Kit for detecting hantavirus and detection method thereof
Designing specific primers and probes through digital PCR technology has solved the problems of insufficient sensitivity and insufficient type determination of existing Hantavirus detection methods, and achieved high sensitivity and accuracy Hantavirus detection, which is especially suitable for low abundance Sample detection.
Patent Information
- Application Number
- CN202411743510.8
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2024-11-30
- Publication Date
- 2025-02-21
AI Technical Summary
The existing Hantavirus detection methods have problems such as insufficient sensitivity, susceptibility to subjectivity in the judgment of results, insufficient determination of Hantavirus type, and inability to accurately detect low-abundance samples.
Using digital PCR technology to design specific primers and probes, visualize droplet quality control through droplet readers and data analysis software, and directly conduct quantitative detection of nucleic acids, avoid possible quantitative deviations during amplification, and improve Tolerance to PCR inhibitors.
It improves the sensitivity and accuracy of hantavirus detection, and is especially suitable for samples with extremely low nucleic acid content, which can significantly reduce false positive results and improve the accuracy of detection.
Smart Images
Figure CN119491067A_ABST
Abstract
Description
Technical Field
[0001] The invention belongs to the field of medicine and biology, and relates to the detection of a virus, in particular to the detection and identification of Hantavirus. Background Art
[0002] Hantavirus is an enveloped, segmented, negative-strand RNA virus belonging to the family Bunyaviridae that causes two major acute febrile illnesses in many parts of the world: Hantavirus pulmonary syndrome (HPS) and hemorrhagic fever with renal syndrome (HFRS).
[0003] The main transmission routes of Hantavirus include respiratory transmission, digestive tract transmission, contact transmission and vertical transmission. Specifically, it can be transmitted through inhalation of aerosols formed by rodent excrement carrying the virus, eating contaminated food, being bitten or wounded by a rodent and coming into contact with rodent excrement carrying the virus, infection after blood, and infection of the fetus through the placenta after a pregnant woman is infected.
[0004] my country is a country with a high incidence of hemorrhagic fever with renal syndrome, with 20,000 to 50,000 cases reported each year, accounting for more than 90% of the total number of cases in the world. For a long time, Hantaan (HTNV) and Seoul (SEOV) viruses have been the two main serotypes in my country, and their hosts are the black-lined field mouse (Apodemus agrarius) and the brown rat (Rattus norvegicus). In 2009, the Chinese Academy of Inspection and Quarantine also confirmed the existence of Amur hantavirus in rodents at Changbai Port.
[0005] In the detection of natural pathogens infected with rodents monitored at key ports in northern my country in 2019, 4 cases (4 / 31) of brown rats captured at Huludao Port were found to be positive for hantavirus nucleic acid, the pathogen of hemorrhagic fever with renal syndrome. All of them were Seoul-type viruses, with a carrier rate of 12.90%; 5 cases (5 / 54) of hantavirus nucleic acid were detected in the lung tissues of large forest mice at Changbai Port, which were Amur-type hantavirus, and the carrier rate of hantavirus in large forest mice was 9.26%.
[0006] Huludao Port detected positive results of Seoul Hantavirus in brown rats in 2017, 2018 and 2019. The virus can be excreted through the blood, saliva, urine and feces of host animals and has a wide range of transmission routes. In addition to strengthening the monitoring of rodent density, accurate typing tests should be conducted on pathogens carried by rodents to reduce the risk of transmission of hemorrhagic fever with renal syndrome.
[0007] Currently, the detection methods for Hantavirus mainly include serological detection methods (antigen detection, antibody detection) and nucleic acid detection methods, including immunofluorescence assay (IFA), enzyme-linked immunosorbent assay (ELISA), colloidal gold method, real-time fluorescence RT-PCR method, etc.
[0008] Immunofluorescence assay (IFA) is the recommended method for monitoring Hantavirus in host animals in the current monitoring program. It is easy to operate, but the result judgment is easily affected by subjective factors, and there are problems such as it cannot be used for high-throughput detection; enzyme-linked immunosorbent assay has high sensitivity, simple operation, suitable for high-throughput detection, and convenient for daily clinical testing and large-scale serological epidemiological surveys, but it is insufficient in determining the type of Hantavirus; colloidal gold method has the advantages of simplicity and low cost, and is suitable for grassroots units and on-site testing, but it has low sensitivity and can only perform qualitative but not quantitative detection; RT-PCR method has the advantages of high specificity and high sensitivity, can perform quantitative detection, and can perform type judgment, but its analysis results are heavily dependent on the cycle threshold (Ct value) and cannot accurately detect low-abundance samples.
[0009] The digital PCR technology used in the present invention does not need to rely on a standard curve or amplification cycle threshold, and can directly perform quantitative analysis on nucleic acids, which is an endpoint detection method. This method avoids the quantitative deviation that may occur during the amplification process to a certain extent, and has a higher tolerance to PCR inhibitors, thereby showing obvious advantages in improving the accuracy of quantitative analysis and reducing variability. For samples with low nucleic acid content, digital PCR technology shows higher detection sensitivity. In addition, through the application of droplet readers and data analysis software, digital PCR technology can realize the visualization of droplet quality control, which is easier to identify and exclude false positive results than traditional RT-PCR methods, further improving the accuracy of detection. Summary of the invention
[0010] The purpose of the present invention is to provide a primer for detecting and typing Hantavirus. The present invention has very good sensitivity and accuracy in terms of detection effect.
[0011] Primers were designed for the Hantan type L gene fragment, Hantan type S gene fragment, and Hantan type M gene fragment, and each type involved two target probe sets and one internal standard probe set.
[0012] The object of the present invention is to provide a primer for detecting and typing Hantavirus, comprising the following primer set:
[0013]
[0014]
[0015] Preferably, the primers and probes for detecting Hantavirus of the present invention are:
[0016]
[0017] Another object of the present invention is to provide the use of the above primers and probes in the preparation of a Hantavirus detection and genotyping kit.
[0018] Another object of the present invention is to provide a kit for detecting Hantavirus, comprising one or more of the above-mentioned primers.
[0019] Another object of the present invention is to provide a method for detecting Hantavirus for non-diagnostic purposes, comprising the following steps:
[0020] 1. Extract RNA from the sample to be tested. The extraction method belongs to the existing technology. Use a commercial extraction kit to extract RNA from tissues, cells or blood samples and store them at -80°C for future use.
[0021] 2. This method can use both RNA and cDNA of the sample to be tested as templates. The specific primers and fluorescent probe sequences used for detection are as follows:
[0022]
[0023]
[0024] The composition and preparation methods of different template reaction systems are as follows:
[0025] (1) The reaction system using the sample RNA to be tested as a template is as follows:
[0026] Reagent name Add volume (μL) 1× <![CDATA[qScript TM XLT One-Step RT-qPCR ToughMix]]> 12.5 Fluorescein sodium salt (1μM) 2.5 HAN-L Assay(25×)FAM 2 HAN-M Assay(25×)HEX 1 β-actin Assay(25×)CY5 1 <![CDATA[H2O and the RAN template to be measured]]> 6 Total volume 25μL
[0027] (2) The reaction system using the cDNA of the sample to be tested as the template is as follows:
[0028] Reagent name Add volume (μL) 1× PerfeCTa Multiplex qPCR ToughMix,5× 5 Fluorescein sodium salt (1μM) 2.5 HAN-L Assay(25×)FAM 2 HAN-M Assay(25×)HEX 1 β-actin Assay(25×)CY5 1 <![CDATA[H2O and cDNA sample to be measured]]> 13.5 Total volume 25μL
[0029] (3) After the above system is prepared, add 25 μL to each well of the Sapphire Chip and place the chip in the Crystal Digital PCR System for PCR amplification. The reaction conditions are as follows:
[0030]
[0031] (4) After the PCR reaction is completed, the chip is taken out and placed in the NaicaTM prism droplet reading and analysis system to scan the chip and analyze the data.
[0032] This study established a digital PCR genotyping detection technology for Hantaan type of Hantaan virus, which is divided into four steps: first, primer design, Hantaan type-specific primers, primers for Hantaan type L gene fragment, Hantaan type S gene fragment, Hantaan type M gene fragment, 2-3 pairs of primers for each target gene, and dye-based qPCR to verify its specificity, and select primers for subsequent experiments; then, based on the selected primers, probes for detection are designed, and primer-probe combination specificity verification and condition optimization are performed, and known positive and negative samples are used to test specificity, each type involves two target primer probe sets and one internal standard primer probe set; then a digital PCR method system is designed, including single, double and triple combination interference verification, copy number concentration comparison verification and other triple probe combination verification and condition optimization; finally, 50 unknown samples are tested. Finally, a digital PCR genotyping detection technology for Hantaan virus is established.
[0033] The detection method or kit of the present invention has the following advantages over existing methods:
[0034] The kit and detection method provided by the present invention show excellent sensitivity and accuracy in detecting Hantavirus (Hantavirus type). Using digital PCR technology, this method disperses the standard PCR reaction into thousands of tiny reaction units (droplets), each of which may contain zero or more copies of the target molecule, to achieve PCR amplification of a single molecular template. This method is particularly suitable for samples with extremely low nucleic acid content and can significantly improve the sensitivity of detection. Through the droplet reader and data analysis software, automated analysis of data can be achieved, making the droplet quality control process visual, and more accurate test results can be obtained compared to the RT-PCR method. Digital PCR technology does not rely on standard curves or amplification cycle thresholds, and can directly perform quantitative detection of nucleic acids, which belongs to the endpoint detection method. To a certain extent, this technology avoids the quantitative deviation that may be caused during the amplification process, and has a higher tolerance to PCR inhibitors, thereby having obvious advantages in improving the accuracy of quantitative analysis and reducing variability. BRIEF DESCRIPTION OF THE DRAWINGS
[0035] Figure 1 , Primer pair HAN-S-1F / R detects positive samples (A is the amplification curve, B is the melting curve)
[0036] Figure 2 , Primer pair HAN-S-2F / R detects positive samples (A is the amplification curve, B is the melting curve)
[0037] Figure 3 , Primer pair HAN-M-2F / R detects positive samples (A is the amplification curve, B is the melting curve)
[0038] Figure 4 , Primer pair HAN-M-3F / R detects positive samples (A is the amplification curve, B is the melting curve)
[0039] Figure 5 , Primer pair HAN-M-4F / R detects positive sample YSFH-F-28 (A is the amplification curve, B is the melting curve)
[0040] Figure 6 , Primer pair HAN-M-5F / R detects positive sample YSFH-F-28 (A is the amplification curve, B is the melting curve)
[0041] Figure 7 , Primer pair HAN-L-2F / R detects positive sample YSFH-F-28 (A is the amplification curve, B is the melting curve)
[0042] Figure 8 , Primer pair HAN-L-3F / R detects positive sample YSFH-F-28 (A is the amplification curve, B is the melting curve)
[0043] Fig. 9 , Primer pair HAN-S-1F / R negative and positive sample detection diagram (A is the amplification curve, B is the melting curve)
[0044] Fig.10 , Primer pair HAN-M-4F / R negative and positive sample detection diagram (A is the amplification curve, B is the melting curve)
[0045] Fig.11 , Primer pair HAN-L-2F / R negative and positive sample detection diagram (A is the amplification curve, B is the melting curve)
[0046] Fig.12 , primer-probe combination HAN-L-2-F / R / P probe method detection amplification curve
[0047] Fig.13 , primer-probe combination HAN-M-4F / R / P probe method detection amplification curve
[0048] Fig.14 , One-dimensional diagram of the sample SYFH-F-24 (cDNA) detected by the Hantan type probe combination (A: Hantan L, B: Hantan M, C: animal source)
[0049] Fig.15 , One-dimensional diagram of the sample SYFH-F-28 (cDNA) detected by the Hantan type probe combination (A: Hantan L, B: Hantan M, C: animal source)
[0050] Fig.16, One-dimensional diagram of the sample HLDF-10 (cDNA) detected by the Hantan type probe combination (A: Hantan L, B: Hantan M, C: animal source)
[0051] Note: The droplets above the threshold line are positive droplets, i.e., droplets containing the target gene; the droplets below the threshold line are negative droplets, i.e., droplets without the target gene. DETAILED DESCRIPTION
[0052] The product and preparation method of the present invention are further described below in conjunction with specific examples, but the present invention is not limited to the following examples. The methods are conventional methods unless otherwise specified. The raw materials can be obtained from public commercial channels unless otherwise specified.
[0053] Example 1. Primer design and specificity verification of Hantavirus (Hantavirus type)
[0054] 1. Purpose
[0055] A primer set for the Hantavirus Hantaan type involved was designed, and its specificity was detected by dye-based qPCR.
[0056] (II) Materials, reagents and instruments
[0057] 1. Main instruments and equipment
[0058] Instrument Name factory <![CDATA[CFX96 TM Real-Time System]]> Bio-Rad
[0059] 2. Main Reagents
[0060]
[0061] 3. Experimental materials (randomly select two RNA samples for testing)
[0062] name source type A260 A260 / A280 Concentration (ng / μL) YSFH-F-5 Mouse lung tissue RNA 6.68 2.12 267.1 YSFHF28 Mouse lung tissue RNA 5.17 2.23 206.71
[0063] 4. Primer Synthesis
[0064]
[0065] (III) Experimental process
[0066] 1.cDNA synthesis system and process
[0067]
[0068] 2.cDNA Sample Processing
[0069] The above 20 μL cDNA template was supplemented with water to 100 μL and aliquoted for later use.
[0070] 3.PCR system and process:
[0071] The annealing temperature was adjusted to 60°C, and samples YSFHF05 and 2017YSFHF28 were selected for testing)
[0072]
[0073] (IV) Test results
[0074] 1. Detection results of Hantan type S fragment
[0075] (1) Ct value
[0076] Primer combinations Sample name Ct value (Mean) HAN-S-1F / R YSFH-F-5 32.08 HAN-S-1F / R YSFH-F-28 27.76 HAN-S-2F / R YSFH-F-5 31.27 HAN-S-2F / R YSFH-F-28 28.61
[0077] (2) Amplification curve and melting curve
[0078] See also Figure 1 , 2 .
[0079] 2. Detection results of Hantan type M fragment
[0080] (1) Ct value
[0081] Primer combinations Sample name Ct value (Mean) HAN-M-2F / R YSFH-F-5 30.15 HAN-M-2F / R YSFH-F-28 32.66 HAN-M-3F / R YSFH-F-5 31.12 HAN-M-3F / R YSFH-F-28 34.64 HAN-M-4F / R YSFH-F-28 34.40 HAN-M-5F / R YSFH-F-28 39.58
[0082] (2) Amplification curve and melting curve
[0083] See also Figure 3 —6.
[0084] 3. Detection results of Hantan type L fragment
[0085] (1) Ct value
[0086] Primer combinations Sample name Ct value (Mean) HAN-L-2F / R YSFH-F-5 29.28 HAN-L-2F / R YSFH-F-28 28.18 HAN-L-3F / R YSFH-F-5 32.09 HAN-L-3F / R YSFH-F-28 31.13
[0087] (2) Amplification curve and melting curve
[0088] See also Figure 7 , 8 .
[0089] (V) Results description and conclusion
[0090] 1. For the Hantan type S fragment, the primer pairs HAN-S-1F / R and HAN-S-2F / R were amplified in the positive samples YSFH-F-28 and YSFH-F-5, and the melting curve of the sample YSFH-F-28 was a single peak. However, the melting curve of the primer pair HAN-S-2F / R in the sample YSFH-F-5 was abnormal. Therefore, HAN-S-1F / R can be used for subsequent experiments.
[0091] 2. For the Hantan type M fragment, the primer pair HAN-M-5F / R failed to detect in the positive sample YSFH-F-28, and the other primers all had amplification curves, but the melting curves of primers HAN-M-2F / R and HAN-M-3F / R were abnormal. Primer HAN-M-4F / R can be detected in sample YSFH-F-28, and the melting curve has a single peak. NTC has amplification, but the melting curve is different from the sample well, which may be a primer dimer. Therefore, HAN-M-4F / R can be used for subsequent experiments.
[0092] 3. For the Hantan type L fragment, the primer pairs HAN-L-2F / R and HAN-L-3F / R were both able to detect in sample YSFH-F-28, but the melting curve of primer HAN-L-3F / R was abnormal, so the primer pair HAN-L-2F / R was selected for subsequent experiments.
[0093] Example 2 Specificity verification of Hantavirus (Hantavirus type) primers in negative samples
[0094] 1. Purpose
[0095] Validation of the specificity of Hantan-type primers in negative samples.
[0096] (II) Materials, reagents and instruments:
[0097] 1. Main instruments and equipment
[0098] Instrument Name factory <![CDATA[CFX96 TM Real-Time System]]> Bio-Rad
[0099] 2. Main Reagents
[0100]
[0101]
[0102] (III) Experimental process
[0103]
[0104] (IV) Test results
[0105] 1. Ct value
[0106] Primer Name Target fragment Samples to be tested Sample Type Ct value Remark HAN-S-1F / R Hantan-type S segment HLD-F-10 Hantan type negative 37.78 Not detected HAN-S-1F / R Hantan-type S segment YSFH-F-28 Hantan type positive N / A Not detected HAN-M-4F / R Hantan-type M segment YSFH-24 Hantan type positive 31.14 Checkout HAN-M-4F / R Hantan-type M segment HLDF-10 Hantan type negative 37.87 Not detected HAN-L-2F / R Hantan L fragment HLD-F-10 Hantan type negative 37.26 Not detected HAN-L-2F / R Hantan L fragment YSFH-F-28 Hantan type positive 29.94 Checkout F / R_β-actin Animal origin YSFH-F-28 / 21.70 Checkout
[0107] 3. Amplification curve and melting curve
[0108] See also Fig. 9 , 10 、11.
[0109] (V) Results description
[0110] 1. For primer HAN-S-1F / R, there are amplification curves in both positive and negative samples, with Ct values between 36-40, but the melting curve is abnormal. The primer and sample were retested, and the results of repeated tests are as follows. The Ct value in the positive sample is 39.34. It may be due to sample degradation or other reasons.
[0111] Primer Name Virus genotype Samples to be tested Sample Type Ct value Remark HAN-S-1F / R Hantan-type S segment blank NTC N / A Not detected HAN-S-1F / R Hantan-type S segment HLD-F-10 Hantan type negative N / A Not detected HAN-S-1F / R Hantan-type S segment YSFH-F-28 Hantan type positive 39.34 Not detected
[0112] 2. The results for primer HAN-M-4F / R show that the primer is specific, and its melting curve in positive samples has a single peak with a Ct value of 31.14; while the melting curve in negative samples may be a primer dimer.
[0113] 3. For primer HAN-L-2F / R, it was only detected in positive samples, and the melting curve had a single peak, indicating that the primer was specific and could be used for subsequent probe synthesis.
[0114] Based on the above results, primers HAN-M-4F / R and HAN-L-2F / R were selected to design probes for subsequent detection experiments.
[0115] Example 3 Hantavirus (Hantavirus) probe design and specificity verification - testing positive and negative samples
[0116] 1. Purpose
[0117] The probes HAN-L-2p and HAN-M-4p were designed and synthesized, and the specificity of the primer-probe combination was verified by qPCR.
[0118] (II) Materials, reagents and instruments:
[0119] 1. Main instruments and equipment
[0120] Instrument Name factory <![CDATA[CFX96 TM Real-Time System]]> Bio-Rad
[0121] 2. Main Reagents
[0122] name Part Number factory PerfeCTa qPCR ToughMix UNG 95138 Quantabio
[0123] 3. Probe Synthesis
[0124] Primer / probe name Sequence (5'-3') Fluorescent labeling Target genes HAN-L-2p AATTGCGACAGCCACATGGTT 5'FAM,3'BHQ1 Hantan L fragment HAN-M-4P CGGCTGCGGTATGATTCTTCCAC 5'HEX,3'BHQ1 Hantan-type M segment P_β-actin TACTCCTGCTTGCTGATCCACATC 5'CY5,3'BHQ2 Animal origin
[0125] (III) Experimental process
[0126]
[0127]
[0128]
[0129] (IV) Test results
[0130] 1. Ct value
[0131] Primer Name Experiment Type Samples to be tested Sample Type Ct value Remark HAN-L-2-F / R / P Probe method NTC Blank control N / A Not detected HAN-L-2-F / R / P Probe method YSFH-F-23 Hantan type positive 36.00 Checkout HAN-L-2-F / R / P Probe method YSFH-F-24 Hantan type positive 31.17 Checkout HAN-M-4F / R / P Probe method YSFH-F-24 Hantan type positive 32.21 Checkout HAN-M-4F / R / P Probe method HLDF-10 Hantan type negative N / A Not detected HAN-M-4F / R / P Probe method NTC Blank control N / A Not detected
[0132] 3. Amplification curve and melting curve
[0133] See also Fig.12 , 13 .
[0134] (V) Results description
[0135] 1. For the primer-probe combination HAN-L-2-F / R,2P, there was no amplification in NTC when detected by the probe method, but there was amplification in the positive samples YSFH-F-23 and 24, but the Ct value of YSFH-F-23 was 36, and the concentration was low. This shows that the primers and probes HAN-M-4F / R / P designed for the Hantan type are specific and can be used for subsequent detection experiments.
[0136] 2. The primer-probe combination HAN-M-4F / R / P was detected in the positive sample YSFH-F-24, but not in the negative sample and NTC, indicating that the primers and probe HAN-M-4F / R / P designed for the Hantan type are specific and can be used for subsequent detection experiments.
[0137] Example 4. Establishment of digital PCR method for Hantavirus (Hantavirus type)
[0138] 1. Purpose
[0139] Validation of the digital PCR method for Hantavirus (Hantavirus type).
[0140] (II) Materials, reagents and instruments:
[0141] 1. Main instruments and equipment:
[0142] Instrument Name factory <![CDATA[Naica TM Crystal Digital PCR System]]> Stilla
[0143] 2. Main reagents:
[0144] name Part Number factory PerfeCTa Multiplex qPCR ToughMix,5× 95147 Quantabio Fluorescein sodium salt AK200000 Apexbio Sapphire Chip C14012 Stilla Technologies
[0145] 3. Experimental Materials
[0146] name source type Contains virus type HLD-F-10 Mouse lung tissue cDNA Seoul Type YSFH-F-24 Mouse lung tissue cDNA Hantan Type YSFH-F-28 Mouse lung tissue cDNA Hantan Type
[0147] (III) Experimental process
[0148]
[0149] (IV) Test results
[0150] 1. Digital PCR test results:
[0151]
[0152] 2. One-dimensional graph display of digital PCR detection
[0153] See also Fig.14 , 15 、16.
[0154] (V) Results description and conclusion
[0155] The Hantan-type primer-probe combination (L and M) was only detected in the Hantan-type positive samples SYFH-F-24 and SYFH-F-28 (cDNA), but not in the negative sample HLD-F-10 (cDNA), indicating that the Hantan-type primer-probe combination is specific and can accurately detect the Seoul-type virus.
[0156] The above description is only a preferred embodiment of the present invention. It should be noted that the embodiments of the present invention are not limited to the embodiments. Without departing from the principle of the present invention, several changes, modifications, substitutions, combinations, and simplifications can be made, all of which should be equivalent replacement methods, and these should also be regarded as the scope of protection of the present invention.
Claims
1. A kit for detecting Hantavirus, characterized in that: The following primer and probe sets are included: HAN-L-2F:CAGGTTGTTAGCTTTTAAAC HAN-L-2R:GGTCTTCTTGTGTAGTATTG HAN-L-2P:AATTGCGACAGCCACATGGTT HAN-M-4F: GTGTCTACTGAAGTTGAC HAN-M-4R: AGGTCATAACAGGTTATTG HAN-M-4P: CGGCTGCGGTATGATTCTTCCAC.
2. A kit for detecting Hantavirus, characterized in that: Comprising the primer according to claim 1.
3. Use of the kit according to claim 2 in detecting Hantavirus.
4. A PCR reagent for detecting Hantavirus, characterized in that: The PCR reagents include the primer and probe combination as claimed in claim 1.
5. The PCR reagent according to claim 4, characterized in that Includes the following ingredients: PerfeCTa Multiplex qPCR ToughMix 5μL Fluorescein sodium salt 2.5μL HAN-L-2-F / R,2P 2μL HAN-M-4F / R / P 2μL F1 / R1_Actin, P_Actin 2μL H2O 9.5μL cDNA 2μL.
6. A method for detecting Hantavirus Hantavirus for non-diagnostic purposes, characterized in that The following steps are involved: (1) Extract RNA from the sample to be tested using a commercial extraction kit to extract RNA from tissues, cells or blood samples and store at -80°C for future use. (2) Both RNA and cDNA of the sample to be tested can be used as templates. The specific primers and fluorescent probe sequences used for detection are as follows: The composition and preparation methods of different template reaction systems are as follows: 1) The reaction system using the sample RNA to be tested as the template is as follows: 2) The reaction system using the cDNA of the sample to be tested as the template is as follows: (3) After the above system is prepared, add 25 μL to each well of the Sapphire Chip and place the chip in the Crystal Digital PCR System for PCR amplification. The reaction conditions are as follows: (4) After the PCR reaction is completed, the chip is taken out and placed in the NaicaTM prism droplet reading and analysis system to scan the chip and analyze the data.