Tobacco mosaic virus RNA electrochemical detection kit based on DNA tetrahedron and multi-component deoxyribozyme signal amplification strategy

Abstract

The invention discloses a tobacco mosaic virus RNA electrochemical detection kit based on a DNA tetrahedron and a multi-component deoxyribozyme signal amplification strategy. The kit mainly comprises a gold electrode, TA, TB, TC, TD, a part of enzyme A, a part of enzyme B, HP, MCH, SA-ALP and BSA. According to the kit, the detection sensitivity is remarkably improved on the basis of DNA tetrahedron ordered modification and a multi-component deoxyribozyme double-signal cascade amplification strategy. Experiments prove that compared with similar plant virus nucleic acid detection methods, the electrochemical detection kit designed by the invention is wider in detection range and lower in detection limit. The kit disclosed by the invention has the advantages of high efficiency, convenience in operation and environmental friendliness, and still has 92% of original signal strength after being placed for two weeks, so that the kit is proved to be good in stability. And in addition, the method shows accurate and excellent detection performance in a sample adding and recycling experiment of the healthy rehmannia root RNA extract, and has potential application value.

Description

Technical Field

[0001] The invention relates to a tobacco mosaic virus RNA electrochemical detection kit, a detection method and an application based on a DNA tetrahedron and a multi-component deoxyribozyme (MNAzymes) signal amplification strategy, and belongs to the technical field of biological analysis. Background Art

[0002] Tobacco mosaic virus (TMV) is a major group of the genus Tobamovirus and is a plant positive-strand RNA virus. TMV is one of the most intensively studied plant viruses in the world. Since the Russian biologist Iwanowski discovered TMV in 1892, people have been studying it for more than a century. TMV has the characteristics of a wide host range, strong stress resistance and difficulty in prevention and control. It can infect hundreds of plants such as tobacco, peppers, cucumbers, etc. TMV not only causes crop yield reduction, but also reduces the quality of agricultural products, causing great economic losses to agricultural production. According to statistics, the economic losses caused by TMV worldwide exceed 100 million US dollars each year. Therefore, it is particularly important to accurately and reliably detect the content of TMV in infected plants.

[0003] For a long time, scholars in related fields have been committed to the research and application of tobacco virus detection technology. At present, the commonly used methods for detecting plant viruses include enzyme-linked immunosorbent assay (ELISA), polymerase chain reaction (PCR) technology, high-throughput sequencing technology and reverse transcription loop-mediated isothermal amplification (RT-LAMP). However, the specificity and sensitivity of the ELISA method need to be improved. The PCR technology process is cumbersome and it is difficult to detect low-abundance virus samples. High-throughput sequencing technology also has the problem of high cost and is not suitable for rapid detection in production. Although RT-LAMP can significantly improve the sensitivity, it cannot quantify TMV. Therefore, it is urgent to develop a convenient, stable and efficient detection method to achieve trace detection of TMV. In recent years, various biosensors, including colorimetry (CL), fluorescence (FL), electrochemical method (EC), electrochemiluminescence (ECL) and surface plasmon resonance (SPR), have been developed. Among them, electrochemical technology with high detection sensitivity, fast detection speed and low price has attracted much attention. In order to further improve the sensitivity of biosensors, various signal amplification strategies have been developed, such as nucleic acid-based isothermal amplification methods, including rolling circle amplification (RCA) and strand displacement amplification (SDR). Although RCA and SDR greatly improve the efficiency of isothermal amplification, they are both affected by polymerase activity, and the length of RCA amplification products is also uncertain. At the same time, existing signal amplification strategies are also difficult to meet the needs of trace target detection. Summary of the invention

[0004] In view of the deficiencies in the prior art, the purpose of the present invention is to provide a tobacco mosaic virus RNA electrochemical detection kit, detection method and application based on DNA tetrahedron and multi-component deoxyribozyme signal amplification strategy, which has the advantages of high sensitivity, good selectivity and high stability.

[0005] In order to achieve the above-mentioned purpose, the technical solution of the present invention is, on the one hand, to provide a tobacco mosaic virus RNA electrochemical detection kit based on DNA tetrahedron and multi-component deoxyribozyme signal amplification strategy, comprising the following raw materials: gold electrode, TA, TB, TC, TD, partial enzyme A, partial enzyme B, HP, MCH, SA-ALP, BSA, α-NP, DEA buffer and MNAzymes buffer.

[0006] Further, the nucleotide sequence of TA is shown in SEQ ID NO.1, the nucleotide sequence of TB is shown in SEQ ID NO.2, the nucleotide sequence of TC is shown in SEQ ID NO.3, the nucleotide sequence of TD is shown in SEQ ID NO.4, the nucleotide sequence of partial enzyme A is shown in SEQ ID NO.6, the nucleotide sequence of partial enzyme B is shown in SEQ ID NO.7, and the nucleotide sequence of HP is shown in SEQ ID NO.8.

[0007] On the other hand, the technical solution of the present invention is to provide a method for detecting tobacco mosaic virus RNA using the kit, comprising the following steps:

[0008] (1) stimulating DNA amplification; mixing the solution of the substance to be detected, the solution of partzyme A, the solution of partzyme B and the HP solution, adding the MNAzymes buffer to react, and obtaining a large amount of biotin-labeled single-stranded DNA solution, i.e., the stimulating DNA solution;

[0009] (2) TDN modified electrode: TDN solution was added dropwise to the surface of the pretreated gold electrode for reaction;

[0010] (3) MCH modified electrode: immersing the modified electrode in step (2) in an MCH solution for reaction;

[0011] (4) Exciting the DNA-modified electrode: adding the exciting DNA solution obtained in step (1) to the electrode modified in step (3) to react;

[0012] (5) SA-ALP modified electrode: Add DEA buffer containing SA-ALP and BSA to the electrode modified in step (4) for reaction;

[0013] (6) Electrochemical detection:

[0014] ① After the above reaction is completed, the electrode modified in step (5) is cleaned and dried;

[0015] ② The electrode in step ① was used as a sample, and a mixed solution of HP solution, partial enzyme A solution and partial enzyme B solution without the test object and MNAzymes buffer was used as a blank control. Electrochemical detection was performed in DEA buffer containing α-NP substrate, and the TMV RNA concentration in the test object solution was calculated based on the electrochemical signal intensity.

[0016] Furthermore, before use, the gold electrode was pretreated: the electrode was polished on suede with 0.05μm Al2O3 powder, then cleaned and sonicated, and then immersed in a piranha solution, followed by ultrapure water, anhydrous ethanol, and ultrapure water sonication; finally, the electrode was scanned multiple times by CV to obtain a reproducible CV curve, and then cleaned and dried for use; wherein the piranha solution was a mixture of 98% H2SO4 and 30% H2O2 in a volume ratio of 3:1.

[0017] Furthermore, the preparation method of TDN solution is: equal volumes of TA solution, TB solution, TC solution and TD solution are mixed at 36-38°C, reacted for 15-20 minutes, heated to 95°C for 3-5 minutes, and then cooled to 3-5°C for storage.

[0018] Furthermore, the reaction temperature of steps (1), (4) and (5) is 36-38°C, and the reaction time is 0.5-2.5h; the reaction temperature of steps (2) and (3) is 3-5°C, and the reaction time is 0.5-8h.

[0019] Furthermore, the electrochemical detection conditions of step (6) are as follows: modulation time is 0.05s, interval time is 0.017s, step potential is 5mV, modulation amplitude is 70mV, and potential scanning range is 0.0~+0.5V.

[0020] On the other hand, the technical solution of the present invention is to provide an application of the kit in detecting tobacco mosaic virus RNA.

[0021] On the other hand, the technical solution of the present invention is to provide an application of the kit in preparing a product for detecting tobacco mosaic virus RNA.

[0022] The construction process of the electrochemical detection kit for tobacco mosaic virus RNA based on DNA tetrahedron and multi-component deoxyribozyme signal amplification strategy is as follows Figure 1As shown in Figure 1, the TDN with the bottom-connected -SH bond is fixed on the gold electrode through the Au-S bond interaction. Then, in the presence of the TMV RNA, the part enzyme A and part enzyme B are close to each other due to the complementary bases with the TMV RNA, and then assembled into a complete MNAzyme. 2+ In the presence of auxiliary factors, the HP substrate is catalyzed and cleaved, so that the biotin-labeled excitation DNA is released from the hairpin and complementary to the TDN top probe on the electrode. In addition, the active MNAzymes will continue to look for the next substrate for cutting, and finally obtain a large number of excitation DNA fragments. Subsequently, through the specific interaction between biotin and streptavidin, SA-ALP is further captured on the electrode. Finally, on the basis of BSA acting as a stabilizer, ALP catalyzes the hydrolysis of its substrate α-NP to generate a strong electrochemical signal. The relationship between the current and the logarithm of the TMV RNA concentration is measured by DPV, and the corresponding linear equation is calculated, thereby realizing the quantitative detection of TMV RNA.

[0023] Beneficial effects of the present invention:

[0024] 1. The kit of the present invention significantly improves the detection sensitivity based on the DNA tetrahedron ordered modification and multi-component deoxyribozyme double signal cascade amplification strategy.

[0025] 2. The kit of the present invention has the advantages of high efficiency, convenient operation, and environmental friendliness. After being placed for two weeks, it still has up to 92% of the original signal intensity, proving its good stability. In addition, it shows accurate and excellent detection performance in the sample recovery experiment of RNA extract of healthy Rehmannia glutinosa, and has potential application value.

[0026] 3. Under the optimal experimental conditions, the present invention studied the analytical performance of the kit within a certain TMV RNA concentration range. The electrochemical signal intensity was detected by reacting with different concentrations of TMV RNA. The strongest electrochemical signal DPV voltage was at about +0.2V. It was found through calculation that within the range of 1pM to 10nM of TMV RNA concentration, there was a good linear relationship between the logarithm of TMV RNA concentration and the electrochemical signal intensity. The linear equation was: I = 1.39451 + 1.63896lgC TMV RNA , correlation coefficient (R 2) is 0.997, and the detection limit (LOD) of this method is 0.17pM (S / N=3). Compared with similar plant virus nucleic acid detection methods, the electrochemical detection kit designed by the present invention has a wider detection range and a lower detection limit. The above experimental results show that the electrochemical detection kit for tobacco mosaic virus RNA based on DNA tetrahedron and multi-component deoxyribozyme signal amplification strategy has a wider effective detection range, higher sensitivity, and good analytical performance. BRIEF DESCRIPTION OF THE DRAWINGS

[0027] Figure 1 The construction process of the detection kit of the present invention (A), the process of ALP catalyzing α-NP to produce electrochemical signals (B), the names of the various substances used in the construction process A (C) ( Figure 1 Target in C corresponds to the detection target TMV RNA of the kit, PA and PB correspond to the two partial enzymes A and B required for assembling the complete MNAzymes nanozyme, and TriggerDNA corresponds to a large amount of biotin-labeled single-stranded DNA obtained through the nanozyme cycle mediated by the target Target).

[0028] Figure 2 The electrophoresis diagram of the MNAzymes system (A) and the feasibility analysis diagram of electrochemical detection (B).

[0029] Figure 3 AFM images of the electrode without TDN modification (A), the electrode with TDN modification (B), and the electrophoresis diagram of TDN (C).

[0030] Figure 4 The electrochemical impedance spectroscopy (A) and cyclic voltammetry (B) diagrams of the detection kit of the present invention are shown.

[0031] Figure 5 Optimization of the reaction temperature of the MNAzymes system (A), optimization of the time for the formation of the MNAzymes system and the cleavage of the substrate (B), and optimization of the concentration of the added SA-ALP (C).

[0032] Figure 6 DPV response after adding different concentrations of TMV RNA (A) (AG represents the detected TMV RNA concentrations of 1pM, 10pM, 50pM, 100pM, 500pM, 1nM, and 10nM, respectively), and the linear relationship between the electrochemical intensity and the logarithm of the TMV RNA concentration (B).

[0033] Figure 7 It is the specific DPV response of the detection kit to TMV RNA.

[0034] Figure 8 This is a stability test after the kit has been left for a period of time. DETAILED DESCRIPTION

[0035] The specific implementation modes of the present invention are further described in detail below in conjunction with the embodiments.

[0036] Gold electrodes were purchased from Shanghai Chenhua Instrument Co., Ltd.

[0037] The TA, TB, TC, TD, partzyme A, partzyme B, and HP used were synthesized by Sangon Biotechnology (Shanghai) Co., Ltd. and purified by HPLC-CE. The nucleic acid sequences are as follows:

[0038] TA: 5'-ACATTCCTAAGTCTGAAACATTACAGCTTGCTACACGAGAAGAGCCGCCATAGTACCCCCCCCCCGGTTAACCT-3' (SEQ ID NO. 1).

[0039] TB: 5'-TATCACCAGGCAGTTGACAGTGTAGCAAGCTGTAATAGATGCGAGGGTCCAA TAC-(CH2)6-SH-3' (SEQ ID NO. 2).

[0040] TC: 5'-TCAACTGCCTGGTGATAAAACGACACTACGTGGGAATCTACTATGGCGGCTC TTC-(CH2)6-SH-3' (SEQ ID NO. 3).

[0041] TD: 5'-TTCAGACTTAGGAATGTGCTTCCCACGTAGTGTCGTTTGTATTGGACCCTCG CAT-(CH2)6-SH-3' (SEQ ID NO. 4).

[0042] TMV RNA (tRNA): 5'-GAGGUGUGAGCGUGUGUCUG-3' (SEQ ID NO. 5).

[0043] Partzyme A: 5'-TAACCTGGCTAGCTCTCACACCTC-3' (SEQ ID NO. 6).

[0044] Partzyme B: 5'-CAGACACACG ACAACGAAGACAC-3' (SEQ ID NO. 7).

[0045] HP: 5'-ATATCGCATGGTGTGTCTAAGGTTAACCGCCCGATAT-(CH2)6-Botin-3' (SEQ ID NO. 8).

[0046] SBM(SM): 5'-GAGGUGUGAGCAUGUGUCUG-3' (SEQ ID NO. 9).

[0047] TBM(TM): 5'-GAGGCGUGAGCAUGUGUAUG-3' (SEQ ID NO. 10).

[0048] NC: 5'-AUCACUCCGAUCACGCGAGC-3' (SEQ ID NO. 11).

[0049] Example 1: Electrochemical detection kit for tobacco mosaic virus RNA based on DNA tetrahedron and multi-component deoxyribozyme signal amplification

[0050] The kit includes the following raw materials: gold electrode, TA, TB, TC, TD, partial enzyme A, partial enzyme B, HP, 6-mercapto-1-hexanol (MCH), streptavidin-alkaline phosphatase (SA-ALP), bovine serum albumin (BSA), 1-naphthyl phosphate (α-NP), MNAzymes buffer and DEA buffer.

[0051] Some raw materials need to be prepared into solutions when used, among which the concentrations of TA solution, TB solution, TC solution and TD solution are all 8 μM, the concentrations of partial enzyme A solution and partial enzyme B solution are both 1 μM, the concentration of HP solution is 1 μM, the concentration of MCH solution is 0.5 mM, the DEA buffer includes 0.1 M diethanolamine (DEA), 100 mM KCl and 1 mM MgCl2, pH = 9.6; the MNAzymes buffer includes 40 mM Tris, 0.28 nM NaCl, 10 mM KCl and 30 mM MgCl2, pH = 7.4.

[0052] Example 2: Tobacco mosaic virus RNA detection method

[0053] (1) Construction of TDN: TA solution, TB solution, TC solution, and TD solution of equal concentration (8 μM) were mixed (50 μL each) at 37±1°C and reacted for 20 min. Then, the mixture was heated to 95°C using a fluorescence quantitative PCR detector and maintained for 3 min. Then, the mixture was slowly cooled to 4±1°C and stored for later use.

[0054] (2) Stimulating DNA amplification: HP solution (1 μM), partzyme A solution (1 μM), partzyme B solution (1 μM) and solutions of different concentrations of the substance to be detected were mixed (20 μL each) and 120 μL of MNAzymes buffer was added, and the mixture was reacted at 37±1°C for 2.5 h to obtain a large amount of biotin-labeled single-stranded DNA, i.e., the stimulating DNA solution, which was stored at 4±1°C for later use;

[0055] (3) Electrode pretreatment: A bare gold electrode was polished on suede with 0.05 μm Al2O3 powder for 5 min, then washed with ultrapure water and sonicated for 1 min, and then immersed in piranha solution (98% H2SO4:30% H2O2=3:1, v / v) for 15 min, followed by ultrapure water, anhydrous ethanol, and ultrapure water sonicated for 1 min. Finally, the gold electrode was subjected to cyclic voltammetry (CV) in 0.5 M H2SO4 solution at 0.2 V s -1 The scanning rate was 0.5 V and the scanning was repeated multiple times in the range of -0.3 to 1.5 V until a reproducible CV curve was obtained. The sample was then rinsed with ultrapure water and dried with nitrogen gas for later use.

[0056] (4) TDN modified electrode: 10 μL of the TDN solution (2 μM) obtained in step (1) was added to the surface of the gold electrode treated in step (3) and placed in a refrigerator at 4±1°C for overnight reaction;

[0057] (5) MCH modified electrode: The electrode modified in step (4) was cleaned with ultrapure water and dried with nitrogen gas, and then immersed in 135 μL MCH solution (0.5 mM) and reacted at 4±1°C for 0.5 h;

[0058] (6) Exciting the DNA-modified electrode: The electrode modified in step (5) was cleaned with ultrapure water and blown dry with nitrogen gas, and 10 μL of the exciting DNA solution obtained in step (2) was added to the electrode surface and reacted at 37±1°C for 1 h;

[0059] (7) SA-ALP modified electrode: The electrode modified in step (6) was washed with ultrapure water and dried with nitrogen. 10 μL of 4 μg mL -1 SA-ALP and 10 mg mL -1 BSA in DEA buffer, react at 37±1℃ for 0.5h;

[0060] (8) Electrochemical detection:

[0061] ① After the above reaction is completed, the electrode modified in step (7) is washed with ultrapure water and blown dry with nitrogen;

[0062] ② The electrode washed and dried with nitrogen in step ① was used as a sample, and a mixed solution of HP solution, partzyme A solution, and partzyme B solution without the test substance (20 μL each) was added with 140 μL MNAzymes buffer as a blank control. -1Differential pulse voltammetry (DPV) current detection was carried out in DEA buffer (pH = 9.6) with an α-NP substrate, with a modulation time of 0.05 s, an interval time of 0.017 s, a step potential of 5 mV, a modulation amplitude of 70 mV, and a potential scanning range of 0.0 to +0.5 V. The TMV RNA concentration in the solution of the object to be detected was calculated based on the electrochemical signal intensity.

[0063] Example 3: Tobacco mosaic virus RNA detection method

[0064] The method of Example 3 is basically the same as that of Example 2, except that the reaction time of step (1) is 15 min, and 95° C. is maintained for 4 min, the reaction time of step (2) is 2 h, the reaction time of step (4) is 4 h, the reaction time of step (5) is 4 h, the reaction time of step (6) is 0.5 h, and the reaction time of step (7) is 1 h.

[0065] Example 4: Tobacco mosaic virus RNA detection method

[0066] The method of Example 3 is basically the same as that of Example 2, except that the reaction time of step (1) is 18 min, and 95° C. is maintained for 5 min, the reaction time of step (2) is 0.5 h, the reaction time of step (4) is 0.5 h, the reaction time of step (5) is 8 h, the reaction time of step (6) is 2.5 h, and the reaction time of step (7) is 2.5 h.

[0067] Example 5: Feasibility Analysis

[0068] In order to evaluate the feasibility of the electrochemical kit for specific detection of TMV RNA based on the MNAzymes system proposed in the present invention, the 2% agarose gel electrophoresis patterns of samples under different conditions were studied. Figure 2As shown in A, lanes 1-4 correspond to partial enzyme A, partial enzyme B, target RNA (TMV RNA), and HP, respectively. The migration rates of partial enzyme A, partial enzyme B, and HP are not much different, while the migration rate of short-chain TMV RNA in lane 3 is faster; lane 5 is a mixture of partial enzyme A and partial enzyme B, and the migration rate is not significantly changed compared with 1 and 2; lane 6 is the reaction product of partial enzyme A, partial enzyme B, and TMV RNA; lanes 7 and 8 show the migration bands of MNAzymes in the absence and presence of target (TMV RNA), respectively. It can be seen that due to the connection of partial enzyme A, partial enzyme B, and TMV RNA, a new band with a slow migration rate appears in lane 6. However, the nanozyme cannot complete assembly and cutting due to the lack of target, and lane 7 shows bands similar to partial enzyme A, partial enzyme B, and HP. Compared with lanes 6 and 7, lane 8 not only has bands similar to those in lane 6, but also has a new band with a fast migration rate, which indicates that the substrate is cut in the complete MNAzymes system to generate short-chain DNA. The above results prove that the construction of the MNAzymes system of the present invention is successful. Compared with lanes 6 and 7, lane 8 shows 3 bands, of which the two slower moving bands correspond to the two bands in lane 6, and the new band with a fast migration rate is the new short-chain DNA generated by the HP activated MNAzymes cutting.

[0069] In order to further verify the feasibility of this electrochemical kit for detecting TMV RNA activity, the DPV responses of the sensing system under different experimental conditions were compared. Figure 2 As shown in Figure B, when measuring at a bare electrode (curve A), in the absence of TDN (curve B), and in the absence of the target (curve C), almost no obvious current signal was observed. On the contrary, in the complete MNAzymes system with TMV RNA (curve D), due to the dual signal amplification of TDN and the cyclic cleavage effect of the simulated enzyme, an obvious redox reaction occurred on the electrode, generating a large amount of electrochemical substance α-naphthol and a strong DPV current signal, proving the feasibility of the experiment.

[0070] Example 6: Characterization Analysis

[0071] To verify whether the kit was successfully constructed, the present invention observed the surface morphology of the electrode with or without TDN modification under an atomic force microscope (AFM). The results are shown in 3A and 3B. The height of the bare gold sheet is clearly visible, and the height is about 8nm. After connecting the TDN, Figure 3The height of the gold sheet in B increased to about 17 nm. Compared with the bare gold sheet, it increased by about 9 nm, which is close to the height of TDN reported in other studies, indicating that TDN was successfully synthesized. In order to further characterize the synthesis process of TDN, the present invention used agarose gel electrophoresis to identify its electrophoretic mobility. Figure 3 As shown in Figure C, lanes a, b, c, d, e, f, and g correspond to TA, TB, TC, TD, TB+TC, TB+TC+TD, and TA+TB+TC+TD, respectively. The migration speeds of the four short-chain DNAs are not much different. The migration rates of bands e and f gradually decrease as expected. Compared with the previous bands, band g corresponding to TDN shows a larger molecular weight and a lower migration rate. It is easy to conclude that the four short-chain DNAs successfully construct TDN through base complementary pairing.

[0072] Subsequently, the present invention is carried out by mixing [Fe(CN)] 3- / 4- Electrochemical impedance spectroscopy (EIS) and cyclic voltammetry (CV) were performed in the electrolyte to verify the preparation of the electrochemical kit. Figure 4 As shown in the Nyquist diagram, the horizontal axis is the real part of the impedance, the vertical axis represents the negative imaginary part of the impedance, and the size of the semicircle represents the electron transfer restriction process. The equivalent circuit in the illustration includes four parts, among which Rs is the electrolyte resistance, CPE is the double layer capacitance, Zw is the Weber impedance (Warburg), and Rct is the charge transfer resistance. First, due to the excellent conductivity of the bare gold electrode, the curve in the figure is almost straight (Rct≈274Ω, curve a). After TDN modified by thiol at the bottom is loaded on the electrode, Rct increases significantly (Rct≈2134Ω, curve b), which is because the negative charge carried by the phosphate group of TDN itself hinders electron transfer. Then, when MCH occupies the remaining sites of the electrode, Rct continues to increase (Rct≈3055Ω, curve c) because it hinders electron transfer on the electrode surface. Afterwards, in the presence of tRNA, MNAzymes are activated, cutting the substrate to produce a large amount of biotin-labeled excitation DNA and connecting to the electrode, and Rct continues to increase (Rct≈4635Ω, curve d). Finally, after the addition of SA-ALP, Rct increases significantly (Rct≈6583Ω, curve e). This is because SA-ALP is connected to the electrode due to its specific action. At the same time, alkaline phosphatase is a protease, which is not conducive to charge transfer. At the same time, Figure 4 The bare gold electrode (curve A) in B shows a pair of obvious redox peaks. After TDN connection, the negatively charged phosphate backbone repels [Fe(CN)] 3- / 4-, resulting in a significant decrease in the redox peak (curve B). Then, after soaking the sensing interface in MCH to block nonspecific binding sites, a decrease in the redox current was observed due to the blocking effect of MCH (curve C). Similarly, the redox peak current was further reduced due to the blocking of the excited DNA (curve D) and SA-ALP (curve E). The CV results are in good agreement with the EIS results, once again demonstrating the successful construction of the electrochemical biosensor system in this study.

[0073] Example 7: Condition Optimization

[0074] Based on the reaction conditions of Example 2, several important conditions involved in the kit detection were optimized to achieve the best detection performance of the tRNA electrochemical detection kit. The present invention studies the effects of the time of complete MNAzyme formation and substrate cleavage, the reaction temperature, and the concentration of added SA-ALP on the electrochemical intensity.

[0075] Sufficient reaction time allows partenzyme A and partenzyme B to combine with the target to form a complete MNAzyme, so that MNAzymes can cut more substrate HP and obtain more biotin-labeled short-chain DNA. At the same time, the temperature of the MNAzyme reaction also has a huge impact on the activity of the mimetic enzyme, so the optimization of the MNAzyme reaction time and temperature is very important.

[0076] 1. Optimization of reaction temperature of activated MNAzymes system

[0077] like Figure 5 As shown in A, with other conditions unchanged, 5 parameters of 4°C, 25°C, 37°C, 42°C, and 47°C were selected for optimization. The DPV intensity reached its maximum value at 37°C, proving that the enzyme activity was maximum and the efficiency of substrate cleavage was highest at this time. Therefore, 37°C was selected as the incubation temperature of MNAzymes.

[0078] 2. Optimization of MNAzyme formation and substrate cleavage time

[0079] like Figure 5 As shown in Figure B, when other conditions remain unchanged, as the incubation time increases from 30 min to 150 min, the current intensity also increases rapidly and remains basically stable after 150 min, indicating that complete MNAzymes are formed at 150 min and the cutting efficiency reaches the maximum, so 150 min is selected as the incubation time of MNAzymes.

[0080] Streptavidin-labeled alkaline phosphatase has a direct impact on the final dephosphorylation of α-NP and the strength of the generated DPV electrochemical signal, so the amount of SA-ALP connected to the electrode is crucial.

[0081] 3. SA-ALP concentration optimization

[0082] When other conditions remain unchanged, select 1, 2, 3, 4, 5, 6 μg·mL -1 A total of 6 different concentrations of SA-ALP were incubated, such as Figure 5 As shown in C, the current intensity increases with the increase of concentration. -1 The maximum current value is reached when the SA-ALP is fully connected to the electrode, and the catalytic effect on α-NP is the best. Therefore, 4 μg mL -1 As the optimized concentration of SA-ALP.

[0083] Example 8: Performance Analysis

[0084] Under the optimal experimental conditions of Example 7, DPV signal detection was performed on tRNAs of different concentrations to analyze the performance of the kit. Figure 6 As shown in A, as the concentration of target RNA (tRNA) increases, the corresponding DPV signal gradually increases, indicating that the formation of MNAzymes and the subsequent attachment of SA-ALP depend on the concentration of tRNA. Partzyme A, partzyme B and HP are far in excess compared to tRNA, which also proves that the determination of tRNA content can be achieved by observing the size of the current signal. Figure 6 As shown in B, within the dynamic range of 1pM to 10nM, the DPV response shows a good linear relationship with the logarithm of the tRNA concentration, and the correlation equation is I = 1.39451 + 1.63896lgC TMV RNA (R 2 =0.997), and the calculated detection limit was 0.17 pM. As shown in Table 1, compared with similar plant virus nucleic acid detection methods, the kit showed considerable sensitivity, a wide linear range and a low detection limit, and can be used for the quantitative determination of tRNA.

[0085] Table 1 Comparison of the detection method of this kit with other methods

[0086]

[0087] [1] Khater M, de la Escosura-Muniz A, Quesada-Gonzalez D, et al. Electrochemical detection of plant virus using gold nanoparticle-modified electrodes [J]. ANALYTICA CHIMICA ACTA, 2019, 1046: 123-131.

[0088] [2]Qiu B, Zhang Y, Lin Y, et al. Anovel fluorescent biosensor for detection of target DNA fragment from the transgene cauliflower mosaic virus35S promoter [J]. BIOSENSORS&BIOELECTRONICS, 2013, 41: 168-171.

[0089] [3]Wang Y,Wang W,Lu

[0090] Example 9: Selectivity Analysis

[0091] In order to investigate the specificity of the proposed biosensor method for tRNA detection, the present invention designed a series of single-base, three-base and full-base mismatched sequences that are different from the target RNA to replace tRNA. Under the same experimental conditions, the electrochemical response of the sensing method to tRNA, SBM, TBM and NC (all at a concentration of 10 nM) was tested respectively. Figure 7 It can be seen that as the number of mismatched bases increases, the electrochemical signal response gradually decreases, and the signal intensity is much lower than that of the experimental group, where the electrochemical signal of SBM is 18.01% of tRNA, and the current intensity of TBM is only 8.76% of tRNA. The signal intensity measured by the full non-complementary base group is similar to that of the blank group, and the current intensity can be ignored. This shows that the prepared sensing method of the present invention can effectively distinguish the electrochemical signals of SBM, TBM and NC, and has good selectivity for the detection of tRNA.

[0092] Example 10: Stability and sample recovery

[0093] The stability of the electrochemical biosensor system is an important factor affecting its application in actual clinical practice. The stability of the sensing system was studied by placing the modified electrode in a refrigerator at 4°C for 14 days and recording the DPV behavior every day. Figure 8 As shown, the measured peak current remained constant in the first seven days and gradually decayed over time from the tenth day. After two weeks, the DPV response of the modified electrode was still as high as 92%, indicating that the constructed electrochemical detection method has satisfactory stability.

[0094] In order to test the ability of the sensing method to be applied to real sample detection, total RNA samples were extracted from healthy Rehmannia glutinosa leaves, and the samples were subjected to spike recovery experiments. First, the total RNA of Rehmannia glutinosa without tRNA was diluted 100 times, and then tRNA was added to make the final concentrations of 0.1, 1, and 10nM, respectively, and the spike recovery rate was calculated. The results are shown in Table 2. The final recovery rate was 98% to 103.24%, the relative standard deviation (RSD) ranged from 2.58% to 5.96% (<6%, n=3), and the average RSD was 4.23%. This result provides a strong proof for the application of the sensing method constructed in this study to detect tRNA in real samples.

[0095] Table 2 Sample recovery experiment

[0096]

Claims

1. A tobacco mosaic virus RNA electrochemical detection kit based on DNA tetrahedron and multi-component deoxyribozyme signal amplification strategy, characterized in that: The invention comprises the following raw materials: gold electrode, TA, TB, TC, TD, partial enzyme A, partial enzyme B, HP, MCH, SA-ALP and BSA.

2. The kit according to claim 1, characterized in that Also included are α-NP, DEA buffer and MNAzymes buffer.

3. The kit according to claim 1, characterized in that The nucleotide sequence of TA is shown in SEQ ID NO.1, the nucleotide sequence of TB is shown in SEQ ID NO.2, the nucleotide sequence of TC is shown in SEQ ID NO.3, the nucleotide sequence of TD is shown in SEQ ID NO.4, the nucleotide sequence of partial enzyme A is shown in SEQ ID NO.6, the nucleotide sequence of partial enzyme B is shown in SEQ ID NO.7, and the nucleotide sequence of HP is shown in SEQ ID NO.

8.

4. A method for detecting tobacco mosaic virus RNA using the kit according to any one of claims 1 to 3, characterized in that: The following steps are involved: (1) stimulating DNA amplification; mixing the solution of the substance to be detected, the solution of partzyme A, the solution of partzyme B and the HP solution, adding the MNAzymes buffer to react, and obtaining a large amount of biotin-labeled single-stranded DNA solution, i.e., the stimulating DNA solution; (2) TDN modified electrode: TDN solution was added dropwise to the surface of the pretreated gold electrode for reaction; (3) MCH modified electrode: immersing the modified electrode in step (2) in an MCH solution for reaction; (4) Exciting the DNA-modified electrode: adding the exciting DNA solution obtained in step (1) to the electrode modified in step (3) to react; (5) SA-ALP modified electrode: Add DEA buffer containing SA-ALP and BSA to the electrode modified in step (4) for reaction; (6) Electrochemical detection: ① After the above reaction is completed, the electrode modified in step (5) is cleaned and dried; ② The electrode in step ① was used as a sample, and a mixed solution of HP solution, partial enzyme A solution and partial enzyme B solution without the test object and MNAzymes buffer was used as a blank control. Electrochemical detection was performed in DEA buffer containing α-NP substrate, and the TMV RNA concentration in the test object solution was calculated based on the electrochemical signal intensity.

5. The method according to claim 4, characterized in that Before use, the gold electrode was pretreated: the electrode was polished on suede with 0.05μm Al2O3 powder, then cleaned and sonicated, and then immersed in piranha solution, followed by ultrapure water, anhydrous ethanol, and ultrapure water sonication; finally, the electrode was scanned multiple times by CV to obtain a reproducible CV curve, and then cleaned and dried for use; the piranha solution was a mixture of 98% H2SO4 and 30% H2O2 in a volume ratio of 3:

1.

6. The method according to claim 4, characterized in that The preparation method of TDN solution is as follows: equal volumes of TA solution, TB solution, TC solution and TD solution are mixed at 36-38°C, reacted for 15-20 minutes, heated to 95°C for 3-5 minutes, and then cooled to 3-5°C for storage.

7. The method according to claim 4, characterized in that The reaction temperature of steps (1), (4) and (5) is 36-38°C, and the reaction time is 0.5-2.5h; the reaction temperature of steps (2) and (3) is 3-5°C, and the reaction time is 0.5-8h.

8. The method according to claim 4, characterized in that The electrochemical detection conditions of step (6) are as follows: modulation time is 0.05 s, interval time is 0.017 s, step potential is 5 mV, modulation amplitude is 70 mV, and potential scanning range is 0.0 to +0.5 V.

9. Use of the kit according to any one of claims 1 to 3 in detecting tobacco mosaic virus RNA.

10. Use of the kit according to any one of claims 1 to 3 in preparing a product for detecting tobacco mosaic virus RNA.

Images