Application of glutathione reductase gene in improving aspergillus niger protein secretion

Abstract

The invention discloses an application of a glutathione reductase gene in improving aspergillus niger protein secretion, and relates to the technical field of gene engineering. According to the invention, by overexpressing a glutathione reductase gene (such as a glutathione reductase gene) or a related gene for providing energy for a glutathione system, ROS in aspergillus niger cells is reduced, and the increase of the total secreted protein amount can be observed through SDS-PAGE (Sodium Dodecyl Sulfate-Polyacrylamide Gel Electrophoresis). The obtained recombinant strain can produce amylase with high yield, such as glucamylase, the maximum enzyme activity of the glucamylase can be 3.43 times of wt through shake flask fermentation, the enzyme activity for expressing the glucamylase is enhanced, the expression quantity is remarkably improved, and meanwhile, the expression quantity of other proteins such as acidic amylase and neutral amylase is improved. The recombinant strain can be directly applied to the field of industrial fermentation, and a research thought is provided for wide application of aspergillus niger in the field of industrial enzyme preparations.

Description

Technical Field

[0001] The invention relates to the technical field of gene engineering, and in particular to the application of glutathione reductase gene in improving the secretion of Aspergillus niger protein. Background Art

[0002] Free radicals in organisms mainly refer to reactive oxygen species. The so-called reactive oxygen species refer to certain intermediate metabolites of oxygen or oxygen-containing derivatives that have stronger oxidizing power than oxygen. In fungi, the main types of reactive oxygen species (ROS) are: superoxide anion (O2 - ), hydrogen peroxide (H2O2), hydroxyl radicals (·OH), singlet oxygen (O2) and lipid peroxide free radicals (·ROO), etc. Under normal circumstances, when the level of reactive oxygen is low, it will not damage cells because the generation and removal of reactive oxygen in cells are in a dynamic equilibrium state. Once this balance is broken, it may cause damage.

[0003] Usually ROS is controlled by the glutaredoxin system and the thioredoxin system, and both of them use reduced coenzyme II (NADPH) as the reduced energy source. In the glutaredoxin system, electrons are transferred from NADPH to Glr1, i.e. glutathione reductase, through flavin adenine dinucleotide (FAD). Glr1 will reduce oxidized glutathione GSSG to generate glutathione GSH. GSH can act directly on ROS or on reduced glutaredoxin. Finally, glutaredoxin will reduce the disulfide bond substrate through its free sulfhydryl group. The thioredoxin system is similar to the glutaredoxin system, mainly composed of NADPH, TRX and thioredoxin reductase.

[0004] About 1 / 3 of the proteins in eukaryotic cells are secretory proteins and membrane proteins, and these proteins often require disulfide bonds to assist in completing the folding spatial structure. These proteins themselves are rich in disulfide bonds. The process of forming disulfide bonds in nascent peptide chains is called protein oxidative folding, and the misfolding of disulfide bonds requires the antioxidant system to repair. The protein folding process requires the participation of sulfhydryl oxidase Ero1 and protein disulfide isomerase PDI. PDI is responsible for catalyzing the formation of disulfide bonds in substrate proteins, while Ero1 is responsible for providing upstream oxidative power for PDI. This process consumes O2 and produces H2O2. Excessive hydrogen peroxide will force the activation of Yap1, the main transcription factor of oxidative stress, and enhance the ability to cope with oxidative stress.

[0005] Since ROS are continuously produced in the endoplasmic reticulum, their impact on protein folding and even cell survival is also very significant, so it is necessary to improve the antioxidant capacity. This is especially important for strains with high protein production. Summary of the invention

[0006] In order to overcome the shortcomings and deficiencies of the prior art, the purpose of the present invention is to provide an application of a glutathione reductase gene in improving the secretion of Aspergillus niger protein. The method provided by the present invention can enhance the protein secretion ability of Aspergillus niger and improve the enzymatic activity of secreted proteins for use in the field of industrial fermentation.

[0007] The purpose of the present invention is achieved through the following technical solutions:

[0008] Application of a glutathione reductase gene in improving the secretion of Aspergillus niger protein, wherein the application is achieved by overexpressing the glutathione reductase gene in Aspergillus niger.

[0009] The protein includes, but is not limited to, amylase, and further includes at least one of glucoamylase, neutral amylase and acid amylase.

[0010] The glutathione reductase gene is Glr1, specifically a glutathione reductase gene from fungi; the fungi are Aspergillus or yeast; further Aspergillus niger or Saccharomyces cerevisiae.

[0011] When the fungus is a fungus other than Aspergillus (specifically Aspergillus niger), in order to better achieve overexpression of the glutathione reductase gene in Aspergillus niger, the glutathione reductase gene may be subjected to Aspergillus niger codon optimization.

[0012] 1) wherein the amino acid sequence of the Glr1 gene has at least 70% amino acid identity when compared with the amino acid sequence selected from SEQ ID NO.1 [ScGlr1] or SEQ ID NO.2 [AnGlr1] based on the BLASTP alignment method;

[0013] 2) wherein the nucleotide sequence of the Glr1 gene has at least 70% nucleotide sequence identity when compared with a nucleotide sequence selected from SEQ ID NO.3 [ScGlr1] or SEQ ID NO.4 [AnGlr1] based on the BLASTN alignment method;

[0014] or,

[0015] 3) A complementary sequence to the nucleotide sequence of the Glr1 gene of 2) above, wherein the complementary sequence and the nucleotide sequence consist of the same number of nucleotides and are 100% complementary.

[0016] Preferably, the overexpression is performed by homologous recombination between FungiDB accession numbers An17g00730 and An17g00740 using CRISPR technology; further, the promoter used is the constitutive promoter Ptef, and the terminator is Ttef.

[0017] More preferably, the overexpression is performed by homologous recombination using CRISPR technology at 1001 to 1200 bp of SEQ ID NO. 5 [An17g_INSERT] between FungiDB accession numbers An17g00730 and An17g00740.

[0018] The specific steps of using the CRISPR technology are as follows:

[0019] (a) Designing sgRNA (509-604 bp of SEQ ID NO.7) according to the overexpression insertion site and constructing an overexpression vector containing the glutathione reductase gene;

[0020] (b) The coding frame of sgRNA, the promoter used is the U6 promoter of Aspergillus oryzae, and the terminator is the U6 terminator of Aspergillus oryzae. The U6 promoter of Aspergillus oryzae, the sgRNA of step (a), and the U6 terminator of Aspergillus oryzae are connected to obtain the coding frame of sgRNA, and then the coding frame of sgRNA is connected to the gene editing tool plasmid to obtain a recombinant plasmid with a cutting insertion site; the sequence of the coding frame of sgRNA is shown in SEQ ID NO.7.

[0021] Wherein, the gene editing tool plasmid carries the autonomous replication sequence AMA1, ampicillin resistance and Cas9 protein expression frame; preferably, the promoter and terminator used in the Cas9 protein expression frame are Ptef and Ttef respectively;

[0022] Furthermore, the gene editing tool plasmid is a pFC332 plasmid;

[0023] (c) transforming the recombinant plasmid of step (b) and the overexpression plasmid of step (a) into Aspergillus niger, and screening to obtain recombinant Aspergillus niger bacteria, wherein the recombinant Aspergillus niger bacteria can achieve overexpression of the corresponding gene (glutathione reductase gene).

[0024] After the gene is overexpressed, the protein secretion ability of Aspergillus niger is enhanced. These proteins include but are not limited to glucoamylase, neutral amylase, and acid amylase.

[0025] The Aspergillus niger is Aspergillus niger SH-1:ΔpyrG.

[0026] The screening tag is a pyrG screening tag, and further is an ANpyrG screening tag (ie, a pyrG screening tag derived from Aspergillus nidulans).

[0027] A high-protein secreting Aspergillus niger recombinant bacterium is disclosed. In Aspergillus niger, the above-mentioned glutathione reductase gene is overexpressed between FungiDB accession numbers An17g00730 and An17g00740 by homologous recombination using CRISPR technology; further, the promoter used for overexpressing the glutathione reductase gene is a constitutive promoter Ptef, and the terminator is Ttef; the high-protein secreting Aspergillus niger recombinant bacterium is obtained.

[0028] The method for constructing the above-mentioned high-protein secreting Aspergillus niger recombinant bacteria comprises the following steps:

[0029] (1) constructing an overexpression vector containing a glutathione reductase gene;

[0030] (2) Design sgRNA according to the overexpression insertion site;

[0031] (3) The coding frame of sgRNA, the promoter used is the U6 promoter of Aspergillus oryzae, the terminator is the U6 terminator of Aspergillus oryzae, the U6 promoter of Aspergillus oryzae, the sgRNA of step (2), and the U6 terminator of Aspergillus oryzae are connected to obtain the coding frame of sgRNA, and then the coding frame of sgRNA is connected to the gene editing tool plasmid to obtain a recombinant plasmid with a cutting insertion site;

[0032] Wherein, the gene editing tool plasmid carries the autonomous replication sequence AMA1, ampicillin resistance and Cas9 protein expression frame; preferably, the promoter and terminator used in the Cas9 protein expression frame are Ptef and Ttef respectively;

[0033] Furthermore, the gene editing tool plasmid is a pFC332 plasmid;

[0034] (4) The recombinant plasmid of step (3) and the overexpression vector of step (1) are co-transformed into Aspergillus niger, and a recombinant Aspergillus niger strain with high protein secretion is obtained by screening.

[0035] Preferably, in step (3), the coding frame of the sgRNA is connected to the restriction enzyme cutting site BglII of the gene editing tool plasmid.

[0036] In step (4), the Aspergillus niger is Aspergillus niger SH-1:ΔpyrG.

[0037] The tag used for the screening is a pyrG screening tag, and further is an ANpyrG screening tag (ie, a pyrG screening tag derived from Aspergillus nidulans).

[0038] The method for constructing an overexpression vector containing a glutathione reductase gene in step (1) comprises the following steps:

[0039] (I) Construction of a universal overexpression vector: Using the Aspergillus niger genome as a template, using primers 18T-17gmid-up-F / R and 18T-17gmid-down-F / R to amplify fragment 1 and fragment 3; using the Aspergillus nidulans genome as a template; using primers Up-EcoRV-pyrG-F / pyrG-down-R to amplify fragment 2; using a plasmid with promoter Ptef and terminator Ttef as a template, using primers Up-ptef-F / R and BglII-Ttef-F / Ttef-AnpyrG-R to amplify fragment 4 and fragment 5; ligating fragment 1, fragment 2, and fragment 3 to a cloning vector, then cutting them with the restriction enzyme cutting site EcoRV, and then ligating them with fragment 4 and fragment 5 to construct a universal overexpression vector; wherein 18T-17gmid-up-F / R is as shown in SEQ ID NO.11-12, and 18T-17gmid-down-F / R is as shown in SEQ ID NO. NO.15-16, Up-EcoRV-pyrG-F / pyrG-down-R as shown in SEQ ID NO.13-14, Up-ptef-F / R as shown in SEQ ID NO.17-18, BglII-Ttef-F / Ttef-AnpyrG-R as shown in SEQ ID NO.19-20;

[0040] (II) constructing an overexpression vector: inserting the glutathione reductase gene into the restriction enzyme cleavage site BglII of the overexpression universal vector in step (I) to construct an overexpression vector containing the glutathione reductase gene;

[0041] Preferably, the cloning vector in step (I) is a T vector, including but not limited to a pMD18T vector;

[0042] The application of the above-mentioned recombinant Aspergillus niger in the efficient fermentation production of secretory proteins.

[0043] The recombinant Aspergillus niger can reduce intracellular reactive oxygen species (ROS), increase the secretion of total protein, and increase the secretion of glucoamylase, acid amylase, and neutral amylase in amylase, wherein the secretion of glucoamylase is 3.43 times that of wt. After conventional transcriptome (RNA-Seq) analysis, the gene expression of glucoamylase is 5.67 times that of wt, the gene expression of acid amylase is 49.91 times that of wt, and the gene expression of neutral amylase is 1.63 times that of wt.

[0044] Preferably, the secretory protein includes but is not limited to amylase, and further includes at least one of glucoamylase, neutral amylase and acid amylase.

[0045] Compared with the prior art, the present invention has the following advantages and effects:

[0046] a. The present invention utilizes glutaredoxin system genes or related genes that provide energy for the glutaredoxin system, providing a practical basis for the regulatory mechanism of Aspergillus niger to resist ROS.

[0047] b. The present invention reduces ROS in Aspergillus niger cells by overexpressing glutaredoxin system genes (such as glutathione reductase genes) or related genes that provide energy for the glutaredoxin system, and an increase in the total amount of secreted protein can be observed by SDS-PAGE.

[0048] c. The recombinant strain obtained by the present invention can produce high-yield amylase, such as glucoamylase. Through shake flask fermentation, the enzyme activity of glucoamylase can be up to 3.43 times that of wt, so that the recombinant strain can be directly applied to the field of industrial fermentation.

[0049] d. The enzymatic activity of glucoamylase expressed by the recombinant Aspergillus niger strain obtained by the present invention is enhanced, and the expression level is significantly improved. At the same time, the expression levels of other proteins such as acid amylase and neutral amylase are also improved, which provides a research idea for the wide application of Aspergillus niger in the field of industrial enzyme preparations. BRIEF DESCRIPTION OF THE DRAWINGS

[0050] Figure 1 It is a map of the overexpression plasmid 17g-Glr1 which overexpresses Glr1.

[0051] Figure 2 During the shake flask fermentation of overexpressed Aspergillus niger, the bacterial liquid was taken on the second day and the active oxygen level was measured by the active oxygen kit.

[0052] Figure 3 It is a comparison of the total protein amount of the wild type (Wild Type, wt) and the overexpression recombinant strain (OEglrl) on the 7th day of shake flask fermentation (detected by BCA kit).

[0053] Figure 4 Comparison of glucoamylase activity between wt and OEglr1 on day 7 of shake flask fermentation.

[0054] Figure 5 It is the SDS-PAGE electrophoresis diagram of the mutant on the 7th day of shake flask fermentation; wherein, wt1 and wt2 represent two parallel samples of wt, and glr11 and glr12 represent two parallel samples of OEglrl. DETAILED DESCRIPTION

[0055] The present invention is further described in detail below in conjunction with embodiments and drawings, but the embodiments of the present invention are not limited thereto.

[0056] If no specific experimental conditions are specified in the following embodiments, conventional experimental conditions or experimental conditions recommended by the reagent company are generally followed. The materials and reagents used, unless otherwise specified, are all reagents and materials obtained from commercial sources.

[0057] The strains, raw materials, reagents and instruments involved in the present invention are: Aspergillus niger SH-1 is disclosed in the document "Jin Shen. Construction and screening of Aspergillus niger SH-1 high-efficiency CALB lipase [D]. South China University of Technology." and is a material preserved in this laboratory; the chemical reagents and drugs involved in the present invention are: snail enzyme, cellulase (Beijing Dingguo Changsheng Biotechnology Co., Ltd.), peptone, yeast powder (UK OXOID Company), polyethylene glycol (PEG4000), Tris-base, sorbitol, anhydrous calcium chloride, ampicillin, lysozyme (Sigma Company, USA), agarose, restriction endonuclease, Dream TaqGreen PCR Master Mix (Thermo Fisher Company, USA), PrimerStar HSDNApolymerase, DNALigation Kit, DNA marker, FastAP dephosphorylation kit, RNAiso plus, 6×Loadingbuffer, RNase free water, RNase inhibitor, SYBR Premix EX TaqTM (TaKaRa, Japan), GelRed nucleic acid dye (Biotum, USA), Miracloth filter cloth (Merck, Germany), PCR product purification kit, plasmid large-scale extraction kit (Guangzhou Jiebeisi), Infusion kit (NEBuilder HiFi DNA Assembly Cloning Kit), restriction endonuclease (NEB, USA), other chemical reagents and drugs are domestic or imported analytical grade or above; the main instruments and equipment involved in the present invention: NanoDrop1000 biological spectrophotometer (Thermo Fisher, USA), high pressure sterilizer (MLS-3750, SANYO, Japan), DNA gel electrophoresis instrument (Bio-Rad, USA), DNA gel imager (CareStream, USA) Health Company), mold incubator (SHP-450D, Shanghai Senxin Experimental Instrument Co., Ltd.), constant temperature air bath shaker (Suzhou Peiying Experimental Instrument Co., Ltd.), small desktop centrifuge (Eppendorf, Germany), clean bench (SW-CJ-1FD, Suzhou Purification Co., Ltd.), IMS-20 ice machine (Guangzhou Shenhua Biotechnology Co., Ltd.), ultrapure water meter (Shanghai Lingde Instrument Co., Ltd.), electric tissue grinder (Beijing Tiangen Biochemical Technology Co., Ltd.), high-precision balance (Sartorius, Germany), vortex oscillator (SCILOGEX, USA), ultrasonic cleaner (Ningbo Xinzhi Instrument Co., Ltd.), vacuum pump (DOA-P70-BN, PALL, USA).

[0058] The pFC332 plasmid used in the example is disclosed in the document “CN115851804A, A base editing system of Aspergillus niger and its construction method and application”;

[0059] The pFC330-3 (PAoU6-pepBsgRNA-TU6) plasmid is disclosed in the document “Li, K.; Zheng, J.; Yu, L.; Wang, B.; Pan, L. Exploration of the Strategy for Improving the Expression of Heterologous Sweet Protein Monellin in Aspergillus niger. J. Fungi 2023, 9, 528. https: / / doi.org / 10.3390 / jof9050528”.

[0060] Example 1

[0061] The present invention is further described below in conjunction with examples, but the embodiments of the present invention are not limited to this method.

[0062] The construction of overexpression plasmid and recombinant plasmid with cutting activity includes the following steps:

[0063] (1) Obtaining gene sequences. The gene sequence to be edited is found based on the analysis, and the gene library is NCBI or FungiDB. For example, the sequence of the Glr1 gene from Aspergillus niger (ID: An03g03660) is found through the FungiDB gene library, and the sequence between An17g00730 and An17g00740 is obtained through the FungiDB gene library, which is recorded as An17g_INSERT, and the sequence is shown in SEQ ID NO.5.

[0064] (2) Design of spacer RNA. The online design platform: http: / / www.rgenome.net / cas-designer / was used. The spacer RNA selected was ACGTAAGCAAAACAAATTCG. See Table 1.

[0065] Table 1 Spacer RNA nucleic acid sequence

[0066]

[0067] (3) Construction of universal overexpression vector and overexpression plasmid The DNA fragments in this specification were PCR amplified using PrimeSTAR Max DNA Polymerase, and the PCR amplification system used and the primers used for the construction of universal overexpression vector are shown in Tables 2 and 3.

[0068] Table 2 PCR reaction system

[0069]

[0070] Table 3 PCR primer sequences for constructing universal overexpression vector

[0071]

[0072] The basic vector of all amplified plasmids used in this example is pMD18T (Takara), and each recovered fragment is added according to the system in Table 2. All vector construction ligases in this example are 5×In-Fusion BHD Enzyme Premix, and the amount is 5 μL. The amount of added fragments is calculated according to the instruction manual, and double distilled water is added to make up to 10 μL. After incubating the ligation reaction system at 50°C for 25 minutes, it can be used for transformation of Escherichia coli.

[0073] Select E. coli Machl-T1 competent cells as the host strain for plasmid transformation. Add 10 μL of the ligation system to 100 μL of E. coli competent cells, place on ice for 30 minutes, then heat shock in a 42°C water bath for 90 seconds and incubate on ice for 2 minutes. Add 450 μL of liquid antibiotic-free LB medium to the centrifuge tube, resuscitate at 37°C and 220 rpm for 60 minutes, and remove 600 μL of supernatant by centrifugation. After reselection and mixing, take 100 μL of bacterial solution to a solid LB plate containing ampicillin, spread it evenly with a coating rod, and culture the plate in a 37°C incubator for 12 to 16 hours.

[0074] Table 4 in-Fusion vector construction connection system

[0075]

[0076] The DNA fragments were amplified in sequence according to the forward primer and the reverse primer, and after the fragments were recovered, they were connected using In-Fusion (Table 4). In this embodiment, three fragments (fragment 1, fragment 2, fragment 3) were amplified by the first three pairs of primers in Table 3 (18T-17gmid-up-F / R, Up-EcoRV-pyrG-F / pyrG-down-R, 18T-17gmid-down-F / R), and then connected using the restriction enzyme site EcoRV, and then the two fragments amplified by the last two pairs of primers in Table 3 (Up-ptef-F / R, Bglll-Ttef-F / Ttef-AnpyrG-R) were connected with this as a vector to form a universal overexpression vector. Among them, the sequence of fragment 1 is shown as 1st to 1000bp of SEQ ID NO.5; the sequence of fragment 2 is shown as SEQ ID NO.6 (1-476bp: promoter; 477-1360bp: ANpyrG, of which 634-692bp: intron; 1361-1398bp: terminator); the sequence of fragment 3 is shown as 1201-2200bp of SEQ ID NO.5; the fragment sequence amplified by Up-ptef-F / R is shown as SEQ ID NO.8; the fragment sequence amplified by Bglll-Ttef-F / Ttef-AnpyrG-R is shown as SEQ ID NO.9.

[0077] The universal overexpression vector was then cut using the restriction enzyme site BglII, and then ligated with the fragment containing the overexpression gene amplified by the primers in Table 5 (Ptef-Glr1-F / R) (sequence shown in SEQ ID NO.4) to construct an overexpression plasmid named 17g-Glr1 ( Figure 1 ); The primers used are shown in Table 5.

[0078] Table 5 Primer sequences for constructing overexpression vector

[0079]

[0080] (4) Construction of a recombinant plasmid with cleavage activity:

[0081] (a) Designing sgRNA according to the site to be inserted (assembled in sequence from the spacer RNA and sgRNA backbone of step (2), as shown in 509-604 bp of SEQ ID NO.7), connecting the two fragments amplified by the two pairs of primers in Table 6 with the sgRNA to obtain the coding frame of sgRNA (composed of the U6 promoter of Aspergillus oryzae, spacer RNA, sgRNA backbone, and U6 terminator of Aspergillus oryzae, as shown in SEQ ID NO.7; wherein, 1-508 bp is the U6 promoter of Aspergillus oryzae, 509-528 bp is the spacer RNA, 529-604 bp is the sgRNA backbone, and 605-742 bp is the U6 terminator of Aspergillus oryzae).

[0082] (b) The pFC332 plasmid was extracted and cut with the restriction enzyme site BglII, and then the coding frame of the sgRNA obtained in step (a) was connected to construct a recombinant plasmid with cutting activity; the primers used are shown in Table 6.

[0083] Table 6 Construction of PCR primer sequences for recombinant plasmids with cleavage activity

[0084]

[0085] (5) The overexpression plasmid constructed in this example was transformed by Aspergillus niger. The culture medium and steps used were as follows:

[0086] Hypertonic CD medium: 342.3 g / L sucrose, 2 g / L potassium chloride, 1 g / L potassium dihydrogen phosphate, 3 g / L sodium nitrate, 0.5 g / L magnesium sulfate heptahydrate, 0.01 g / L ferrous sulfate heptahydrate.

[0087] Ordinary CD culture medium: 20 g / L anhydrous glucose, 2 g / L potassium chloride, 1 g / L potassium dihydrogen phosphate, 3 g / L sodium nitrate, 0.5 g / L magnesium sulfate heptahydrate, 0.01 g / L ferrous sulfate heptahydrate.

[0088] DPY medium: 20 g / L anhydrous glucose, 5 g / L yeast powder, 10 g / L peptone, 10 g / L sodium chloride.

[0089] Shake flask fermentation medium: 70g / L maltose monohydrate, 25g / L peptone, 12.5g / L yeast powder, 2g / L potassium sulfate, 1g / L potassium dihydrogen phosphate, 0.5g / L magnesium sulfate heptahydrate, 0.03g / L zinc chloride, 0.02g / L calcium chloride, 0.009g / L manganese sulfate monohydrate, 0.3g / L ferrous sulfate heptahydrate.

[0090] STC solution: 10 mM Tris-HCl, 1.2 M sorbitol, 50 mM calcium chloride, pH 7.5, first make up to volume and then adjust pH, sterilize by filtration through a 0.22 μm membrane.

[0091] PEG solution: 60% (w:v) PEG4000, 50mM calcium chloride, 10mM Tris-HCl, pH 7.5, first make up to volume and then adjust pH, sterilize at high temperature and high pressure.

[0092] The steps for Aspergillus transformation are as follows:

[0093] 1. Take 3 mL of the starting strain Aspergillus niger SH-1: ΔpyrG (a pyrG-deficient strain obtained by knocking out the pyrG gene of Aspergillus niger SH-1, named Aspergillus niger SH-1: ΔpyrG; the method of knocking out the pyrG gene refers to the document "CN106480036A, a DNA fragment with promoter function and its application") from the ordinary liquid CD medium and inoculate it into the DPY medium, and culture it at 30°C and 220rpm for three days. Use a Buchner funnel to obtain mycelium by suction filtration, wash the mycelium twice with sterile water, and then wash it twice with 0.8M sodium chloride, and weigh it.

[0094] 2. Use the PEG-mediated protoplast method to transform Aspergillus niger. Transfer the filtered mycelium to the protoplast hydrolysate, the system of which is 1% (w:v) cellulase, 1% (w:v) snail enzyme, 0.5% (w:v) lytic enzyme, 1× sodium phosphate buffer, 0.8M sodium chloride. Add 1g of mycelium to 20mL of hydrolysate, and hydrolyze at 100rpm in a 30℃ water bath shaker. After the hydrolysis, filter and collect the protoplasts with 4 layers of Milipore super cloth, and then rinse the bottle of the hydrolysate and the Milipore super cloth with 20mL of 0.8M sodium chloride. Centrifuge the protoplasts at 900g for 10min at 4℃, and discard the supernatant. Add 5mL of STC buffer to resuspend the protoplasts, and after uniform dispersion, add 25mL of STC solution to resuspend, and collect the protoplasts at 900g for 10min at 4℃, and repeat this step once. The protoplasts were resuspended with 800 μL of STC solution to obtain a protoplast suspension for subsequent transformation.

[0095] 3. Take 60 μL of PEG solution, 160 μL of protoplast suspension and 100 μL of plasmid (70 μL of overexpression plasmid 17g-Glr1 obtained in step (3), 30 μL of recombinant plasmid with cleavage activity obtained in step (4), incubate on ice for 30 min, then add 1.5 mL of PEG solution and incubate at room temperature for 25 min. During this period, pour the lower plate, i.e., hypertonic CD medium (containing 2% agar). Finally, pour the above transformation mixture into a 15 mL sterile centrifuge tube containing 6 mL of soft agar hypertonic CD medium (containing 0.65% agar) at 30-45°C and 3 mL of STC solution, and mix them upside down. Finally, pour the mixture (upper plate, containing 0.65% hypertonic CD medium) evenly on the sucrose CD hypertonic solid medium (lower plate, containing 2% hypertonic CD medium), and culture at 30°C.

[0096] 4. Selection and verification of transformants. After 5 days of culture, the upper culture medium (containing 0.65% hypertonic CD culture medium) will solidify. Select the transformants that emerge from the transformation plate to a new ordinary CD culture medium (containing 2% agar), and culture them in a 30°C incubator for 3 days. Since the host has been knocked out of the pyrG gene, the bacteria will only grow when the strain is supplemented with the pyrG gene or other nutrients. Positive transformants can be obtained by using pyrG as a screening label. Select hyphae to extract DNA, and perform PCR verification and sequencing analysis to obtain positive transformants.

[0097] Refer to the above transformation method, except that: 100 μL of plasmid includes 70 μL of the universal overexpression vector obtained in step (3) and 30 μL of the recombinant plasmid with cutting activity obtained in step (4); the strain obtained after transformation is recorded as wt.

[0098] 5. Use the enzyme reaction kit of Jiebeis to assist in extracting the transformant genome and identify whether it is located on the target fragment. Using the transformant genome as a template, use primer identification-up-F / R to detect the upstream fragment of the Glr1 gene expression frame, use primer identification-down-F / R to detect the downstream fragment of the Glr1 gene expression frame, and use primer identification-internal-F / R to detect the Glr1 gene expression frame; only when the upstream and downstream and Glr1 gene expression frames are detected, the transformant is considered to have successfully transformed the Glr1 gene expression frame. The successfully identified overexpression recombinant strain is recorded as OEglrl. The identification primers are shown in Table 7.

[0099] Table 7 Primer sequences for identifying transformants

[0100] Primer name Primer sequence 5'→3' Identify-up-F CGTCTCGTCTAAGAATAGCTAG Identify-up-R gaaagaaggatggaggagaga Identification-Internal-F tctctcctccatccttctttc Identification-Internal-R gtccaggtcatgtaatatcacg Identify-down-F cgtgatattacatgacctggac Identify-down-R AGACCGAGCCTTGAGTGGG

[0101] 6. After obtaining the correct transformant, pick it to liquid ordinary CD medium (add 0.05% agar to ordinary CD medium) and culture for 10 days before transferring to shake flask fermentation medium. On the second day of transfer, collect the bacteria to obtain the bacteria for detecting intracellular reactive oxygen (ROS) (Solebo Reactive Oxygen Detection Kit). After 7 days of culture, collect the fermentation broth and centrifuge it at 10000rpm for 10 minutes to obtain the supernatant fermentation broth for detecting the activity of saccharifying enzyme (glucoamylase glaA) (NPG method for measuring saccharifying enzyme), total protein (Jiebes BCA method for measuring total protein kit) and SDS-PAGE electrophoresis. And after the general transcriptome (RNA-Seq) analysis was performed at Sangon Biotech Co., Ltd., the gene expression of glucoamylase was 5.67 times that of wt, the gene expression of acid amylase was 49.91 times that of wt, and the gene expression of neutral amylase was 1.63 times that of wt.

[0102] The ROS data graph, total protein, saccharifying enzyme activity and SDS graph of this example are shown in Figures 1 and 2. Figure 2 , as shown in 3, 4, and 5.

[0103] Therefore, the overexpression of the glutaredoxin system gene and the gene functioning therein of this example can act in Aspergillus niger and can reduce ROS (reduced by 17.2%, Figure 2 ), which increased the total protein secretion (increased by 21.9%, Figure 3 ), and also increased the secretion of glucoamylase, acid amylase, and neutral amylase in amylase ( Figure 5 ), among which, the secretion of glucoamylase was about 3.43 times that of wt ( Figure 4 ).

[0104] The above embodiments are preferred implementation modes of the present invention, but the implementation modes of the present invention are not limited to the above embodiments. Any other changes, modifications, substitutions, combinations, and simplifications that do not deviate from the spirit and principles of the present invention should be equivalent replacement methods and are included in the protection scope of the present invention.

Claims

1. Application of glutathione reductase gene in improving protein secretion of Aspergillus niger, characterized in that: The application is achieved by overexpressing the glutathione reductase gene in Aspergillus niger; The glutathione reductase gene is a glutathione reductase gene derived from fungi.

2. The use according to claim 1, characterized in that: The protein includes, but is not limited to, amylase, and further includes at least one of glucoamylase, neutral amylase and acid amylase.

3. The use according to claim 1 or 2, characterized in that: Based on the BLASTP alignment method, the amino acid sequence of the glutathione reductase gene has at least 70% amino acid identity when compared with the amino acid sequence selected from SEQ ID NO.1 [ScGlr1] or SEQ ID NO.2 [AnGlr1].

4. The use according to claim 3, characterized in that: 1) Based on the BLASTN alignment method, the nucleotide sequence of the glutathione reductase gene has at least 70% nucleotide sequence identity when compared with the nucleotide sequence selected from SEQ ID NO.3 [ScGlr1] or SEQ ID NO.4 [AnGlr1]; or, 2) A complementary sequence to the nucleotide sequence of the glutathione reductase gene of 1) above, wherein the complementary sequence and the nucleotide sequence consist of the same number of nucleotides and are 100% complementary.

5. The use according to claim 1 or 2, characterized in that: The overexpression is performed by homologous recombination between FungiDB accession numbers An17g00730 and An17g00740 using CRISPR technology; further, the promoter used is the constitutive promoter Ptef, and the terminator is Ttef; Furthermore, the overexpression is performed by homologous recombination using CRISPR technology at 1001 to 1200 bp of SEQ ID NO. 5 [An17g_INSERT] between FungiDB accession numbers An17g00730 and An17g00740.

6. A recombinant Aspergillus niger with high protein secretion, characterized in that: In Aspergillus niger, the glutathione reductase gene according to any one of claims 1 to 5 is overexpressed between FungiDB accession numbers An17g00730 and An17g00740 by homologous recombination using CRISPR technology; and a recombinant Aspergillus niger with high protein secretion is obtained.

7. The method for constructing a recombinant Aspergillus niger bacteria with high protein secretion according to claim 6, characterized in that: The steps include: (1) constructing an overexpression vector containing the glutathione reductase gene according to any one of claims 1 to 5; (2) Designing sgRNA according to the overexpression insertion site; the sequence of the sgRNA is shown in 509-604 bp of SEQ ID NO.7; (3) The coding frame of sgRNA, the promoter used is the U6 promoter of Aspergillus oryzae, the terminator is the U6 terminator of Aspergillus oryzae, the U6 promoter of Aspergillus oryzae, the sgRNA of step (2), and the U6 terminator of Aspergillus oryzae are connected to obtain the coding frame of sgRNA, and then the coding frame of sgRNA is connected to the gene editing tool plasmid to obtain a recombinant plasmid with a cutting insertion site; the sequence of the coding frame of sgRNA is shown in SEQ ID NO.7; (4) The recombinant plasmid of step (3) and the overexpression vector of step (1) are co-transformed into Aspergillus niger, and a recombinant Aspergillus niger strain with high protein secretion is obtained by screening.

8. The construction method according to claim 7, characterized in that: In step (3), the gene editing tool plasmid contains the autonomous replication sequence AMA1, ampicillin resistance and Cas9 protein expression frame; In step (3), the coding frame of the sgRNA is connected to the restriction enzyme cutting site BglII of the gene editing tool plasmid; In step (4), the Aspergillus niger is Aspergillus niger SH-1: ΔpyrG; The label used for the screening is the pyrG screening label; The method for constructing the overexpression vector containing the glutathione reductase gene in step (1) comprises the following steps: (I) Construction of a universal overexpression vector: Using the Aspergillus niger genome as a template, using primers 18T-17gmid-up-F / R and 18T-17gmid-down-F / R to amplify fragment 1 and fragment 3; using the Aspergillus nidulans genome as a template; using primers Up-EcoRV-pyrG-F / pyrG-down-R to amplify fragment 2; using a plasmid with promoter Ptef and terminator Ttef as a template, using primers Up-ptef-F / R and BglII-Ttef-F / Ttef-AnpyrG-R to amplify fragment 4 and fragment 5; ligating fragment 1, fragment 2, and fragment 3 to a cloning vector, then cutting them with the restriction enzyme cutting site EcoRV, and then ligating them with fragment 4 and fragment 5 to construct a universal overexpression vector; wherein 18T-17gmid-up-F / R is as shown in SEQ ID NO.11-12, and 18T-17gmid-down-F / R is as shown in SEQ ID NO. NO.15-16, Up-EcoRV-pyrG-F / pyrG-down-R as shown in SEQ ID NO.13-14, Up-ptef-F / R as shown in SEQ ID NO.17-18, BglII-Ttef-F / Ttef-AnpyrG-R as shown in SEQ ID NO.19-20; (II) Construction of an overexpression vector: Insert the glutathione reductase gene into the restriction enzyme cleavage site BglII of the universal overexpression vector in step (I) to construct an overexpression vector containing the glutathione reductase gene.

9. Use of the recombinant Aspergillus niger according to claim 6 in the efficient fermentation production of secretory proteins.

10. The use according to claim 9, characterized in that: The secretory proteins include, but are not limited to, amylases, and further include at least one of glucoamylases, neutral amylases, and acid amylases.

Images