Method for improving production of amino acid by microorganisms

Abstract

The invention relates to the technical field of bioengineering, in particular to a method for improving amino acid production of microorganisms. The invention finds that the thioesterase family protein with the amino acid sequence shown as SEQ ID NO.4 has obvious correlation with the yield of lysine, and finds that the thioesterase family protein mutant containing a specific mutation site can obviously promote microbial synthesis and accumulate lysine. The thioesterase family protein mutant provided by the invention is introduced into a microorganism, so that the lysine yield of the microorganism is remarkably improved, and the thioesterase family protein mutant has important significance in improving the fermentation production performance of the microorganism and reducing the production cost of lysine.

Description

Technical Field

[0001] The invention relates to the technical field of bioengineering, and in particular to a method for improving the production of amino acids by microorganisms. Background Art

[0002] Lysine is one of the essential amino acids for animals and is widely used in feed, food, medicine and other fields. The demand is particularly high in the feed field. Therefore, increasing the production of lysine is of great significance.

[0003] At present, Corynebacterium glutamicum is the most commonly used production bacterium of lysine produced by microbial fermentation. The history of Corynebacterium glutamicum for producing amino acids can be traced back to the 1960s. With the rapid development of metabolic engineering technology and genome sequencing technology, the metabolic pathway research of Corynebacterium glutamicum is becoming more and more clear. The efficient production of amino acids can be achieved by many approaches, such as removing the feedback inhibition of products, strengthening the key enzymes of terminal synthetic pathways, improving the efficiency of product transport, enhancing the uptake rate of substrates, enhancing the supply of cofactors, optimizing the carbon flow distribution of central metabolism, blocking the competition branch and carrying out global regulation etc. However, bacteria is a very complex cell metabolism factory, except for the above rational judgment target, there are still many unknown genes or proteins that directly or indirectly affect the production efficiency of amino acids. For further improving the lysine yield of microorganisms, it is still necessary to develop new proteins or genes that can promote lysine production. Summary of the invention

[0004] The invention provides a method for improving the production of amino acids by microorganisms.

[0005] The present invention unexpectedly discovered during the research on the production of lysine by microbial fermentation that there is a significant correlation between the thioesterase family protein with an amino acid sequence such as SEQ ID NO.4 and the yield of lysine, and found that the thioesterase family protein mutant containing a specific mutation site can significantly promote the synthesis and accumulation of lysine by microorganisms, thereby significantly increasing the yield of lysine. For the thioesterase family protein with an amino acid sequence such as SEQ ID NO.4, there is currently no report on the effect of the protein or its mutant on lysine production.

[0006] Based on the above findings, the present invention provides the following technical solutions:

[0007] In the first aspect, the present invention provides a thioesterase family protein mutant or its encoding gene or a biological material containing the encoding gene for use in constructing a microorganism for producing lysine or its derivatives, wherein the thioesterase family protein mutant contains a mutation in which valine at position 23 is mutated to alanine, glycine or threonine compared to the thioesterase family protein with an amino acid sequence as shown in SEQ ID NO.4.

[0008] In a second aspect, the present invention provides a thioesterase family protein mutant or its encoding gene or a biological material containing the encoding gene for use in microbial fermentation to produce lysine or its derivatives. The thioesterase family protein mutant contains a mutation in which valine at position 23 is mutated to alanine, glycine or threonine compared to the thioesterase family protein with an amino acid sequence such as that shown in SEQ ID NO.4.

[0009] In a third aspect, the present invention provides a thioesterase family protein mutant or its encoding gene or a biological material containing the encoding gene for use in improving the yield of lysine or its derivatives produced by microorganisms. The thioesterase family protein mutant contains a mutation in which valine at position 23 is mutated to alanine, glycine or threonine compared to the thioesterase family protein with an amino acid sequence as shown in SEQ ID NO.4.

[0010] The thioesterase family protein with the amino acid sequence shown in SEQ ID NO.4 is derived from Corynebacterium glutamicum, and its NCBI reference sequence number is NCgl0686. The nucleotide sequence of the encoding gene is shown in SEQ ID NO.5.

[0011] Preferably, in the above application, the amino acid sequence of the thioesterase family protein mutant is shown in any one of SEQ ID NO. 1 to 3. The present invention has proved through experiments that the thioesterase family protein mutants with amino acid sequences as shown in SEQ ID NO. 1 to 3 can significantly increase the yield of lysine produced by microorganisms, and have a significant promoting effect on improving the lysine production efficiency of microorganisms.

[0012] In the above application, for the coding gene of the thioesterase family protein mutant, according to the amino acid sequence and codon rules of the thioesterase family protein mutant provided above, a person skilled in the art can obtain the nucleotide sequence of the coding gene of the thioesterase family protein mutant.

[0013] In the above applications, the biological material includes an expression cassette, a vector or a host cell.

[0014] Wherein, the expression cassette is a recombinant nucleic acid molecule obtained by operably linking the coding gene with transcription and / or translation regulatory elements.

[0015] The vector includes but is not limited to a plasmid vector, a viral vector, and a transposon.

[0016] The host cell is any cell capable of carrying the encoding gene or expressing the thioesterase family protein mutant, including microbial cells, preferably bacteria of the genus Corynebacterium (such as Corynebacterium glutamicum), Enterobacteriaceae (such as Escherichia coli) or bacteria of the genus Bacillus (such as Bacillus subtilis).

[0017] In the above application, the microorganism is preferably a bacterium of the genus Corynebacterium.

[0018] More preferably, the Corynebacterium bacterium is Corynebacterium glutamicum.

[0019] In a fourth aspect, the present invention provides a method for increasing the yield of lysine or its derivatives produced by a microorganism, the method comprising: modifying the microorganism so that it expresses a thioesterase family protein mutant, the thioesterase family protein mutant containing a mutation in which valine at position 23 is mutated to alanine, glycine or threonine compared to the thioesterase family protein with an amino acid sequence as shown in SEQ ID NO.4.

[0020] Preferably, the amino acid sequence of the thioesterase family protein mutant is shown in any one of SEQ ID NOs. 1 to 3.

[0021] Preferably, the method for increasing the production of lysine or its derivatives by a microorganism comprises: mutating the original thioesterase family protein gene in the microorganism genome so that it encodes a thioesterase family protein mutant; the amino acid sequence of the original thioesterase family protein in the microorganism genome is shown in SEQ ID NO.4.

[0022] Preferably, in the above method, the microorganism is a bacterium of the genus Corynebacterium.

[0023] More preferably, the Corynebacterium bacterium is Corynebacterium glutamicum.

[0024] In a fifth aspect, the present invention provides a lysine-producing microorganism, wherein the lysine-producing microorganism expresses a thioesterase family protein mutant, wherein the thioesterase family protein mutant contains a mutation in which valine at position 23 is mutated to alanine, glycine or threonine compared to the thioesterase family protein with an amino acid sequence as shown in SEQ ID NO.4.

[0025] Preferably, the lysine-producing microorganism expresses a thioesterase family protein mutant having an amino acid sequence as shown in any one of SEQ ID NOs. 1 to 3.

[0026] Preferably, the lysine-producing microorganism does not express a thioesterase family protein having an amino acid sequence as shown in SEQ ID NO.4.

[0027] Preferably, the microorganism is a bacterium of the genus Corynebacterium, more preferably Corynebacterium glutamicum.

[0028] The above-mentioned lysine-producing microorganism can be constructed by the following method: using a microorganism capable of synthesizing lysine as a starting strain, mutating the thioesterase family protein gene of the amino acid sequence in the genome of the starting strain as shown in SEQ ID NO.4, so that it encodes the thioesterase family protein mutant.

[0029] In some embodiments of the present invention, the starting strain is a wild-type Corynebacterium glutamicum, including but not limited to Corynebacterium glutamicum model bacteria ATCC 13032. The genetic information of Corynebacterium glutamicum ATCC 13032 has been published in GenBank and can be queried at the following website: https: / / www.ncbi.nlm.nih.gov / nuccore / NC_003450.3.

[0030] In some embodiments of the present invention, the starting strain is Corynebacterium glutamicum CGMCC No.11942, which is a lysine-producing bacterium and was deposited in the General Microbiological Center of China Culture Collection Committee on December 25, 2015, at the Institute of Microbiology, Chinese Academy of Sciences, No. 3, Yard No. 1, Beichen West Road, Chaoyang District, Beijing. The classification name is: Corynebacterium glutamicum, which has been disclosed in patent CN105734004B.

[0031] In some embodiments of the present invention, the starting strain is Corynebacterium glutamicum CGMCC No.13407, which is a lysine-producing bacterium and was deposited in the General Microbiological Center of China Culture Collection Committee on November 30, 2016, at the Institute of Microbiology, Chinese Academy of Sciences, No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing, and is classified and named as Corynebacterium glutamicum. The strain has been disclosed in patent application CN106635944A.

[0032] The present invention respectively uses Corynebacterium glutamicum (wild-type strain, lysine production bacteria modified by genetic engineering) of different genetic backgrounds as starting strains to carry out functional verification of the thioesterase family protein mutant. It has been verified that after expressing the thioesterase family protein mutant in these starting strains, the lysine production of the strain is significantly improved. It can be seen that the thioesterase family protein mutant of the present invention does not depend on other genetic modifications contained in the above-mentioned strains for the improvement of the lysine production capacity of the strain, and these genetic modifications are only to make the strain have a certain lysine production capacity. Therefore, the thioesterase family protein mutant has universality for the improvement of the lysine production capacity of Corynebacterium glutamicum for the starting strain that can synthesize and accumulate lysine. Thus, it can be understood by those skilled in the art that the thioesterase family protein mutant is introduced into any Corynebacterium glutamicum and can effectively promote the production improvement of lysine.

[0033] In a sixth aspect, the present invention provides a thioesterase family protein mutant, wherein the thioesterase family protein mutant contains a mutation in which valine at position 23 is mutated to glycine or threonine compared to the thioesterase family protein with an amino acid sequence as shown in SEQ ID NO.4.

[0034] Preferably, the amino acid sequence of the thioesterase family protein mutant is shown in SEQ ID NO.2 or SEQ ID NO.3.

[0035] The beneficial effects of the present invention include at least: the present invention found that there is a significant correlation between the thioesterase family protein with an amino acid sequence such as SEQ ID NO.4 and the yield of lysine, and found that the thioesterase family protein mutant containing a specific mutation site can significantly promote the synthesis and accumulation of lysine by microorganisms. When the thioesterase family protein mutant provided by the present invention is introduced into a microorganism, the lysine yield of the microorganism is significantly improved, which is of great significance for improving the fermentation production performance of the microorganism and reducing the production cost of lysine. DETAILED DESCRIPTION

[0036] In order to make the purpose, technical solution and advantages of the present invention clearer, the technical solution of the present invention will be described clearly and completely below. Obviously, the described embodiments are part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0037] The primer sequence information used in the following examples is shown in Table 1.

[0038] Table 1 Primer sequence information

[0039] Primer Name Sequence (5’-3’) 0686-1f ccaaagttgttgatggtcaagtcac 0686-V23A-1r catcatcgcgccacgcaccgctggaatgct 0686-V23A-2f agcattccagcggtgcgtggcgcgatgatg 0686-2r actctgccaaaggctcagaatcttc 0686-V23G-1r catcatcgcgccacccaccgctggaatgct 0686-V23G-2f agcattccagcggtgggtggcgcgatgatg 0686-V23T-1r catcatcgcgccacgtaccgctggaatgct 0686-V23T-2f agcattccagcggtacgtggcgcgatgatg

[0040] If no specific techniques or conditions are specified in the following examples, the techniques or conditions described in the literature in the field or the product instructions are used. If no manufacturer is specified for the reagents or instruments used, they are all conventional products that can be purchased through regular channels.

[0041] Example 1 Introduction of a thioesterase family protein mutant containing a V23A mutation into Corynebacterium glutamicum ATCC 13032

[0042] The method of introducing thioesterase family protein mutants into Corynebacterium glutamicum can adopt the classical genetic manipulation method in Corynebacterium, that is, the secondary exchange recombination strategy based on pK18mobsacB suicide plasmid. The specific operation method is as follows:

[0043] Step 1: Using the ATCC 13032 genome as a template, PCR amplification was performed with the primer pairs 0686-1f / 0686-V23A-1r and 0686-V23A-2f / 0686-2r, respectively, to obtain the upstream homology arm and downstream homology arm of the NCgl0686 gene V23A mutation modification. Afterwards, the mixture of the upstream homology arm and the downstream homology arm was used as a template, and the primer pair 0686-1f / 0686-2r was used for amplification to obtain the full-length fragment after the fusion of the upstream and downstream homology arms. The full-length fragment was double-digested with XbaI and HindIII, and the product was recovered using a gel recovery kit.

[0044] Step 2: The plasmid vector was pK18mobsacB (GenBank: FJ437239.1), which was double-digested with the same restriction endonuclease and subjected to gel recovery.

[0045] Step 3: The products obtained in step 1 and step 2 were assembled using a seamless cloning kit and transformed into Trans1 T1 competent cells. The target transformants were screened on 50 mg / L kanamycin resistance plates, and the plasmids were extracted and sequenced for the obtained transformants. The correctly sequenced plasmid was named pK18mobsacB-NCgl0686-V23A.

[0046] Step 4: Prepare competent cells of ATCC 13032 and perform gene recombination according to the method in the C. glutamicum Handbook (Charpter 23).

[0047] The recombinant plasmid pK18mobsacB-NCgl0686-V23A was transformed into ATCC 13032 competent cells by electroporation, and transformants were selected on BHI selection medium containing 15 mg / L kanamycin. The selected transformants were cultured overnight in ordinary BHI liquid medium at 33°C and shaken at 220 rpm on a rotary shaker. During this culture process, the transformants underwent a second recombination, the vector sequence was removed from the genome by gene exchange, and the target mutation was introduced at the same time. The culture was diluted in a continuous gradient (10 -2 Serial dilution up to 10 -4 ), the dilution was spread on a common BHI solid medium containing 10% sucrose and cultured at 33°C for 48 hours. The grown transformants should carry the target mutation and not carry the inserted vector sequence. The target sequence was amplified by PCR, and nucleotide sequencing confirmed that the NCgl0686 gene had been successfully mutated, so that the 23rd valine of its encoded protein was mutated to alanine. The target transformed strain finally obtained was named 13032-NCgl0686-V23A.

[0048] Example 2 Introduction of a thioesterase family protein mutant containing a V23G mutation into Corynebacterium glutamicum ATCC 13032

[0049] The method for plasmid construction and introduction of a thioesterase family protein mutant containing a V23G mutation is the same as the method in Example 1. The specific operation method is as follows:

[0050] Step 1: Using the ATCC 13032 genome as a template, PCR amplification was performed with the primer pairs 0686-1f / 0686-V23G-1r and 0686-V23G-2f / 0686-2r, respectively, to obtain the upstream homology arm and downstream homology arm of the NCgl0686 gene V23G mutation modification. Afterwards, a mixture of the upstream homology arm and the downstream homology arm was used as a template, and amplification was performed with the primer pair 0686-91-1f / 0686-91-2r to obtain the full-length fragment after the fusion of the upstream and downstream homology arms. The full-length fragment was double-digested with XbaI and HindIII, and the product was recovered using a gel recovery kit.

[0051] Step 2: The plasmid vector was pK18mobsacB (GenBank: FJ437239.1), which was double-digested with the same restriction endonuclease and subjected to gel recovery.

[0052] Step 3: The products obtained in step 1 and step 2 were assembled using a seamless cloning kit and transformed into Trans1 T1 competent cells. The target transformants were screened on 50 mg / L kanamycin resistance plates, and the plasmids were extracted and sequenced for the obtained transformants. The correctly sequenced plasmid was named pK18mobsacB-NCgl0686-V23G.

[0053] Step 4: Prepare competent cells of ATCC 13032 and perform gene recombination according to the method in the C. glutamicum Handbook (Charpter 23).

[0054] The recombinant plasmid pK18mobsacB-NCgl0686-V23G was transformed into ATCC 13032 competent cells by electroporation, and transformants were selected on BHI selection medium containing 15 mg / L kanamycin. The selected transformants were cultured overnight in ordinary BHI liquid medium at 33°C and shaken at 220 rpm on a rotary shaker. During this culture process, the transformants underwent a second recombination, the vector sequence was removed from the genome by gene exchange, and the target mutation was introduced at the same time. The culture was diluted in a continuous gradient (10 -2 Serial dilution up to 10 -4 ), the dilution was spread on a common BHI solid medium containing 10% sucrose and cultured at 33°C for 48 hours. The grown transformants should carry the target mutation and not carry the inserted vector sequence. The target sequence was amplified by PCR, and nucleotide sequencing confirmed that the NCgl0686 gene had been successfully mutated, so that the 23rd valine of its encoded protein was mutated to glycine. The target transformed strain finally obtained was named 13032-NCgl0686-V23G.

[0055] Example 3 Introduction of a thioesterase family protein mutant containing a V23T mutation into Corynebacterium glutamicum ATCC 13032

[0056] The method for plasmid construction and introduction of thioesterase family protein mutants containing V23T mutation is the same as the principle of Example 1 and Example 2. The specific operation method is as follows:

[0057] Step 1: Using the ATCC 13032 genome as a template, PCR amplification was performed with the primer pairs 0686-1f / 0686-V23T-1r and 0686-V23T-2f / 0686-2r, respectively, to obtain the upstream homology arm and downstream homology arm of the NCgl0686 gene V23T mutation modification. Afterwards, a mixture of the upstream homology arm and the downstream homology arm was used as a template, and amplification was performed with the primer pair 0686-91-1f / 0686-91-2r to obtain the full-length fragment after the fusion of the upstream and downstream homology arms. The full-length fragment was double-digested with XbaI and HindIII, and the product was recovered using a gel recovery kit.

[0058] Step 2: The plasmid vector was pK18mobsacB (GenBank: FJ437239.1), which was double-digested with the same restriction endonuclease and subjected to gel recovery.

[0059] Step 3: The products obtained in step 1 and step 2 were assembled using a seamless cloning kit and transformed into Trans1 T1 competent cells. The target transformants were screened on 50 mg / L kanamycin resistance plates, and the plasmids were extracted and sequenced for the obtained transformants. The correctly sequenced plasmid was named pK18mobsacB-NCgl0686-V23T.

[0060] Step 4: Prepare competent cells of ATCC 13032 and perform gene recombination according to the method in the C. glutamicum Handbook (Charpter 23).

[0061] The recombinant plasmid pK18mobsacB-NCgl0686-V23T was transformed into ATCC 13032 competent cells by electroporation, and the transformants were screened on BHI selection medium containing 15 mg / L kanamycin. The screened transformants were cultured overnight in ordinary BHI liquid medium at 33°C and shaken at 220 rpm on a rotary shaker. During this culture process, the transformants underwent a second recombination, the vector sequence was removed from the genome by gene exchange, and the target mutation was introduced at the same time. The culture was diluted in a continuous gradient (10 -2 Serial dilution up to 10 -4 ), the dilution was spread on a common BHI solid medium containing 10% sucrose and cultured at 33°C for 48 hours. The grown transformants should carry the target mutation and not carry the inserted vector sequence. The target sequence was amplified by PCR, and nucleotide sequencing confirmed that the NCgl0686 gene had been successfully mutated, so that the 23rd valine of its encoded protein was mutated to threonine. The target transformed strain finally obtained was named 13032-NCgl0686-V23T.

[0062] Example 4: Introducing a thioesterase family protein mutant containing a V23A mutation into the CGMCC No.11942 strain

[0063] CGMCC No.11942 is a lysine high-producing strain, which is derived from ATCC 13032 through genetic engineering. The tool plasmid used in ATCC 13032 can also be used in CGMCC No.11942. Therefore, the NCgl0686 gene of the CGMCC No.11942 strain was mutated and modified. The modification method can be referred to Example 1, and the modified strain finally obtained was named 11942-NCgl0686-V23A.

[0064] Example 5: Introducing a thioesterase family protein mutant containing a V23G mutation into the CGMCC No.11942 strain

[0065] A thioesterase family protein mutant containing a V23G mutation was introduced into the CGMCC No. 11942 strain. The transformation method was referred to Example 2. The finally obtained transformed strain was named 11942-NCgl0686-V23G.

[0066] Example 6 Introducing a thioesterase family protein mutant containing a V23T mutation into CGMCC No.11942 strain

[0067] A thioesterase family protein mutant containing a V23T mutation was introduced into the CGMCC No. 11942 strain. The transformation method was referred to Example 3. The finally obtained transformed strain was named 11942-NCgl0686-V23T.

[0068] Example 7 Introducing a thioesterase family protein mutant containing a V23A mutation into CGMCC No.13407 strain

[0069] CGMCC No.13407 is a high-lysine-producing strain derived from ATCC 13032 through genetic engineering. The tool plasmid used in ATCC 13032 can also be used in CGMCC No.13407. Therefore, the NCgl0686 gene of the CGMCC No.13407 strain was mutated and modified. The modification method can be referred to Example 1. The modified strain finally obtained was named 13407-NCgl0686-V23A.

[0070] Example 8 Introducing a thioesterase family protein mutant containing a V23G mutation into CGMCC No.13407 strain

[0071] A thioesterase family protein mutant containing a V23G mutation was introduced into the CGMCC No. 13407 strain. The transformation method was referred to Example 2. The finally obtained transformed strain was named 13407-NCgl0686-V23G.

[0072] Example 9 Introducing a thioesterase family protein mutant containing a V23T mutation into CGMCC No.13407 strain

[0073] A thioesterase family protein mutant containing a V23T mutation was introduced into the CGMCC No. 13407 strain. The transformation method was referred to Example 3. The finally obtained transformed strain was named 13407-NCgl0686-V23T.

[0074] Example 10 Acid production phenotype test of modified strains

[0075] The 9 strains obtained in Examples 1-9 were subjected to fermentation tests to observe whether their lysine production capacity was enhanced. The starting strains were used as control experiments in the same period.

[0076] The culture medium used in the fermentation experiments was as follows:

[0077] 1. Plate activation medium: BHI 37g / L, 18g / L agar powder.

[0078] 2. Seed culture medium: sucrose 20g / L, yeast powder 5g / L, peptone 10g / L, urea 5g / L, magnesium sulfate heptahydrate 0.4g / L, adjust pH to 7.0.

[0079] 3. Fermentation medium: glucose 60g / L, ammonium sulfate 25g / L, potassium dihydrogen phosphate 2.0g / L, magnesium sulfate heptahydrate 1.0g / L, soybean meal hydrolyzate 10g / L, calcium carbonate 30g / L, adjust pH to 7.0.

[0080] The fermentation method is as follows:

[0081] 1. Seed activation: Take the strain to be verified from the cryopreserved tube, streak it on the seed activation medium, and culture it at 33℃ for 24h;

[0082] 2. Seed culture: Pick the activated seeds 1 from the plate and transfer them to a 500mL Erlenmeyer flask containing 30mL of seed culture medium. Shake and culture at 33℃ and 220r / min for 6h to obtain seed solution.

[0083] 3. Fermentation culture: inoculate 2 mL of seed liquid into a 500 mL Erlenmeyer flask containing 20 mL of fermentation medium, and culture at 33°C and 220 rpm for 14-15 h. Make 3 parallel cultures for each strain.

[0084] 4.OD 562Determination: The fermentation broth was diluted 100 times with 0.01M hydrochloric acid, and the absorbance was detected at a wavelength of 562nm using a spectrophotometer. Three parallel tests were performed for each strain, and the average value was calculated. The test results are shown in Table 2, and the data in the table are the average values ​​of the three parallel tests.

[0085] 5. Determination of amino acid concentration: Take 2 mL of fermentation broth and centrifuge (12000 rpm, 2 min), collect the supernatant, and detect it using Agilent high performance liquid chromatography (HPLC). The experimental bacteria and the control bacteria were each tested in parallel for 3 times, and the average value was calculated. The test results are shown in Table 2.

[0086] Table 2 Acid production phenotype test of modified strains

[0087]

[0088] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, rather than to limit it. Although the present invention has been described in detail with reference to the aforementioned embodiments, those skilled in the art should understand that they can still modify the technical solutions described in the aforementioned embodiments, or make equivalent replacements for some of the technical features therein. However, these modifications or replacements do not deviate the essence of the corresponding technical solutions from the spirit and scope of the technical solutions of the embodiments of the present invention.

Claims

1. Use of a thioesterase family protein mutant or its encoding gene or a biological material containing the encoding gene in constructing a microorganism for producing lysine or its derivatives, wherein the thioesterase family protein mutant contains a mutation in which valine at position 23 is mutated to alanine, glycine or threonine compared to the thioesterase family protein with an amino acid sequence as shown in SEQ ID NO.

4.

2. Use of a thioesterase family protein mutant or its encoding gene or a biological material containing the encoding gene in microbial fermentation to produce lysine or its derivatives, wherein the thioesterase family protein mutant contains a mutation in which valine at position 23 is mutated to alanine, glycine or threonine compared to the thioesterase family protein with an amino acid sequence as shown in SEQ ID NO.

4.

3. The use of a thioesterase family protein mutant or its encoding gene or a biological material containing the encoding gene in improving the yield of lysine or its derivatives produced by microorganisms, wherein the thioesterase family protein mutant contains a mutation in which valine at position 23 is mutated to alanine, glycine or threonine compared to the thioesterase family protein with an amino acid sequence as shown in SEQ ID NO.

4.

4. The use according to any one of claims 1 to 3, characterized in that: The amino acid sequence of the thioesterase family protein mutant is shown in any one of SEQ ID NOs. 1 to 3.

5. The use according to any one of claims 1 to 3, characterized in that: The biological material includes an expression cassette, a vector or a host cell.

6. The use according to any one of claims 1 to 3, characterized in that: The microorganism is a bacterium of the genus Corynebacterium.

7. A method for increasing the yield of lysine or its derivatives produced by microorganisms, characterized in that: The method comprises: modifying a microorganism so that the microorganism expresses a thioesterase family protein mutant, wherein the thioesterase family protein mutant contains a mutation in which the valine at position 23 is mutated to alanine, glycine or threonine compared to the thioesterase family protein with an amino acid sequence as shown in SEQ ID NO.

4.

8. The method according to claim 7, characterized in that The amino acid sequence of the thioesterase family protein mutant is shown in any one of SEQ ID NOs. 1 to 3.

9. The method according to claim 8, characterized in that The method comprises: mutating the original thioesterase family protein gene in the genome of the microorganism so that it encodes the thioesterase family protein mutant; The amino acid sequence of the original thioesterase family protein in the microbial genome is shown in SEQ ID NO.

4.

10. The method according to any one of claims 7 to 9, characterized in that: The microorganism is a bacterium of the genus Corynebacterium.

Images