on gene fragment cadA; using upstream primer 3 and downstream primer 4 to perform PCR amplification on gene fragment yahK; using upstream primer 5 and downstream primer 6 to perform PCR amplification on gene fragment patA; using upstream primer 7 and downstream primer 8 to perform PCR amplification on gene fragment ecao; Step 2: select pCDFDuet-1, replace the promoter and multiple cloning site of pCDFDuet-1 with the pTrc99a plasmid sequence, and delete the lactose operon sequence, which is recorded as pCDFTrc (△lacO); then use the plasmid pCDFTrc (△lacO) as a vector, and use nucleases NCOⅠ and KpnⅠ to digest at 37°C for 1 h to obtain a linearized vector; The ClonExpress II One Step Cloning Kit was used to perform homologous recombination on the linearized vector and the homologous arms at both ends of the fragment, and the amplified gene fragment cadA was constructed on pCDFTrc (△lacO). Then, BamHI and HindIII sites were selected and the amplified gene fragment yahK was constructed on the plasmid using the same method to obtain the recombinant plasmid pCDFTrc (△lacO)-cadA-yahK. pTrc99a(K) was used as a vector and digested with endonucleases SacI and SalI at 37°C for 1 h to obtain a linearized vector pTrc99a(K). The linearized vector pTrc99a(K) and the fragments, as well as the homology arms between the fragments, were used to construct the two amplified fragments patA and ecaO onto the plasmid pTrc99a(K) using the ClonExpress II One Step Cloning Kit to obtain the recombinant plasmid pTrc99a(K)-patA-ecaO. Step 3, select the Lys high-producing bacteria NT1003, use the CRISPR-Cas9 system to knock out the YcjQ gene in the Escherichia coli genome, and obtain the recombinant strain NT1003△ycjQ; then use the recombinant strain NT1003△ycjQ as the chassis, introduce the recombinant plasmid pCDFTrc(△lacO)-cadA-yahK and the plasmid recombinant plasmid pTrc99a(K)-patA-ecaO, and obtain the recombinant strain NT1003△ycjQ-LS01.

3. The construction method according to claim 2, characterized in that: The PCR amplification conditions in step 1 are: pre-denaturation at 95°C for 5 min, followed by 30 cycles of 95°C for 15 s, 55°C for 15 s, and 72°C for 2 s, where T = the number of bases in each gene / 1000×45.

4. Use of the recombinant strain NT1003△ycjQ-LS01 constructed based on the construction method of claim 2 in producing 1,5-pentanediol.

5. The use according to claim 4, characterized in that: The application is that the amount of 1,5-pentanediol produced by fermentation in a shake flask is 3.94 g / L.

Images