Morchella septimelata strain pleurospermum hookeri No.18 and application thereof

Abstract

The invention provides a Morchella septimelata strain pleurospermum hookeri No.18 and application thereof, and relates to the technical field of strain breeding, the Morchella septimelata strain pleurospermum hookeri No.18 is obtained by space-carrying induced genetic variation, then subculture is carried out to screen out stably inherited characters, and the Morchella septimelata strain pleurospermum hookeri No.18 is screened through a fruiting screening test. According to the method, the hypha adaptability, resistance, harvesting concentration and commercial mushroom quality are remarkably improved, the method can be widely applied to cultivation and production of morchella septimelata, the acre yield of morchella septimelata can be greatly increased, and the method has a wide application prospect.

Description

Technical Field

[0001] The invention relates to the technical field of strain breeding, and in particular to a Morchella chinensis strain Meizai No. 18 and applications thereof. Background Art

[0002] Seven Sister Morel ( Morchella eximia ) has the characteristics of high protein and low calories, and has health functions, and is deeply loved by the public. Since 2008, my country has begun to cultivate morels on a large scale, and the planting area and scale have increased year by year. The Seven Sisters Morel is one of the main species cultivated commercially in my country since 2023.

[0003] Creating genetic variation and improving genetic characteristics through breeding in order to cultivate new varieties of Morchella with stable genetic traits, high quality and high yield has always been a focus of technical personnel in this field and has great application value. Summary of the invention

[0004] The purpose of the present invention is to provide a strain of Morchella chinensis Meizai No. 18 and its application. The strain of Morchella chinensis Meizai No. 18 has the characteristics of high yield, good commercial properties and strong resistance to foreign bacteria, can be widely used in the cultivation and production of Morchella chinensis, and has the advantages of high quality and high yield.

[0005] The embodiment of the present invention is achieved as follows: A strain of Morchella oxysporum Meizai No. 18, with a collection number of CGMCC No. 41346, was deposited at the General Microbiology Center of China National Culture Collection Administration on June 27, 2024. The collection address is No. 3, Yard No. 1, Beichen West Road, Chaoyang District, Beijing.

[0006] An application of the above-mentioned Qimei Morchella strain Meizai No. 18 in Morchella cultivation and production.

[0007] The beneficial effects of the embodiments of the present invention are: The present invention provides a strain of Morchella chinensis Meizai No. 18 and its application. The Morchella chinensis Meizai No. 18 is subjected to space flight to induce genetic variation, and then the stable hereditary traits are screened out through subculture, and the strain is obtained through mushroom screening test. The mycelium adaptability, resistance, collection speed and commercial mushroom quality are significantly improved, and the strain can be widely used in the cultivation and production of Morchella chinensis, which can greatly improve the per mu yield of Morchella chinensis chinensis, and has broad application prospects. BRIEF DESCRIPTION OF THE DRAWINGS

[0008] In order to more clearly illustrate the technical solutions of the embodiments of the present invention, the drawings required for use in the embodiments are briefly introduced below. It should be understood that the following drawings only show certain embodiments of the present invention and therefore should not be regarded as limiting the scope. For ordinary technicians in this field, other related drawings can be obtained based on these drawings without creative work.

[0009] Figure 1 A schematic diagram of the fruiting body and spore print of Morchella chinensis G2022 provided in Example 1 of the present invention; Figure 2 Schematic diagram of the space-borne monofilament strains Meizai 01-Meizai 56 provided in Example 1 of the present invention; Figure 3 A schematic diagram of the morphology of the fresh fruiting body of Meizai No. 18 provided in Example 1 of the present invention; Figure 4 A schematic diagram of the planting scene of the Qimei Morchella strain Meizai No. 18 provided in the application example of the present invention; Figure 5 A schematic diagram showing the morphological comparison between the Qimei Morchella strain Meizai 18 and the strain G10 that has not been carried on space flight, provided as an application example of the present invention; wherein, strains 1 to 3 from the left are Meizai 18, and strains 1 to 3 from the right are G10. DETAILED DESCRIPTION

[0010] In order to make the purpose, technical scheme and advantages of the embodiments of the present invention clearer, the technical scheme in the embodiments of the present invention will be described clearly and completely below. If the specific conditions are not specified in the embodiments, they are carried out according to conventional conditions or conditions recommended by the manufacturer. If the manufacturer of the reagents or instruments used is not specified, they are all conventional products that can be purchased commercially.

[0011] The following specifically describes a strain of Morchella chinensis Meizai No. 18 and its application according to an embodiment of the present invention.

[0012] The embodiment of the present invention provides a strain of Morchella chinensis Meizai No. 18, whose preservation number is CGMCC No. 41346, and is deposited in the General Microbiology Center of China Microorganism Culture Collection Administration on June 27, 2024, and the preservation address is No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing.

[0013] The cultivation method of the Qimei Morchella strain Meizai No. 18 is as follows: S1. Collect spore prints of fresh Morchella edulis, dry them and set aside.

[0014] S2. The pure cultured single-spore strain of Morchella septempunctata was obtained by single-spore isolation.

[0015] S3. The pure cultured monospore strain is carried into space for cultivation to obtain the space-borne strain.

[0016] S4. Activate and systematically screen the returned space-borne strains to obtain single-hyphae strains.

[0017] S5. Subculture the mycelium of a single strain, select the ones that can be subcultured to the 25th generation, have fast mycelial germination, neat edges, few aerial mycelium, dense sclerotia and little pigment, complete the preliminary domestication work, and preserve the domesticated strains.

[0018] S6. The domesticated strains were subjected to multiple point and multiple fruiting screening tests, and a strain of Morchella chinensis was obtained, which has the characteristics of fast mycelium germination, strong resistance to foreign bacteria, long cap, short stem, strong fragrance, and strong mycelium resistance to foreign bacteria, achieving the purpose of domestication and breeding of excellent strains. The strain was named "Meizai No. 18".

[0019] The mycelium culture temperature of the Seventh Sister Morel strain Meizai No. 18 is 8~25℃, the humidity is 75%, the carbon dioxide concentration is 500~3000ppm, and the culture period is 10~25 days.

[0020] The strain of the Qimei Morchella strain Meizai No. 18 has the following morphological characteristics: its mycelium is attached and the sclerotia are concentrated; the fruiting bodies are scattered to clustered, and its cap is oblong to oblong conical, light brown to brown in color, about 9 to 15 cm long, and about 3 to 8 cm in diameter; its cap handle is white in color, relatively short, about 1 to 2 cm long, and about 0.5 to 1.2 cm in diameter. The mushroom flesh is tough, elastic, and has a strong aroma. Figure 1 shown.

[0021] The Qimei Morchella Meizai No. 18 strain was amplified and sequenced using the universal primers ITS4 / ITS5 for fungi to obtain the nucleotide sequence of the molecular fragment as shown in SEQ ID NO: 1, which is as follows: .

[0022] The nucleotide sequence SEQ ID NO:1 was compared with the sequence of GenBank (https: / / blast.ncbi.nlm.nih.gov / Blast.cgi?PROGRAM=blastn&PAGE_TYPE=BlastSearch&LINK_LOC=blasthome#), and the result was 100% homologous to the Morchella eximia in the database, with gene accession numbers (KM587980, MT435009 and MZ027897). Therefore, the strain of Morchella eximia Meizai No. 18 was identified as Morchella eximia.

[0023] Furthermore, through genetic testing, it was found that compared with the common Qimei Morchella in the market, the Qimei Morchella strain Meizai No. 18 includes a specific DNA fragment of about 484 bp in size. The nucleotide sequence of the specific DNA fragment is as shown in SEQ ID NO: 2, which is as follows: TTCCCCTACGCCCCCATACAGCGCGTCCCGGCCTCAAGCTCGTCGCGTAGCCGTGCAATCACCTCTGCCCCGCATAGCCAAGCACAACCCTATGCGCAAAGTGCAGGGAGCGTAGCTCGTACTTCAACACCATCGCGTAGCCATACACATTCTTCGGCGTCACGGCACAGTCAAATGAGCCATCAGCCCATCTCTGGCAGCCAAGCTCCTACCCACGCATCGCACCGCAGTAGCACAACCAG AGTAAGTCATGGCGGATCTCACGGTAGGCATATGGACCAACCGCCACGCTATGAGGCACCATCTAGGCCTGCTGCCGGTATGATTGCCCCTTCTCCATCTGGATACCAGACGTCGTCGTTCCCGCAAAGGACCGACTACATCCAGCGCCCGGCCACGGTGGTAACAAGGGGACCGAGTCGTCCGCCTGTCGCCCCAGACGCGCCGTCGCATGTATCGAGACACTCACATCACTCGTGTTCGG.

[0024] The specific DNA fragment is obtained by PCR amplification of the Morchella chinensis strain Meizai No. 18 with specific primers; the specific primers include Primer_1L and Primer_1R, and their nucleotide sequences are shown in SEQ ID NO:3 and SEQ ID NO:4 respectively, and are specifically as follows: Primer_1L:5'- CTCCCGGCACACCTACAAG -3' Primer_1R:5'- GCTTCGAGTCGTCGTACGT -3' During PCR amplification, Primer_1L and Primer_1R primer sets were added to the amplification system at the same time, and 2% agarose gel electrophoresis was used for detection after the reaction was completed.

[0025] Wherein, the amplification system is: PCR Buffer 1×, MgCl 21.50 mM, dNTPs Mix 0.25 mM, specific primers 1.00 mM each, rTaqPolymerase 1.5 U, template DNA 50 ng; The reaction conditions are: Pre-denaturation at 95°C for 3 min, followed by 35 cycles of 95°C for 60 s, 53°C for 40 s, and 72°C for 30 s; final extension at 72°C for 10 min.

[0026] The sequencing of the PCR amplification reaction products was sent to Beijing Biotech Biotechnology Co., Ltd., Shanghai Shenggong Bioengineering Technology Service Co., Ltd. and Yingjun Biotechnology Co., Ltd. The sequencer used for sequencing was ABI3730DNA sequencer, and the sequencing primers were the same as the PCR amplification primers.

[0027] The embodiment of the present invention also provides an application of the above-mentioned Qimei Morchella strain Meizai No. 18 in the cultivation and production of Morchella.

[0028] The cultivation conditions of the strain of the seventh sister morel, Meizai No. 18, are: Soil temperature is 10~14℃, air humidity is 85%~100%, carbon dioxide concentration is 400~1000ppm, light intensity is 300~3000Lux. The cultivation period is 90~130 days.

[0029] After repeated tests, a suitable nutrient package for the strain of Morchella chinensis Meizai No. 18 was obtained. According to the percentage by weight, the nutrient package includes: Wheat kernels 33%~53%, corn cobs 45%~65%, slaked lime 1%~3%.

[0030] Its water content is 55-63% and pH is 6.5-7.5. This nutrient pack can effectively promote the growth of strains and improve the yield and quality of strains.

[0031] The features and performance of the present invention are further described in detail below in conjunction with the embodiments. Example

[0032] This embodiment provides a strain of Morchella chinensis Meizai No. 18, the cultivation process of which is as follows: S1. A fresh Morchella edulis (G2022, s. Figure 1 As shown), collect spore prints indoors and dry them for later use.

[0033] S2. A series of pure cultured single-spore strains T1-T99 were obtained by conventional single-spore isolation. Subsequently, the strain intended for space travel (No. G14-98) was obtained through conventional Morchella strain resistance screening and mushroom fruiting experiments.

[0034] S3. The strain was carried into space on the Shenzhou XIV manned spacecraft on June 5, 2022, and returned to the ground in the return capsule of the Shenzhou XIV manned spacecraft on December 4, 2022. After being fair-checked, it was brought back to the Culture Collection Center of the Kunming Institute of Botany, Chinese Academy of Sciences for related research.

[0035] S4. The space-borne strain G14-99 was activated and systematically screened to obtain 56 single-hyphae strains, numbered Meizai01-Meizai56 (e.g. Figure 2 as shown).

[0036] S5. The 56 strains obtained were subcultured using ordinary PDA medium. The culture conditions were: temperature 16°C, humidity 70%, carbon dioxide concentration less than 3000ppm, and dark culture. On the third day of inoculation, the number with fast mycelium germination speed was selected for subculture again, and repeated 25 cycles. Meizai 18, which could be subcultured to the 25th generation, with fast mycelium germination speed, neat edges, few aerial mycelium, dense sclerotia and few pigments, was selected to complete the preliminary domestication work, and the strain was preserved in the Kunming Institute of Botany, Chinese Academy of Sciences (KUNCC) using 10% glycerol + distilled water preservation method.

[0037] S6. Conduct multiple-point and multiple-time fruiting screening tests on the strains that have completed preliminary domestication. The specific experimental process can be referred to ZL201710911452.9. Through the above domestication and breeding work, a strain of Morchella serrata was obtained, such as Figure 3 As shown in the figure, the strain of Morchella chinensis has the characteristics of long cap, short stem, strong fragrance, and strong mycelium resistance to foreign bacteria, achieving the purpose of domestication and breeding of excellent strains. The strain was named "Meizai 18".

[0038] Application Examples This application example uses the Qimei Morchella strain Meizai No. 18 provided in Example 1 to compare cultivation with the commercially available G10 (not carried into space), and examines indicators such as the number of primordia generated, the number of young mushrooms formed, the ratio of the cap and stipe length, the harvesting intensity and the yield of the test strain.

[0039] The cultivar formula used in this embodiment is: 53% high-quality wheat, 45% corn cobs, 2% slaked lime, with a moisture content of 55-63% and a pH of 7.

[0040] The formula of the nutrient bag used in this embodiment is: 33% high-quality wheat, 65% corn cobs, 2% slaked lime, with a water content of 55-63% and a pH of 7.

[0041] When comparing cultivation, the cultivation conditions of the two strains must be kept consistent, and they should be cultivated according to the following cultivation methods: S1. Before sowing, pre-treat the planting soil, deep plow and seal the shed to reduce bacteria and pests in the soil. When the soil temperature is below 18℃ for a week, start preparing for sowing. After pre-wetting the soil, add quicklime and plow it evenly. Use a soil pH meter to measure and record the pH value. Ridge the soil with a width of about 1-1.2 m, no limit on length, and a furrow width of about 20-40 cm as the standard; S2. When sowing, break up the fungus (0.5 kg / m2) and spread evenly on the surface of the soil and cover with 2-3 cm of loam; S3. 5-7 days after sowing, white fungus frost can be seen on the surface of the soil. 10 days after sowing, nutrient bags (8 bags / m2, each bag is about 500 g) are placed on the surface of the soil in a triangular shape. Two parallel incisions of about 3-5 cm are made on one side of the ground and buckled to the surface of the soil. Black mulch is covered for 40-60 days. When the fungus frost fades and a small amount of primordium is formed, and the soil temperature continues to rise to above 6℃, the mulch can be removed and watering can be started to promote mushroom growth. S4. During the mushroom production period, the temperature in the greenhouse was kept at about 15℃ and the air humidity was kept at 85%. The cultivation was carried out for 15-25 days until harvest. The cultivation conditions of Meizai No. 18 are as follows: Figure 4 shown.

[0042] The cultivation comparison results are shown in Table 1.

[0043] Table 1. Comparison results of cultivation of Morchella chinensis in Qimei variety Number of young mushrooms formed (pieces / square meter) Cap / Stipe Length Ratio Collection medium Yield (kg / mu) Meizai No.18 209 3 1 Tide 1200 G10 160 0.7 2 Tide 300 As can be seen from Table 1, compared with the cultivation of G10 strain without space flight, the number of young mushrooms formed by Meizai No. 18 strain is 209 per square meter, which is about 30% higher than that of G10. The yield reaches 1200kg per mu, which is four times that of G10. Figure 5 As shown, from the morphological point of view, the cap / stem length ratio of G10 is only 0.7, while the cap / stem length ratio of Meizai No. 18 reaches 3, which is a very significant change in morphology.

[0044] In summary, the present invention provides a strain of Morchella chinensis Meizai No. 18 and its application, wherein the Morchella chinensis Meizai No. 18 is subjected to spaceflight-induced genetic variation, and then the stable hereditary traits are screened out through subculture, and the strain is obtained through mushroom screening test. The mycelium adaptability, resistance, collection intensity and commercial mushroom quality are significantly improved, and the strain can be widely used in the cultivation and production of Morchella chinensis, which can greatly improve the per mu yield of Morchella chinensis chinensis, and has broad application prospects.

[0045] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. For those skilled in the art, the present invention may have various modifications and variations. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present invention shall be included in the protection scope of the present invention.

Claims

1. A strain of Morchella chinensis Meizai No. 18, characterized in that: The deposit number is CGMCC No. 41346. It was deposited at the General Microbiology Center of China Culture Collection Administration on June 27, 2024. The deposit address is No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing.

2. The Qimei Morchella strain Meizai No. 18 according to claim 1, characterized in that The Qimei Morchella strain Meizai No. 18 includes a specific DNA fragment with a size of about 484 bp, and the nucleotide sequence of the specific DNA fragment is as SEQ ID NO:

2.

3. The Qimei Morchella strain Meizai No. 18 according to claim 2, characterized in that: The specific DNA fragment is obtained by PCR amplification of the Morchella chinensis strain Meizai No. 18 using specific primers; the specific primers include Primer_1L and Primer_1R, and their nucleotide sequences are shown in SEQ ID NO: 3 and SEQ ID NO: 4, respectively.

4. The Qimei Morchella strain Meizai No. 18 according to claim 3, characterized in that The amplification system for PCR amplification using the specific primers is: PCR Buffer 1×, MgCl2 1.50 mM, dNTPs Mix 0.25 mM, 1.00 mM of each specific primer, rTaq Polymerase 1.5 U, template DNA 50 ng; The reaction conditions are: Pre-denaturation at 95°C for 3 min, followed by 35 cycles of 95°C for 60 s, 53°C for 40 s, and 72°C for 30 s; final extension at 72°C for 10 min.

5. An application of the Qimei Morchella strain Meizai No. 18 as described in any one of claims 1 to 3 in the cultivation and production of Morchella.

6. The use according to claim 5, characterized in that: The cultivation conditions of the Qimei Morel strain Meizai No. 18 are: soil temperature 10-15°C, air humidity 80%-95%, carbon dioxide concentration 400-1000ppm, and light intensity 300-3000Lux.

7. The use according to claim 6, characterized in that: The cultivation period of the Qimei Morchella strain Meizai No. 18 is 90 to 130 days.

8. The use according to claim 7, characterized in that: According to the percentage by weight, the nutrient package of the Qimei Morchella strain Meizai No. 18 comprises: Wheat kernels 33%~53%, corn cobs 45%~65%, slaked lime 2%.

9. The use according to claim 8, characterized in that: The water content of the nutrient pack is 55-63%, and the pH is 6.5-7.5.

Images