Engineered extracellular vesicle for targeted uterus delivery of Hand2 siRNA as well as preparation method and application of engineered extracellular vesicle

Abstract

The invention discloses an engineered extracellular vesicle for targeted uterus delivery of Hand2siRNA and a preparation method and application thereof, and belongs to the technical field of biomedicine. The invention provides an engineered extracellular vesicle for targeted delivery of Hand2siRNA (small interfering Ribonucleic Acid) in a uterus. The engineered extracellular vesicle comprises the engineered extracellular vesicle for targeted delivery of the uterus and the Hand2siRNA entrapped in the engineered extracellular vesicle. The engineered extracellular vesicle for contraception has the characteristic of targeting endometrial stromal cells, and because the Hand2 transcription factor plays a key role in establishing endometrial receptivity, the engineered extracellular vesicle can target the endometrial stromal cells and interfere with Hand2 gene expression, the endometrial receptivity is interfered, and the engineered extracellular vesicle can be used for contraception. Therefore, the contraception effect is realized.

Description

Technical Field

[0001] The present invention belongs to the field of biomedical technology and relates to a method for preparing a non-hormonal contraceptive specifically targeting the uterus. Background Art

[0002] In the past few decades, people have developed and adopted a variety of highly effective and acceptable contraceptives, including intrauterine devices, female hormone patches, male condoms, and vasectomy. However, contraceptive technology has not yet made significant breakthroughs, and related long-term adverse reactions are difficult to overcome. Among them, most of the existing contraceptives are hormonal drugs, including single contraceptives containing only progestins (drospirenone, levonorgestrel, and norgestrel) and combined contraceptives containing progestins and estrogen (ethinyl estradiol). Taking hormones often leads to endocrine system disorders. In addition, contraceptive methods such as invasive ligation and removal of intrauterine devices can cause negative effects such as slow recovery of fertility.

[0003] During pregnancy, progesterone inhibits the growth-promoting effects of estrogen in the uterus, and progesterone attenuates estrogen-mediated uterine epithelial proliferation, which is a prerequisite for successful implantation. Some scholars have studied the mechanism. Studies have shown that the expression of the basic helix-loop-helix transcription factor Hand2 in the progesterone-induced uterine stroma inhibits the production of several fibroblast growth factors (FGFs), which act as paracrine mediators in the mitosis of epithelial cells by estrogen. In addition, in the uterus of Hand2-knocked mice, the continued induction of these FGFs maintains epithelial proliferation and stimulates estrogen-induced pathways, resulting in impaired implantation. Therefore, Hand2 is a key regulator of uterine stroma-epithelial communication, guiding appropriate steroid regulation and facilitating the establishment of pregnancy.

[0004] Extracellular vesicles (EVs) contain exosomes, which have many characteristics such as barrier penetration ability, good biocompatibility, and low immunogenicity, which make them ideal drug delivery carriers. By modifying the parent cells or exosomes, the loading of nucleic acids, proteins or chemical molecules by extracellular vesicles is achieved, and engineered exosomes or engineered extracellular vesicles with targeted drug delivery effects for specific organs and tissues or lesions are obtained. Based on this, the present invention provides a method for preparing a non-hormonal contraceptive specifically targeting the uterus. Summary of the invention

[0005] In view of the problems existing in the above-mentioned prior art, the purpose of the present invention is to design and provide a non-hormonal contraceptive specifically targeting the uterus and its preparation method and application. In the present invention, Hand2 siRNA is encapsulated in engineered extracellular vesicles (EVs) targeting the uterus.Lamp2b ) to gain EVs Lamp2b @Hand2 siRNA has the property of targeting endometrial stromal cells. It specifically targets uterine stromal cells to deliver Hand2 siRNA. Hand2 siRNA interferes with the expression of Hand2 and the receptivity of the endometrium, thus effectively achieving contraception.

[0006] In order to achieve the above objectives, this application adopts the following technical solutions:

[0007] In one aspect, the present invention provides a siRNA, wherein the siRNA is Hand2 siRNA;

[0008] The Hand2 siRNA is one of Hand2 siRNA-1, Hand2 siRNA-2 or Hand2 siRNA-3, or a derivative sequence with an amino acid sequence of Hand2 siRNA-1, Hand2 siRNA-2 or Hand2 siRNA-3 as a backbone;

[0009] Among them, the sense chain of Hand2 siRNA-1 is shown as SEQ ID NO.1, and the antisense chain of Hand2 siRNA-1 is shown as SEQ ID NO.2; the sense chain of Hand2 siRNA-2 is shown as SEQ ID NO.3, and the antisense chain of Hand2 siRNA-2 is shown as SEQ ID NO.4; the sense chain of Hand2 siRNA-3 is shown as SEQ ID NO.5, and the antisense chain of Hand2 siRNA-3 is shown as SEQ ID NO.6.

[0010] In a second aspect, the present invention provides the use of the siRNA in preparing engineered extracellular vesicles for contraception.

[0011] In a third aspect, the present invention provides an engineered extracellular vesicle for delivering Hand2 siRNA targeted to the uterus, comprising an engineered extracellular vesicle targeted to the uterus, and Hand2 siRNA encapsulated in the engineered extracellular vesicle;

[0012] The Hand2 siRNA is used to interfere with the expression of the Hand2 gene.

[0013] In a fourth aspect, the present invention provides an engineered extracellular vesicle for targeted uterine delivery of Hand2 siRNA, wherein the Hand2 siRNA is one of Hand2 siRNA-1, Hand2 siRNA-2 or Hand2 siRNA-3, or a derivative sequence with an amino acid sequence of Hand2 siRNA-1, Hand2 siRNA-2 or Hand2 siRNA-3 as a backbone.

[0014] The engineered extracellular vesicles for delivering Hand2 siRNA targeted to the uterus, wherein the envelope of the engineered extracellular vesicles targeted to the uterus expresses Lamp2b protein;

[0015] The amino acid sequence of Lamp2b is selected from one of SEQ ID NOs. 7-13, or a derived sequence with one of SEQ ID NOs. 7-13 as the backbone.

[0016] In a fifth aspect, the present invention provides a method for preparing an engineered extracellular vesicle for uterine-targeted delivery of Hand2 siRNA as described in any one of the above, comprising the following steps:

[0017] (1) obtaining engineered extracellular vesicles targeting the uterus secreted by cells stably overexpressing the protein Lamp2b;

[0018] (2) Encapsulating Hand2 siRNA in the engineered extracellular vesicles targeting the uterus obtained in step (1) to obtain engineered extracellular vesicles for contraception.

[0019] In a sixth aspect, the present invention provides the use of any of the engineered extracellular vesicles described or the engineered extracellular vesicles obtained by the preparation method described in the preparation of contraceptive drugs.

[0020] In a seventh aspect, the present invention provides a contraceptive drug, comprising any one of the engineered extracellular vesicles described or the engineered extracellular vesicles obtained by the preparation method described.

[0021] The contraceptive drug has a single dose of 100 μg of engineered extracellular vesicles encapsulating 200 pmol Hand2 siRNA.

[0022] The contraceptive drug is administered in the form of intravenous injection, oral gavage, intraperitoneal injection, subcutaneous injection or intradermal injection.

[0023] Compared with the prior art, the present invention has the following beneficial effects:

[0024] The present invention provides a method for preparing a non-hormonal contraceptive specifically targeting the uterus, which can specifically target the uterus and effectively achieve contraception based on the Hand2 target. The present invention utilizes engineered extracellular vesicles targeting the uterus, which have the advantages of high biocompatibility and high drug delivery efficiency, and the targeting effect based on the Hand2 target is a non-hormonal drug mode of action, which can reduce drug side effects, avoid a series of negative problems caused by traditional contraceptive methods, and has a good application prospect. BRIEF DESCRIPTION OF THE DRAWINGS

[0025] Figure 1 The results of uterine targeting of engineered extracellular vesicles targeting the uterus in pregnant female mice, wherein A is the absorption in the uterus of pregnant female mice observed by ivis, B is the statistical graph of the absorption intensity in Figure A, and C is the absorption in the uterus of pregnant female mice observed by immunofluorescence;

[0026] Figure 2 The interference of Hand2 siRNA on Hand2 gene of mouse primary stromal cells;

[0027] Figure 3 Figure 2 is the encapsulation efficiency of siRNA, where A is the fluorescence intensity detected by the microplate reader, B is the calculation of the siRNA encapsulation efficiency based on Figure A, and C is the siRNA encapsulation efficiency detected by qPCR;

[0028] Figure 4 Uptake of siRNA-loaded engineered extracellular vesicles targeting the uterus by hESC cells;

[0029] Figure 5 To investigate the interference of non-hormonal contraceptives specifically targeting the uterus on the Hand2 gene in the uterus of pregnant female mice;

[0030] Figure 6 This is the effect of non-hormonal contraceptives that specifically target the uterus on the number of embryos in pregnant female mice, where A is a macroscopic image of the embryos and B is a statistical graph of the number of embryos. DETAILED DESCRIPTION

[0031] The present invention will be further described below by means of the accompanying drawings and examples. The present invention will be further explained below in conjunction with specific examples, but it should be noted that the following examples are only used to explain the present invention, and cannot be used to limit the present invention, and all technical solutions that are the same as and similar to the present invention are within the scope of protection of the present invention. If no specific technology or conditions are specified in this embodiment, the operation is carried out according to the conventional technical methods and instrument instructions in this field; if the manufacturer of the reagents or instruments used is not specified, they are all conventional reagents and consumables that can be obtained commercially.

[0032] Example 1: EVs Lamp2b Preparation

[0033] 1. Plasmid vector construction

[0034] (1) Primer design and PCR cloning of target fragments. The specific steps are as follows:

[0035] F1: atcgCACCTGCATCG TAACCATTTCAGACCATGGCACTGTG

[0036] R1: atcgCACCTGCATCG CAGAGTCTGATATCCAGCATAACTTTTTC

[0037] F2: atcgCACCTGCATCG TCTGTCTGGTGGCGGAGGCTCGG

[0038] R2: atcgCACCTGCATCG GGGTTCAGGCACCGGGCTTGCGG

[0039] (Note: lowercase letters are protective bases, italic bold letters are AarⅠ recognition sites, and underlined letters are sticky ends formed after enzyme cleavage. The nucleotide sequence of F1 is shown in SEQ ID NO.14, the nucleotide sequence of R1 is shown in SEQ ID NO.15, the nucleotide sequence of F2 is shown in SEQ ID NO.16, and the nucleotide sequence of R2 is shown in SEQ ID NO.17.

[0040] The three pairs of primers were used to amplify three DNA fragments respectively according to the systems and conditions in Tables 1 and 2 below.

[0041] Table 1 Amplification system

[0042]

[0043] Table 2 Amplification conditions

[0044]

[0045] (2) PCR product electrophoresis detection and target fragment gel excision recovery, the specific steps are:

[0046] A. After the PCR reaction system is completed, add 10 μL of 6× loading buffer to the reaction system to terminate the reaction;

[0047] B. The reaction products were subjected to agarose gel electrophoresis;

[0048] C. Recover the target fragment by gel excision.

[0049] (3) GoldenGate reaction to construct the intermediate vector, the specific steps are as follows:

[0050] A. Extraction of pDown-AarⅠ-ccdB-Cm-AarⅠ backbone plasmid;

[0051] B. The backbone plasmid and the PCR product obtained in (2) were subjected to GoldenGate reaction according to the system and parameters in Table 3 and the procedure in Table 4.

[0052] Table 3 GoldenGate reaction system and parameters

[0053]

[0054]

[0055] Table 4 GoldenGate reaction procedure

[0056]

[0057] C. After the GoldenGate reaction is completed, part of the reaction product is directly used to transform UltraStable competent cells. Randomly pick 3-6 single colonies, rinse the bacteria in a sterile 0.2mL sterile EP tube, take 1μL as a template for colony PCR, and the rest as a strain for inoculating bacteria to extract plasmid DNA. The colony PCR reaction system and reaction procedure are shown in Tables 5 and 6 below.

[0058] Table 5 Colony PCR reaction system

[0059]

[0060] Table 6 Colony PCR reaction procedure

[0061]

[0062] D. After the colony PCR is completed, add 6× loading buffer and then perform electrophoresis. Refer to the DNA Ladder to select the clones that can amplify the target length, inoculate them into LB medium and culture them at 37℃ 250rpm overnight, then extract the small extract plasmid DNA and send it for sequencing. Use Sequencher software to compare the returned sequencing results with the standard sequence. The entry vector with the correct sequencing can enter the next LR reaction to construct the final vector.

[0063] (4) LR reaction, transformation and final vector positive clone identification. The specific steps are as follows:

[0064] A. Perform LR reaction

[0065] The LR reaction system is shown in Table 7 below. LR reaction conditions: incubate at 25°C for 3 h. After the reaction is completed, add 1 μL of proteinase K and incubate at 37°C for 15 min to terminate the reaction.

[0066] Table 7LR reaction system

[0067]

[0068] B. Transformation of LR reaction products into competent cells

[0069] Take 2 μL of LR reaction product to transform competent cells. The operation refers to the transformation steps of GoldenGate reaction product. Finally, spread the revived bacterial solution on LB plate containing Amp antibiotic and culture it upside down at 37°C overnight.

[0070] C. Colony PCR

[0071] Randomly pick 3-6 single colonies and operate according to the colony PCR for identifying the intermediate vector monoclone. Finally, perform agarose gel electrophoresis and pick the colonies that can amplify the DNA band of the target band length according to DNALadder. Inoculate and culture the bacteria and extract the plasmid DNA.

[0072] D. Enzyme digestion identification

[0073] The vector map was opened using SnapGene software, the restriction endonuclease was determined, and then the plasmid DNA of the final vector was digested using NEB restriction endonucleases. After the digestion reaction was completed, agarose gel electrophoresis was performed and analyzed with reference to DNALadder. The vector that could only cut out a DNA band of a specific length was the correct final vector. The amino acid sequence of Lamp2b in this embodiment is SEQ ID NO.7.

[0074] 2. Lentivirus packaging and concentration

[0075] (1) One day before transfection, transfer HEK293T cells into a 10 cm culture dish so that the cells can reach about 60-70% on the next day.

[0076] (2) Take two clean sterile centrifuge tubes and add 750 μL of DMEM culture medium without antibiotics and serum to each tube. Then add 15 μg of mixed plasmid (psPAX2: pMD2.G: target plasmid = 3:1:4) to one tube and mix it gently with a gun. Add 30 μL of Lipo293 to the other tube. TM Gently pipette the transfection reagent to mix well. Gently add the culture solution containing DNA to the solution containing Lipo293 TM In the culture medium of the transfection reagent, gently invert the centrifuge tube or gently blow with a gun to mix, and let it stand at room temperature for 15 minutes.

[0077] (3) Add the plasmid-culture medium mixed suspension obtained in step 2 evenly to the entire culture dish, and then gently mix.

[0078] (4) After 6 h of culture, remove the old culture medium and add complete culture medium (without double antibody) to continue culture. After 48 h of culture, collect the viral supernatant and add 2-3 mL of complete culture medium.

[0079] (5) After 72 h, the viral supernatant was collected and centrifuged at 500 g for 10 min.

[0080] (6) Transfer the clear supernatant to a sterile container and mix 1 volume of Lenti-X concentrate with 3 volumes of the clear supernatant. Mix by gentle inversion.

[0081] (7) The mixture was placed at 4°C overnight and centrifuged at 1500 g for 45 min at 4°C the next day. After centrifugation, grayish-white particles were visible.

[0082] (8) Carefully and gently remove the supernatant and gently resuspend the pellet to 1 / 10 to 1 / 100 of the original volume using complete medium.

[0083] (9) Titrate the sample or store the sample in aliquots at -80°C.

[0084] 3. Lentivirus infection and eGFP positive cell sorting

[0085] (1) One day before infection, HEK293F cells were transferred into 24-well plates;

[0086] (2) 20 μL of virus solution and 2 ug Polybrene were added to 1 mL of SMM 293-TII medium. Green fluorescence was visible after three days.

[0087] (3) Collect polyclonal cells, and use flow cytometry to sort eGFP-positive / PI (propidium iodide)-negative single cells into 96-well cell culture plates. After 3 weeks, observe under a microscope and find that the HEK293F-Lamp2b-eGFP overexpressing monoclonal cell line after eGFP sorting is obtained.

[0088] (4) Transfer the cells into 24-well plates, 12-well plates, and 6-well plates at a time to preserve the cells and expand the culture.

[0089] 4. Extracellular vesicle extraction

[0090] (1) Collect the cell supernatant, centrifuge at 300 g for 10 min at 4°C, and remove the cells;

[0091] (2) Centrifugation at 2000 g for 20 min at 4°C to remove dead cells;

[0092] (3) Centrifugation at 10,000 g for 30 min at 4°C to remove cell debris;

[0093] (4) 0.22 μm filter to remove impurities and bacteria;

[0094] (5) Centrifuge at 120,000 g for 120 min, discard the supernatant, and wash once with PBS;

[0095] (6) Centrifuge at 120,000 g for 60 min, discard the supernatant, precipitate the extracellular vesicles, resuspend in PBS and quantify with BCA, and aliquot at 50 μg / tube and store in a -80°C refrigerator to obtain engineered EVs Lamp2b .

[0096] Example 2: EVs Lamp2b Uterine targeting validation in pregnant female mice

[0097] 1. Combine cages: Place a female mouse and a male mouse in one cage and combine them together. Combine multiple cages at the same time.

[0098] 2. Thromboembolism inspection: The female mouse is inspected every other morning to see if there is a yellow-white clot. If so, the mouse is on day 0.5 of pregnancy.

[0099] 3. P2.5 grouping and drug administration: The mice were divided into NT, DiR, EVs, and EVs obtained in Example 1. Lamp2b There were four groups: the NT group was not treated, the DiR group was given DiR dye, the EVs group was given DiR-stained EVs, and the EVs Lamp2b Group 1 was given DiR-stained EVs Lamp2b The drug was administered by tail vein injection.

[0100] 4. Sampling: 24 hours after administration, the mice were dissected and the liver, spleen, lung, kidney, heart, fat, brain and uterus were fixed in 4% PFA.

[0101] 5. In vivo imaging to detect the distribution of EVs in tissues (macroscopic): image the tissues under ivis and observe the fluorescence absorption of each tissue, DiR (Ex / Em=754 / 778nm).

[0102] 6. Tissue frozen sections

[0103] (1) Tissue dehydration: The uteri of each group were immersed in 10%, 20%, and 30% sucrose solutions for gradient dehydration. The uteri were transferred to a high concentration solution based on the uterus sinking to the bottom. Finally, they were immersed in a 1:1 (30% sucrose solution: OCT embedding solution) solution and placed at 4°C overnight.

[0104] (2) Tissue embedding: Place the uterus vertically in an embedding box the next day and add embedding solution for embedding.

[0105] (3) Tissue sectioning: The embedded uterus was sectioned using a freezing microtome, with each section measuring 7 μm.

[0106] (4) Pre-staining treatment: The sections were baked on a hot plate for 10 min, fixed with 4% PFA for further 10 min, and then washed three times in PBS for 5 min each time to remove OCT.

[0107] (5) DAPI staining: After the slides were wiped dry, circles were drawn on the tissues with an immunolabeling pen, and then DAPI (30 nM) was added for staining for 10 min. The tissues were then washed with PBS three times, each time for 5 min.

[0108] (6) Sealing: After wiping the slide dry, add anti-fluorescence quenching agent to the slice for sealing.

[0109] 7. Observation of the distribution of EVs in tissues using a laser confocal microscope (microscopic): Laser confocal microscopy was used for observation and photography, DAPI (Ex / Em=364 / 454nm), DiD (Ex / Em=644 / 665nm) (Note: Since the DiR band cannot be observed using the confocal microscope, the dye used for confocal observation was changed to DiD).

[0110] EVs Lamp2b The results of uterine targeting validation in pregnant female mice are as follows Figure 1 As shown, Figure 1 A shows EVs at the macroscopic level (tissue imaging) Lamp2b Targeting the uterus of pregnant female mice, Figure 1 B is the statistical diagram of tissue imaging absorption intensity, Figure 1 C shows EVs at a microscopic level (laser confocal microscopy) Lamp2b It targets the uterus of pregnant female mice and is primarily enriched in the stromal cells of the endometrium.

[0111] Example 3: Screening of Hand2 siRNA

[0112] Takara PrimeScriptrm RT Master Mix (Perfect Real Time) was used for reverse transcription, and THUNDERBIRD SYBR qPCR Mix Without ROX was used for quantitative PCR.

[0113] 1. Extraction of mouse uterine primary stromal cells (MESCs)

[0114] (1) Dissection: The mice were killed, the uterus was removed, cut at the neck, and the uterine cavity was cut open on both sides. The opened uterus was placed in a 15 mL centrifuge tube.

[0115] (2) Digestion of primary epithelial cells (MEEC): Add an appropriate amount of 0.25% trypsin to the tube, place it horizontally on a shaker, and digest it for 60 minutes at 4°C and 50 rpm; then transfer it to room temperature and place it horizontally for 45 minutes; then transfer it to a 37°C water bath and place it horizontally for 15 minutes; add a corresponding volume of DMEM / high glucose medium to the digested uterus and let it stand for 5 minutes to inactivate the trypsin. This Example 4 does not require MEEC and proceeds directly to the next step.

[0116] (3) First round of digestion: The uterus in (1) was transferred to a new medium containing 3 mL of digestion solution (0.05% trypsin (2.7 mL) + 1 mg / mL collagenase (300 μL)) and digested vertically at 50 rpm in a 37°C shaker for 30 min; then, the medium was removed and shaken for 10 s, and 3 mL of DMEM / F12 medium was added to terminate the digestion.

[0117] (4) Collecting MESCs: Transfer the uterus to a 15 mL centrifuge tube containing 3 mL PBS and shake for 10 seconds to release the stromal cells; repeat the above operation twice to obtain a total of 3 cell suspensions and add the tube obtained in (3) to obtain a total of 4 tubes of cell suspension.

[0118] (5) Second round of digestion: The uterus recovered in (4) was vertically digested in a 37°C water bath for 30 min, and then the operations (3)-(4) were repeated to collect a total of 4 tubes of cell suspension.

[0119] (6) Enrichment of MESCs: Filter the 8 tubes of cell suspension obtained above through a 50 μm cell sieve into a 50 mL centrifuge tube, centrifuge at 1690 rpm for 5 min, and discard the supernatant. Add 5 mL of DMEM / F12 medium to the tube, mix thoroughly, and centrifuge at 1690 rpm for 5 min. Discard the supernatant, add an appropriate amount of medium, mix well, count, and plate.

[0120] 2. Cell inoculation: Inoculate 50,000 mouse uterine stromal cells in a 6-well plate.

[0121] 3. Hand2 siRNA treatment: The next day, Lipo8000 was used for transfection. 100 pmol siRNA and 4 μL Lipo8000 were added to 125 μL serum-free culture medium. After incubation at room temperature for 20 minutes, the mixture was added to the cells.

[0122] 4. Cell collection: After 2 days, discard the supernatant and wash twice with PBS.

[0123] 5. Real-time fluorescence quantitative PCR detection of Hand2 knockout:

[0124] (1) Total RNA extraction: 1 mL of Takara RNAiso Plus was added to each 6-well plate to extract RNA. The specific method was the same as (1) in step 3 of Example 2.

[0125] (2) Reverse transcription

[0126] A. The reverse transcription reaction system is shown in Table 8 below.

[0127] Table 8 Reverse transcription reaction system components

[0128]

[0129] B. Reverse transcription reaction procedure: 37℃ for 15 minutes, 85℃ for 5 seconds, 4℃. After reverse transcription, the cDNA product was taken out and quickly cooled on ice. All subsequent steps were performed on ice. cDNA was stored at -80℃ for a long time.

[0130] C. Dilute cDNA 10-fold after reverse transcription.

[0131] (3) Fluorescence quantitative PCR (qPCR)

[0132] A. According to Table 9 below, configure two independent fluorescence quantitative reaction systems for Hand2 and β-Actin respectively.

[0133] Table 9 Fluorescence quantitative reaction system

[0134]

[0135] B. The real-time quantitative PCR reaction procedure is shown in Table 10 below.

[0136] Table 10 Real-time quantitative PCR reaction program

[0137]

[0138] The screening results of Hand2 siRNA are as follows Figure 2As shown, we screened Hand2 siRNA in primary mouse stroma and finally determined Hand2 siRNA-3 as the subsequent experimental sequence. The sense strand of Hand2 siRNA-1 is shown in SEQ ID NO.1 (GACUACAGUAUGGCCCUGUTT), and the antisense strand of Hand2 siRNA-1 is shown in SEQ ID NO.2 (ACAGGGCCAUACUGUAGUCTT); the sense strand of Hand2 siRNA-2 is shown in SEQ ID NO.3 (GCUACAUCGCCUACCUCAUTT), and the antisense strand of Hand2 siRNA-2 is shown in SEQ ID NO.4 (AUGAGGUAGGCGAUGUAGCTT); the sense strand of Hand2 siRNA-3 is shown in SEQ ID

[0139] NO.5 (CCUUCAAGGCGGAGAUCAATT), the antisense strand of Hand2 siRNA-3 is shown in SEQ ID

[0140] NO.6(UUGAUCUCCGCCUUGAAGGTT).

[0141] Example 4: EVs Lamp2b @siRNA preparation

[0142] 1. Integrate siRNA with EVs Lamp2b Co-incubation

[0143] (1) Incubate 200 pmol Hand2 siRNA-3 with 4 μL Transfection reagent and 100 μL Transfection Buffer at room temperature for 15 minutes.

[0144] (2) Add EVs to the mixture in (1) Lamp2b 100 μg and incubate at 37 °C for 1 hour.

[0145] 2. Removal of free Hand2 siRNA-3, transfection reagent and free Hand2 siRNA-3-Exo-Fect complex

[0146] (1) Remove the cap from the attached centrifuge column containing the membrane-penetrating peptide and centrifuge at 1,000 g for 30 seconds to remove the buffer in the column; pre-wash the centrifuge column by adding 500 μL column buffer to the column and centrifuge at 1,000 g for 30 seconds to remove the column buffer in the column, and then buckle the cap back under the column;

[0147] (2) Transfer the reaction obtained in (1) to the included pre-washed spin column and incubate at room temperature with gentle rotation for 10 min;

[0148] (3) Remove the cap from the centrifuge column and place the column in a new 2 mL tube. Centrifuge at 1,000 g for 30 seconds to collect EVs loaded with Hand2 siRNA-3. Lamp2b , get EVs Lamp2b @Hand2 siRNA-3.

[0149] 3. Prepare EVs using the same method as steps 1 and 2 Lamp2b @Hand2 siRNA-1、EVs Lamp2b @Hand2siRNA-2, during the preparation process, only the sequence of Hand2 siRNA-3 was replaced with Hand2 siRNA-1 and Hand2siRNA-2, and the rest were the same.

[0150] Example 5: siRNA Encapsulation Efficiency

[0151] siRNA Encapsulation Using SBI Exo-Fect TM siRNA or miRNA Transfection Kit; reverse transcription and fluorescence quantitative PCR were performed using the Hairpin-itTM microRNA and U6 snRNA Normalization RT-PCR Quantitation Kit.

[0152] 1. Detect fluorescence absorption with an enzyme marker and calculate the encapsulation efficiency

[0153] Use of Fam-tagged SCR siRNA with EVs Lamp2b After incubation at 37°C for 1 hour, the fluorescence absorption of the solution before and after passing through the column was detected, and the encapsulation efficiency = fluorescence absorption after passing through the column / fluorescence absorption before passing through the column, Fam (Ex / Em = 465 / 615nm). Among them, SCR siRNA is a scrambled siRNA.

[0154] 2. Fluorescence quantitative qPCR detection of siRNA encapsulation efficiency

[0155] (1) Total RNA extraction

[0156] A. EVs to be obtained Lamp2b @SCR siRNA was centrifuged at 15000g for 10 min, 1 mL of Takara RNAiso Plus was added to the precipitate, and then vortexed and mixed, and allowed to stand at room temperature for 5 minutes;

[0157] B. Centrifuge at 12,000 g for 5 minutes at 4°C and transfer the supernatant to a new 1.5 mL EP tube;

[0158] C. Add chloroform (1 / 5 the volume of RNAiso Plus), shake to mix, and let stand at room temperature for 5 minutes;

[0159] D. Centrifuge at 12,000 g for 15 minutes at 4°C and transfer the supernatant to a new 1.5 mL EP tube;

[0160] E. Add isopropanol in an equal volume to the supernatant and let stand at room temperature for 10 minutes;

[0161] F. Centrifuge at 12,000 g for 10 minutes at 4°C and add 1 mL of 75% ethanol to wash the pellet;

[0162] G. Centrifuge at 12,000 g for 5 minutes at 4°C, discard the supernatant and keep the precipitate, then dry;

[0163] H. Add appropriate amount of DEPC water to dissolve and then test the RNA concentration.

[0164] (2) Reverse transcription

[0165] A. The reverse transcription system was reacted as shown in Table 11 below.

[0166] Table 11 Reverse transcription reaction system

[0167]

[0168] B. Reverse transcription procedure: 26°C.

[0169] C. Reverse transcription reaction procedure: 40 minutes, 42°C for 40 minutes, 85°C for 10 minutes, 4°C. After reverse transcription, the cDNA product was taken out and quickly cooled on ice. All subsequent steps were performed on ice. cDNA was stored at -80°C for a long time.

[0170] (3) Fluorescence quantitative PCR (qPCR)

[0171] A. According to Table 12 below, two independent fluorescence quantitative reaction systems for miRNA and U6 snRNA were prepared.

[0172] Table 12 Fluorescence quantitative reaction system

[0173]

[0174] B. The real-time quantitative PCR reaction procedure is shown in Table 13 below.

[0175] Table 13 Real-time quantitative PCR reaction program

[0176]

[0177] Encapsulation of siRNA in EVs Lamp2b The packing rate results are as follows Figure 3 As shown, the drug loading efficiency is tested. The column in the kit is used to filter out free siRNA, and the fluorescence absorption before and after passing through the column is detected. BI represents before passing through the column, and AI represents after passing through the column. The drug loading efficiency can be obtained by taking the ratio. Figure 3 A is the fluorescence absorption intensity before and after passing through the column, Figure 3 The value in A can be calculated to be a drug loading efficiency of 60% ( Figure 3 B). Figure 3 C shows that the drug loading can reach 2X10 13 times, that is, this method has a higher drug loading efficiency.

[0178] The same method as above was used to detect the encapsulation efficiency of Hand2 siRNA-1, Hand2 siRNA-2, Hand2 siRNA-1 and Hand2 siRNA-3, respectively, and the results similar to the encapsulation efficiency using the scrambled SCR siRNA mentioned above were obtained.

[0179] Example 6: Cellular uptake of EVs Lamp2b @siRNA

[0180] (1) Cell seeding: 10,000 human uterine stromal cells (hESCs) were seeded in a quadruplicate dish.

[0181] (2)EVs Lamp2b Staining and drug loading: Use Fam-tagged SCR siRNA and EVs every other day Lamp2b Preparation of EVs Lamp2b @SCR siRNA (method see Example 4), and use Dil to treat EVs Lamp2b The precipitate was then centrifuged at 15,000 g for 10 min, the supernatant was discarded, and 50 μL PBS was added to resuspend the precipitate to obtain Dil-stained EVs. Lamp2b @SCR siRNA.

[0182] (3)EVs Lamp2b @SCR siRNA incubation: EVs Lamp2b @SCR siRNA was added to the cells and incubated for 2 h.

[0183] (4) Cell treatment: The supernatant was removed, the cells were washed twice with PBS, and fixed with 4% PFA for 10 min. DAPI (30 nM) was then added for staining for 10 min. After 10 min, the staining solution was discarded and PBS was added.

[0184] (5) Laser confocal microscopy of hESC cell uptake of EVs Lamp2b@SCR siRNA situation: Laser confocal microscopy was used for observation and photography, DAPI (Ex / Em=587 / 610nm), Dil (Ex / Em=549 / 565nm), Fam (Ex / Em=492 / 518).

[0185] Cellular uptake of EVs Lamp2b @SCR siRNA results are as follows Figure 4 As shown, Fam-tagged siRNA was used to target EVs Lamp2b Staining was performed and confocal microscopy was used to observe the expression of EVs by hESCs. Lamp2b @Scrambled siRNA uptake, from Figure 4 It can be observed that siRNA is successfully encapsulated in EVs Lamp2b and are taken up by hESCs.

[0186] The same method as above was used to take up EVs Lamp2b @Hand2 siRNA-1、EVs Lamp2b @Hand2siRNA-2 and EVs Lamp2b @Hand2 siRNA-3, only EVs Lamp2b @SCR siRNA replaced by EVs Lamp2b @Hand2siRNA-1、EVs Lamp2b @Hand2 siRNA-2 or EVs Lamp2b @Hand2 siRNA-3, other methods were the same. The results showed that Hand2 siRNA-1, Hand2 siRNA-2 and Hand2 siRNA-3 were successfully encapsulated in EVs Lamp2b middle.

[0187] Example 6: Non-hormonal contraceptives (EVs) specifically targeting the uterus Lamp2b@ Hand2 siRNA-3) intervention in pregnancy

[0188] 1. EVs Lamp2b @Hand2 siRNA-3 interferes with the expression of Hand2 in mouse uterus

[0189] (1) Cage combination: Place a female mouse and a male mouse in a cage and combine them together. Combine multiple cages at the same time.

[0190] (2) Thromboembolism examination: The female mice were examined for yellow-white clots the next morning to see if there were any. If so, the mice were at PD 0.5 days of pregnancy.

[0191] (3) PD1.5 drug administration: The groups were divided into NT group, EVsLamp2b, EVs Lamp2b@Scrambled siRNA, EVs Lamp2b@ Hand2 siRNA-3 group: The drug was administered via tail vein.

[0192] (4) Sample collection from PD3.5 mice: The mouse uterus was collected 2 days later.

[0193] (5) Real-time fluorescence quantitative PCR detection of Hand2 knockout: 1 / 3 of the uterus was taken for RNA extraction. The specific methods of RNA extraction, reverse transcription, and qPCR were the same as those in Example 4 (5).

[0194] 2. EVs Lamp2b @Hand2 siRNA-3 Effects on Mouse Embryo Number

[0195] (1) Cage combination: Place a female mouse and a male mouse in a cage and combine them together. Combine multiple cages at the same time.

[0196] (2) Thromboembolism examination: The female mice were examined for yellow-white clots the next morning to see if there were any. If so, the mice were at PD 0.5 days of pregnancy.

[0197] (3) PD1.5 treatment: The groups were divided into NT group, EVsLamp2b, EVsLamp2b@Scrambled siRNA, EVs Lamp2b @Hand2 siRNA-3 group. In the drug loading group, 100μg EVsLamp2b was loaded with 200pmol siRNA using the SBI kit. After drug loading, the mice were administered the drug via the tail vein.

[0198] (4) Sample collection from PD8.5 mice: After 7 days, the mouse uterus was sampled and the number of mouse embryos was observed.

[0199] Non-hormonal contraceptives that specifically target the uterus for intervention in pregnancy Figure 5 and Figure 6 As shown, based on the previously screened siRNA, we injected EVs into the tail vein of pregnant female mice on the second day after thrombus formation. Lamp2b @Hand2 siRNA-3, samples were collected on the 4th day after administration to detect the expression of Hand2 in the uterus, Figure 5 The results showed that compared with EVs Lamp2b @SCR siRNA group, EVs Lamp2b @Hand2 siRNA-3 significantly inhibited the expression of Hand2 in the endometrium. Based on the fact that Hand2 transcription factor plays a key role in establishing endometrial receptivity, and the above results show that EVs Lamp2b @Hand2 siRNA-3 can inhibit the expression of Hand2 in the endometrium, in order to further observe EVs more intuitivelyLamp2b @Hand2 siRNA-3 affects the pregnancy of mice. Samples were collected on the 9th day after administration to observe the pregnancy of mice. The pregnancy status and the statistical results of the three times are shown in Figure 6 A and Figure 6 B, EVs can be observed from the result of reduced embryo numbers Lamp2b @Hand2 siRNA-3 significantly interfered with pregnancy.

[0200] The intervention of non-hormonal contraceptives specifically targeting the uterus (EVsLamp2b@Hand2 siRNA-1 and EVsLamp2b@Hand2 siRNA-2) on pregnancy was tested using the same method as above, and similar results were obtained, proving that EVsLamp2b@Hand2 siRNA-1 and EVsLamp2b@Hand2 siRNA-2 can also have a good contraceptive effect.

[0201] Finally, it should be noted that the above embodiments are only illustrative of the principles and performance of the present invention, and are not intended to limit the present invention. Anyone familiar with the technology may modify or optimize the above embodiments without violating the spirit and scope of the present invention. Therefore, all equivalent modifications or optimizations performed by those with ordinary knowledge in the technical field without departing from the spirit and technical ideas disclosed by the present invention should still be covered by the claims of the present invention.

Claims

1. A siRNA, characterized in that The siRNA is Hand2 siRNA; The Hand2 siRNA is one of Hand2 siRNA-1, Hand2 siRNA-2 or Hand2 siRNA-3, or a derivative sequence with an amino acid sequence of Hand2 siRNA-1, Hand2 siRNA-2 or Hand2 siRNA-3 as a backbone; Among them, the sense chain of Hand2 siRNA-1 is shown as SEQ ID NO.1, and the antisense chain of Hand2 siRNA-1 is shown as SEQ ID NO.2; the sense chain of Hand2 siRNA-2 is shown as SEQ ID NO.3, and the antisense chain of Hand2 siRNA-2 is shown as SEQ ID NO.4; the sense chain of Hand2 siRNA-3 is shown as SEQ ID NO.5, and the antisense chain of Hand2 siRNA-3 is shown as SEQ ID NO.

6.

2. Use of a siRNA as claimed in claim 1 in the preparation of engineered extracellular vesicles for contraception.

3. An engineered extracellular vesicle for targeted delivery of Hand2 siRNA to the uterus, characterized in that: The invention comprises an engineered extracellular vesicle targeted to the uterus, and Hand2 siRNA encapsulated in the engineered extracellular vesicle; The Hand2 siRNA is used to interfere with the expression of the Hand2 gene.

4. The engineered extracellular vesicle for uterine-targeted delivery of Hand2 siRNA according to claim 3, characterized in that: The Hand2 siRNA is one of Hand2 siRNA-1, Hand2 siRNA-2 or Hand2 siRNA-3, or a derivative sequence with an amino acid sequence of Hand2 siRNA-1, Hand2 siRNA-2 or Hand2 siRNA-3 as a skeleton.

5. The engineered extracellular vesicle for uterine-targeted delivery of Hand2 siRNA according to claim 3, characterized in that: The Lamp2b protein is expressed on the envelope of the engineered extracellular vesicle targeting the uterus; The amino acid sequence of Lamp2b is selected from one of SEQ ID NOs. 7-13, or a derived sequence with one of SEQ ID NOs. 7-13 as the backbone.

6. A method for preparing an engineered extracellular vesicle for uterine-targeted delivery of Hand2 siRNA as claimed in any one of claims 3 to 5, characterized in that: The following steps are involved: (1) obtaining engineered extracellular vesicles targeting the uterus secreted by cells stably overexpressing the protein Lamp2b; (2) Encapsulating Hand2 siRNA in the engineered extracellular vesicles targeting the uterus obtained in step (1) to obtain engineered extracellular vesicles for contraception.

7. Use of the engineered extracellular vesicles according to any one of claims 3 to 5 or the engineered extracellular vesicles obtained by the preparation method according to claim 6 in the preparation of contraceptive drugs.

8. A contraceptive drug, characterized in that: The contraceptive drug comprises the engineered extracellular vesicles according to any one of claims 3 to 5 or the engineered extracellular vesicles obtained by the preparation method according to claim 6.

9. A contraceptive drug according to claim 8, characterized in that: A single dose of the contraceptive drug is 100 μg of engineered extracellular vesicles encapsulating 200 pmol Hand2 siRNA.

10. A contraceptive drug according to claim 8, characterized in that: The contraceptive drug is administered in the form of intravenous injection, oral gavage, intraperitoneal injection, subcutaneous injection or intradermal injection.

Images