Gene Aokap10 for improving kojic acid yield of aspergillus oryzae, method and application

Abstract

The invention provides a gene Aokap10 for improving the kojic acid yield of aspergillus oryzae, a method and application. The invention finds that in the Aspergillus oryzae Aokap10 gene, nucleotide sequences from the 198 site to the 217 site are taken as target sequences, the site-specific knockout of the Aokap10 gene can be efficiently realized, and when insertion or deletion occurs at the 198 site to the 217 site of the sequence as shown in SEQ ID NO.2, the encoding protein of the Aokap10 gene can be damaged, so that the kojic acid yield of the Aspergillus oryzae is increased, and the application prospect is broad. The construction efficiency of the engineering strain for high yield of kojic acid based on Aokap10 gene mutation is effectively improved.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology, and in particular relates to a gene Aokap10 for improving the kojic acid yield of Aspergillus oryzae, a method and an application thereof. Background Art

[0002] Aspergillus oryzae is a filamentous fungus with important production and application value. Aspergillus oryzae has been used for hundreds of years in the production of traditional fermented foods such as soy sauce and rice wine and is considered a GRAS strain. Due to its strong protein production and secretion capabilities, it is used as a host for protein production. In addition, Aspergillus oryzae can also be used to produce some secondary metabolites with important application value, such as kojic acid.

[0003] Kojic acid is an organic acid with multiple uses. Kojic acid is widely used in food, medicine, agriculture, cosmetics and other fields because of its antibacterial, antioxidant, and tyrosinase inhibitory biological activities. At present, kojic acid is mainly produced by Aspergillus oryzae using sugar fermentation. However, the kojic acid yield of Aspergillus oryzae isolated from nature is generally not high, and mutagenesis is usually required to screen high-yielding kojic acid strains. However, current studies have shown that the effect of mutagenesis on increasing kojic acid yield is becoming less and less obvious. Therefore, compared with traditional mutagenesis to increase kojic acid yield, using genetic engineering to genetically modify Aspergillus oryzae and increase Aspergillus oryzae yield is a more advantageous means. However, the premise of using genetic engineering to genetically modify Aspergillus oryzae and increase kojic acid yield is to clarify the gene target for increasing kojic acid yield. Therefore, it is urgent to study the regulatory mechanism of kojic acid synthesis in depth to provide excellent gene targets for achieving efficient biosynthesis of kojic acid. Summary of the invention

[0004] In order to solve the above technical problems, the present invention provides a gene Aokap10 for improving the kojic acid production of Aspergillus oryzae, a method and an application thereof.

[0005] The technical solution adopted by the present invention to achieve the technical purpose is:

[0006] In a first aspect, the present invention provides a gene Aokap10 for improving the kojic acid production of Aspergillus oryzae, wherein the encoded protein of the gene Aokap10 has any one of the following amino acid sequences:

[0007] A1) the amino acid sequence shown in SEQ ID NO.1;

[0008] A2) a protein having 75% or more identity with the protein shown in A1) and having the same function as the protein shown in A1) obtained by substitution and / or deletion and / or addition of amino acid residues of the amino acid sequence shown in SEQ ID No.1;

[0009] A3) A protein having the same function as A1) or A2) obtained by connecting a tag to the N-terminus and / or C-terminus.

[0010] A person skilled in the art can easily mutate the nucleotide sequence encoding the protein Aokap10 of the present invention by using known methods, such as directed evolution or point mutation. Those artificially modified nucleotides having 75% or more identity with the nucleotide sequence of the protein Aokap10 isolated by the present invention are all derived from the nucleotide sequence of the present invention and are equivalent to the sequence of the present invention as long as they encode the protein Aokap10 and have the function of the protein Aokap10.

[0011] The aforementioned 75% or more identity may be 80%, 85%, 90% or 95% or more identity.

[0012] In the present invention, the above 80% identity may be at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identity.

[0013] In order to facilitate the purification or detection of the protein, a tag protein may be connected to the amino terminal or carboxyl terminal of the protein consisting of the amino acid sequence shown in SEQ ID No. 1 in the sequence table.

[0014] The tag protein includes but is not limited to: GST (glutathione sulfhydryltransferase), His6 tag protein (histidine tag protein), MBP (maltose binding protein) tag protein, Flag tag protein, SUMO tag protein, HA tag protein, Myc tag protein, eGFP (enhanced green fluorescent protein), eCFP (enhanced cyan fluorescent protein), eYFP (enhanced yellow fluorescent protein) or mCherrry (monomeric red fluorescent protein).

[0015] In a second aspect, the present invention provides a gene Aokap10 for improving the kojic acid production of Aspergillus oryzae, wherein the gene Aokap10 has any one of the following nucleotide sequences:

[0016] C1) the coding sequence is a cDNA molecule of SEQ ID No. 2;

[0017] C2) a DNA molecule whose nucleotide sequence is SEQ ID No. 2;

[0018] C3) A nucleic acid molecule obtained by modifying the codon preference based on the nucleotide sequence shown in SEQ ID No. 2;

[0019] C4) A nucleic acid molecule having a nucleotide sequence identity of more than 95% with the nucleotide sequence shown in SEQ ID No. 2 and originating from the same species.

[0020] The gene Aokap10 of the present invention may be any nucleotide sequence that can encode the protein of the gene Aokap10. Considering the degeneracy of codons and the preference of codons of different species, those skilled in the art may use codons suitable for expression of a specific species as needed.

[0021] In a third aspect, the present invention provides biological materials related to regulating the expression of the gene Aokap10, wherein the biological materials include nucleic acids capable of destroying the biological function of the protein encoded by the gene Aokap10.

[0022] The biological material related to regulating the expression of the gene Aokap10 may be a substance that performs at least one of the following six types of regulation:

[0023] 1) Regulation at the transcription level of the gene; 2) Regulation after transcription of the gene (that is, regulation of the splicing or processing of the primary transcript of the gene; 3) Regulation of RNA transport of the gene (that is, regulation of the transport of the mRNA of the gene from the nucleus to the cytoplasm); 4) Regulation of translation of the gene; 5) Regulation of mRNA degradation of the gene; 6) Post-translational regulation of the gene (that is, regulation of the activity of the protein translated from the gene).

[0024] Furthermore, the regulating gene expression may be inhibiting or reducing the gene expression, and the inhibiting or reducing the gene expression may be achieved by gene knockout or by gene silencing.

[0025] The gene knockout refers to the phenomenon of inactivating a specific target gene through homologous recombination. Gene knockout is the inactivation of a specific target gene by changing the DNA sequence.

[0026] The gene silencing refers to the phenomenon that the gene is not expressed or is underexpressed without damaging the original DNA. Gene silencing is based on the premise that the DNA sequence is not changed, so that the gene is not expressed or is underexpressed. Gene silencing can occur at two levels, one is gene silencing at the transcriptional level caused by DNA methylation, heterochromatinization and position effect, and the other is post-transcriptional gene silencing, that is, at the level after gene transcription, the gene is inactivated by specifically inhibiting the target RNA, including antisense RNA, co-suppression, gene repression, RNA interference (RNAi) and micro RNA (mi RNA) mediated translation inhibition, etc.

[0027] The nucleic acid in the present invention may be DNA, such as cDNA, genomic DNA or recombinant DNA; the nucleic acid molecule may also be RNA, such as gRNA, mRNA, siRNA, shRNA, sgRNA, miRNA or antisense RNA.

[0028] Preferably, the nucleic acid comprises an sgRNA for mutating the gene Aokap10, and the target sequence of the sgRNA is from position 198 to position 217 of the sequence shown in SEQ ID NO.2.

[0029] More preferably, the biological material further comprises an expression cassette, a vector, a host cell, an engineered bacterium or a transgenic plant cell line containing the nucleic acid.

[0030] The vectors described in the present invention are well known to those skilled in the art, including but not limited to: plasmids, phages (such as lambda phage or M13 filamentous phage, etc.), cosmids (i.e., cosmids), Ti plasmids, viral vectors, etc.

[0031] In one embodiment of the present invention, the vector may be a pPRTII-Cas9 vector.

[0032] The recombinant vector described in the present invention can specifically be pPRTII-Cas9-Aokap10. The recombinant vector pPRTII-Cas9-Aokap10 contains an editing target site (positions 198-217 of SEQ ID No. 2) and a gene encoding the Cas9 protein. After being introduced into the recipient Aspergillus oryzae, the transcribed guide RNA (sgRNA) can target the target sequence (target site) near the PAM of the recipient Aspergillus oryzae genome through base complementary pairing, that is, target the Aokap10 gene, edit the Aokap10 gene (targeted mutation), and thus achieve knockout of the Aokap10 gene.

[0033] In a fourth aspect, the present invention provides a method for regulating the synthesis of kojic acid in Aspergillus oryzae or constructing an engineered strain with high kojic acid production, comprising: increasing the kojic acid production of Aspergillus oryzae by destroying the biological function of the protein encoded by the gene Aokap10.

[0034] The above-mentioned destruction of the biological function of the protein encoded by the gene Aokap10 can be achieved by conventional technical means in the art, for example, by using gene mutation, gene knockout, gene editing or gene knockdown technology to reduce or inactivate the activity of the gene encoding the protein Aokap10 in the target fungal genome.

[0035] Preferably, the biological function of the protein encoded by the gene Aokap10 is destroyed by using CRISRP / Cas9 technology; the target sequence of the sgRNA used in the CRISRP / Cas9 technology is from position 198 to position 217 of the sequence shown in SEQ ID NO.2.

[0036] More preferably, in one embodiment of the present invention, the above method comprises:

[0037] (1) constructing a CRISPR / Cas9 recombinant vector for targeted editing of positions 198 to 217 of SEQ ID No. 2;

[0038] (2) introducing the recombinant vector constructed in step (1) into the target fungus (such as Aspergillus oryzae);

[0039] (3) A transgenic fungus with a kojic acid production higher than that of the target fungus is obtained through screening and identification.

[0040] Preferably, in the above step (1), the CRISPR / Cas9 gene editing plasmid is a type II CRISPR system.

[0041] Preferably, in the above step (2), the CRISRP / Cas9 gene editing plasmid constructed in step (1) is transferred into Aspergillus oryzae by protoplasts.

[0042] Preferably, in the above step (3), the identification method is specifically: using specific primers of the Aspergillus oryzae Aokap10 gene to amplify the transformed Aspergillus oryzae Aokap10 gene fragment and sequence it; if an insertion or deletion mutation occurs in the nucleic acid sequence from positions 198 to 217 of the sequence shown in SEQ ID NO.2, it indicates that the biological function of the Aspergillus oryzae Aokap10 gene is damaged.

[0043] The host cell of the present invention is a filamentous fungal host cell Aspergillus oryzae, preferably a filamentous fungal host cell of the genus Aspergillus, including but not limited to Aspergillus oryzae.

[0044] In a fifth aspect, the present invention provides the use of the above-mentioned gene Aokap10, the protein encoded therein or the above-mentioned biological material in regulating the synthesis of kojic acid in Aspergillus oryzae or constructing an engineered bacterium with high kojic acid production.

[0045] Preferably, in the above application, the kojic acid production of Aspergillus oryzae is increased by destroying the biological function of the protein encoded by the gene Aokap10.

[0046] The beneficial effects of the present invention are:

[0047] (1) The present invention provides a new gene for increasing the kojic acid content of Aspergillus oryzae: the Aokap10 gene. The kojic acid production of Aspergillus oryzae can be significantly increased by gene editing of the Aokap10 gene. Experiments have shown that the Aokap10 gene has the function of increasing the kojic acid production of Aspergillus oryzae, and the kojic acid production of Aspergillus oryzae can be significantly promoted by destroying the biological function of the protein encoded by the Aokap10 gene. The present invention provides an important functional gene for genetic improvement of increasing the kojic acid production of Aspergillus oryzae.

[0048] (2) The present invention achieves efficient site-specific knockout of Aokap10 through gene editing technology. The present invention finds that the nucleotide sequence from position 198 to position 217 in the Aokap10 gene of Aspergillus oryzae is used as the target sequence, which can efficiently achieve site-specific knockout of the Aokap10 gene, and insertion or deletion from position 198 to position 217 of the sequence shown in SEQ ID NO.2 will cause the encoded protein of the Aokap10 gene to be destroyed, thereby increasing the kojic acid production of Aspergillus oryzae, and effectively improving the efficiency of constructing an engineering strain with high kojic acid production based on Aokap10 gene mutation. BRIEF DESCRIPTION OF THE DRAWINGS

[0049] Figure 1 Mutation types of the nucleotide sequence of the Aokap10 gene in the homozygous mutant strain of the Aokap10 gene under the wild-type Aspergillus oryzae 3.042 background.

[0050] Figure 2 Mutation types of the amino acid sequence of the Aokap10 gene in the homozygous mutant strain of the Aokap10 gene in the wild-type Aspergillus oryzae 3.042 background.

[0051] Figure 3 Analysis of kojic acid production in wild-type Aspergillus oryzae 3.042 and homozygous mutant strains of the Aokap10 gene. DETAILED DESCRIPTION

[0052] The present invention is further described in detail below in conjunction with specific embodiments, and the examples provided are only for illustrating the present invention, rather than for limiting the scope of the present invention. The examples provided below can be used as a guide for further improvements by those of ordinary skill in the art, and do not constitute a limitation of the present invention in any way.

[0053] The experimental methods in the following examples, unless otherwise specified, are all conventional methods, and are performed according to the techniques or conditions described in the literature in the field or according to the product instructions. The materials, reagents, etc. used in the following examples, unless otherwise specified, can all be obtained from commercial channels.

[0054] The Aspergillus oryzae strain in the following examples: Aspergillus oryzae 3.042 (CICC 40092), is publicly available from the China Industrial Microbiological Culture Collection Administration Center.

[0055] In the embodiment of the present invention, the CRISPR-Cas9 vector is a pPRTII-Cas9 vector, which has been described in Yuzhen Li # ,Huanxin Zhang # ,Junxia Fan # ,Ziming Chen,Tianming Chen,Bin Zeng,Zhe Zhang*Ahighly efficient identification of mutants generated by CRISPR / Cas9 using thenon-functional DsRed assisted selection in Aspergillus oryzae,World Journalof Microbiology and Biotechnology,2021,37:132,The public can obtain it from the School of Life Sciences of Jiangxi Science & Technology Normal University. The biological material is only used to repeat the relevant experiments of the present invention and cannot be used for other purposes.

[0056] The primer sequences used in the present invention are shown in Table 1 below.

[0057] Table 1. Primer sequence information in the present invention

[0058]

[0059]

[0060] Example 1. Construction of Aokap10 gene editing knockout vector

[0061] According to the coding sequence of AO090023000796 gene (Aokap10 gene) (SEQ ID No. 2), the primer sequence of the target site of Aokap10 gene knockout was designed by CRISPRdirect web server (https: / / crispr.dbcls.jp / ). The primer sequence of the target site was:

[0062] TU6-Aokap10-F:TATCCCCGTTGCTGCCGTGAGTTTTAGAGCTAGAAATAGCAAGTTAAA

[0063] 1. Obtaining U6 promoter (PU6), gRNA and U6 terminator (TU6)

[0064] When amplifying the PU6 fragment: using the genomic DNA of the Aspergillus oryzae RIB40 strain as a template, using PU6-F and PU6-Aokap10-R as primers, the amplification system is shown in Table 2, and the PU6-Aokap10 fragment is obtained.

[0065] When amplifying gRNA and TU6, the previously constructed vector pPTRII-Cas9-kojA was used as a template (the vector contains sgRNA and U6 terminator sequences, as described in Yuzhen Li # ,Huanxin Zhang # ,Junxia Fan # , Ziming Chen, Tianming Chen, Bin Zeng, Zhe Zhang*A highly efficient identification of mutants generated by CRISPR / Cas9 using the non-functional DsRed assisted selection in Aspergillus oryzae, World Journal of Microbiology and Biotechnology, 2021, 37: 132), PCR amplification was performed using TU6-Aokap10-F and TU6-R as primers (the amplification system is shown in Table 2) to obtain Aokap10-sgRNA-TU6.

[0066] Table 2. 50 μl amplification system of U6 promoter

[0067]

[0068] Amplification conditions: pre-denaturation at 95°C for 30 s, denaturation at 95°C for 10 s, annealing at 55°C for 30 s, extension at 72°C for 5 min, 35 cycles, and complete extension at 72°C for 5 min.

[0069] 2. Obtaining the gRNA expression cassette containing Aokap10 targeting

[0070] Take 1 μL of PU6-Aokap10 and Aokap10-sgRNA-TU6 PCR products as templates, use PU6-F and TU6-R as primers, and perform overlapping PCR amplification (overlapping PCR amplification system is shown in Table 3). Obtain the gRNA expression cassette PU6-Aokap10-sgRNA-TU6 containing Aokap10 targeting.

[0071] Table 3. Overlapping PCR amplification system

[0072]

[0073] Amplification conditions: 95°C pre-denaturation for 2 min, 95°C denaturation for 10 s, 55°C annealing for 30 s, and 72°C extension for 5 min. After 5 cycles, 4 μl of primers (PU6-F and TU6-R mixture (10 μM)) were added and amplified for 30 cycles to obtain the sgRNA expression cassette PU6-Aokap10-sgRNA-TU6 containing the Aokap10 gene targeting sequence.

[0074] 3. Obtaining the CRISPR-Cas9 knockout vector for Aokap10 gene

[0075] 3.1 Enzyme digestion of CRISPR-Cas9 knockout vector pPTRII-Cas9

[0076] The pPTRII-Cas9 plasmid was digested with Sma I (enzyme digestion system see Table 4), and the digestion product was recovered to obtain a linear pPTRII-Cas9 fragment.

[0077] Table 4. pPRTII-Cas9 vector restriction enzyme digestion system

[0078]

[0079] Incubate at 37°C for 1 hour.

[0080] 3.2 Reorganization connection

[0081] The ligase used was a recombinase, and the linearized pPTRII-Cas9 fragment was recombined and ligated with the PU6-Aokap10-TU6 expression cassette using the recombinase to obtain the recombinant plasmid pPTRII-Cas9-Aokap10 (the recombination ligation reaction system is shown in Table 5).

[0082] Table 5. Recombination ligation reaction system

[0083]

[0084] Incubate at 37°C for 30 min, then cool to 4°C or place on ice immediately.

[0085] 3.3 Transformation of recombinant vector into Escherichia coli

[0086] 1) Take 50 μl of competent E. coli Trans10 stored at -80°C, add 2 μl of the above-mentioned recombinant ligation product, mix well, and place on ice for 30 min;

[0087] 2) Incubate in 42°C water bath for 45 seconds, then place on ice for 2 minutes;

[0088] 3) Add 500 μl of antibiotic-free LB liquid medium to the competent E. coli Trans10 and culture at 37°C, 200 rpm for 1 hour;

[0089] 4) Centrifuge at 5000 rpm for 2 min, keep 200 ml of supernatant, mix well, spread the bacterial solution on LB solid medium containing ampicillin antibiotics, and culture at 37°C overnight;

[0090] 3.4 Identification of positive monoclones

[0091] Use a sterilized small pipette to pick up a single E. coli colony on the solid plate, put it into a centrifuge tube containing 1000 μl of ampicillin LB liquid culture medium, and culture it at 37°C, 200 rpm for 6-8 hours. Then take 2 μl of the bacterial solution as a template and use PU6-F / TU6-R for colony PCR detection. The bacterial solution PCR amplification system is shown in Table 6.

[0092] Table 6. Bacterial liquid PCR amplification system

[0093]

[0094] Amplification conditions: pre-denaturation at 95°C for 2 min, denaturation at 95°C for 10 s, annealing at 55°C for 30 s, extension at 72°C for 30 s, 35 cycles, and complete extension at 72°C for 5 min.

[0095] The PCR products were tested by electrophoresis, and the positive clones were selected and sent for sequencing. After sequencing, the correct CRISPR-Cas9-Aokap10-1 was obtained.

[0096] 3.5 Plasmid extraction

[0097] Plasmid extraction was carried out according to the instructions of the endotoxin-free plasmid mini-extraction kit (TIANGEN, DP118) to obtain the CRISPR-Cas9-Aokap10-1 plasmid.

[0098] Example 2: Obtaining Aokap10 knockout bacteria

[0099] 1. Aspergillus oryzae protoplast transformation

[0100] 1) Prepare 100 ml of DPY liquid medium (2% glucose, 1% peptone, 0.5% yeast extract, 0.5% KH2PO4, 0.05% MgSO4·7H2O, pH 5.5), inoculate newly collected Aspergillus oryzae 3.042 spores into the DPY liquid medium, and culture at 200 rpm for 16-20 h. Then collect the mycelium and wash it once with a buffer (50 mM maleic acid, 0.6 M (NH4)2SO4, pH 5.5);

[0101] 2) Prepare 10 ml of enzyme solution containing 1% Yatalase (TaKaRa) and 1.5% cell lysing enzyme (Sigma) to lyse the mycelium at 30°C, 60 rpm, for 3 h;

[0102] 3) Resuspend the protoplasts with washing buffer (1.2 M sorbitol, 50 mM CaCl2·2H2O, 35 mM NaCl, 10 mM Tris-HCl, pH 7.5), centrifuge at 2,000 rpm, 4°C for 8 min to collect the protoplasts, resuspend the protoplasts with washing buffer, and place on ice;

[0103] Mix 10 μg pPTRII-Cas9-Aokap10-1 with 200 μl protoplasts and incubate on ice for 30 min. Then add PEG buffer (60% PEG 4000, 50 mM CaCl2·2H2O, 10 mM Tris-HCl, pH 7.5) three times (250 μl, 250 μl, 850 μl), mix gently, and let stand at room temperature for 10-20 min.

[0104] The PEG-treated protoplasts were diluted with washing buffer, and the protoplasts were collected by centrifugation at 1,000 rpm, 8 min, and 4°C. Then, M+Met medium (0.2% NH4Cl, 0.1% (NH4)2SO4, 0.05% KCl, 0.05% NaCl, 0.1% KH2PO4, 0.05% MgSO4·7H2O, 0.002% FeSO4·7H2O, 2% glucose, 0.15% methionine, 1.2M sorbitol, pH 5.5) containing 1.2M sorbitol and 0.5% agar was added and mixed. The culture was spread on M+Met medium plates containing 1.2M sorbitol and 1.5% agar, and cultured at 30°C for 3-5 days.

[0105] 2. Screening and identification of positive strains

[0106] Screening of positive strains: The hyphae grown on M+Met solid medium were transferred to CD+0.1 μg / ml pyridinium sulfate (PT) solid medium for screening and cultured at 30°C for 3-5 days.

[0107] PCR identification of positive strains: Pick the mycelium on the CD+PT screening medium, put it into a centrifuge tube, add 100 μl 25 mM NaOH, and boil it at 100°C for 20 minutes. Take the supernatant as a template and amplify it with primers CRISPR-S-Aokap10-F / R (SEQ ID NO.7 and SEQ ID NO.8).

[0108] The amplification system was: supernatant DNA template: 2 μl; CRISPR-S-Aokap10-F / R: 4 μl; dNTPs: 4 μl; 2×Buffer: 25 μl; KOD DNA polymerase: 1 μl; ddH2O: 14 μl.

[0109] PCR amplification program: 94°C pre-denaturation for 2 seconds, 98°C denaturation for 10 seconds, 55°C annealing for 30 seconds, 68°C extension for 30 seconds, 35 cycles, and 72°C full extension for 5 minutes.

[0110] The obtained PCR product stock solution was directly sent for testing. By sequencing the DNA sequences of the Aokap10 target region of multiple positive transformation events, it was found that the Aokap10 target region sequences of two positive strains (ΔAokap10-1 and ΔAokap10-2) had changed. The sequences before and after editing were as follows Figure 1 and 2 shown.

[0111] Nucleotide sequence comparison analysis found that compared with the unedited wild type (WT), the Aokap10 gene in the ΔAokap10-1 mutant underwent a deletion mutation (1 base deletion) at the target, and the Aokap10 gene in the ΔAokap10-2 mutant underwent a deletion mutation (123 base deletion) at the target. These mutations caused frameshift or deletion of its amino acids, so the protein function of the Aokap10 gene in both Aokap10 mutants was lost.

[0112] Example 3: Determination of kojic acid production in Aokap10 knockout bacteria

[0113] The method for fermenting and producing kojic acid using the Aspergillus oryzae Aokap10 knockout bacteria constructed by the present invention comprises the following specific steps:

[0114] Fermentation medium: 100 g / L glucose, 1 g / L potassium dihydrogen phosphate, 0.5 g / L magnesium sulfate, 0.5 g / L potassium chloride, 1 g / L yeast extract.

[0115] Fermentation method: First, spread the Aokap10 knockout bacteria spore liquid on the solid fermentation medium and culture it at 30°C. After 3 days, add an appropriate amount of sterile water to wash off the spores on the medium, and filter with lens paper to collect the spore liquid. Then use a hemocytometer to count the number of spores in the spore liquid and calculate the number of spores according to 1×10 7 spores / ml were inoculated into 40ml of liquid fermentation medium and fermented at 30°C and 200 rpm for 7 days.

[0116] Determination of kojic acid content by ferrous sulfate colorimetric method: Take 2 ml of fermentation supernatant and centrifuge to remove impurities in the fermentation broth. Colorimetric system: 0.5 ml of fermentation supernatant, 1 ml of colorimetric solution (0.06 M FeCl3 and 0.27 M HCl), 0.5 ml of ddH2O. Replace the fermentation supernatant with water as a control and measure its absorbance at a wavelength of 500 nm. Finally, the kojic acid content of the sample is calculated using the kojic acid standard curve.

[0117] The kojic acid color development results showed that compared with the fermentation broth of the wild-type 3.042 strain, the fermentation broth of the Aokap10 knockout strain showed a darker red color ( Figure 3 A), indicating that knocking out Aokap10 promotes the synthesis of kojic acid in Aspergillus oryzae. The kojic acid content determination showed that the kojic acid production of Aokap10 knockout strain increased by 131% compared with the wild-type 3.042 strain, and the average content reached 37.02 mg / ml·g. Figure 3 As shown in B.

[0118] The present invention has been described in detail above. For those skilled in the art, without departing from the purpose and scope of the present invention, and without the need to carry out unnecessary experimental conditions, the present invention can be implemented in a wide range under equivalent parameters, concentrations and conditions. Although the present invention provides specific embodiments, it should be understood that the present invention can be further improved. In a word, according to the principles of the present invention, the application is intended to include any changes, uses or improvements to the present invention, including departure from the disclosed scope in the application, and changes made with conventional techniques known in the art.

Claims

1. A gene Aokap10 for improving the kojic acid production of Aspergillus oryzae, wherein the protein encoded by the gene Aokap10 is any one of the following: A1) a protein with an amino acid sequence as shown in SEQ ID NO.1; A2) a protein having 75% or more identity with the protein shown in A1) and having the same function as the protein shown in A1) obtained by substitution and / or deletion and / or addition of amino acid residues of the amino acid sequence shown in SEQ ID No.1; A3) A protein having the same function as A1) or A2) obtained by connecting a tag to the N-terminus and / or C-terminus.

2. The gene Aokap10 according to claim 1, characterized in that The gene Aokap10 has any of the following nucleotide sequences: C1) the coding sequence is a cDNA molecule of SEQ ID No. 2; C2) a DNA molecule whose nucleotide sequence is SEQ ID No. 2; C3) A nucleic acid molecule obtained by modifying the codon preference based on the nucleotide sequence shown in SEQ ID No. 2; C4) A nucleic acid molecule having a nucleotide sequence identity of more than 95% with the nucleotide sequence shown in SEQ ID No. 2 and originating from the same species.

3. A biological material related to regulating the expression of the gene Aokap10 according to claim 1, wherein the biological material comprises a nucleic acid capable of destroying the biological function of the protein encoded by the gene Aokap10.

4. The biomaterial according to claim 3, characterized in that The nucleic acid includes an sgRNA for mutating the gene Aokap10, and the target sequence of the sgRNA is from position 198 to position 217 of the sequence shown in SEQ ID NO.

2.

5. The biomaterial according to claim 3 or 4, characterized in that: The biological material also includes an expression box, a vector, a host cell, an engineering bacterium or a transgenic plant cell line containing the nucleic acid.

6. A method for regulating the synthesis of kojic acid in Aspergillus oryzae or constructing a high-yield kojic acid engineering strain, comprising: The kojic acid production of Aspergillus oryzae is increased by destroying the biological function of the protein encoded by the gene Aokap10 described in claim 1.

7. The method according to claim 6, characterized in that The biological function of the protein encoded by the gene Aokap10 is destroyed by using CRISRP / Cas9 technology. The target sequence of the sgRNA used in the CRISRP / Cas9 technology is as shown in SEQ ID Positions 198 to 217 of the sequence shown in NO.

2.

8. The method according to claim 7, characterized in that The steps include: (1) constructing a CRISPR / Cas9 recombinant vector for targeted editing of positions 198 to 217 of SEQ ID No. 2; (2) introducing the recombinant vector constructed in step (1) into the target fungus; (3) A transgenic fungus with a kojic acid production higher than that of the target fungus is obtained through screening and identification.

9. Use of the gene Aokap10 according to claim 1, the protein encoded therein or the biomaterial according to claim 3 in regulating the synthesis of kojic acid in Aspergillus oryzae or constructing an engineered bacterium with high kojic acid production.

10. The use according to claim 9, characterized in that: The kojic acid production of Aspergillus oryzae is increased by disrupting the biological function of the protein encoded by the gene Aokap10.

Images