KASP molecular marker related to anthocyanin in eggplant peel and application of KASP molecular marker

Abstract

The invention discloses a KASP molecular marker related to anthocyanin in eggplant pericarp and application of the KASP molecular marker, the KASP molecular marker is located at the 76516913 site of a chromosome 10 of an eggplant genome, and point mutation from C to G occurs at the 76516913 site basic group. The KASP molecular marker 21QP381 for identifying whether anthocyanin exists in eggplant peel is developed on the basis of fine positioning, 264 eggplant varieties from all over the country are used as materials, the applicability of the KASP molecular marker 21QP381 is verified, and the result shows that the molecular marker developed by the invention has better applicability. By utilizing the KASP molecular marker 21QP381 disclosed by the invention, the color of eggplant fruits can be quickly identified at high flux in the eggplant seedling stage, purple eggplants and non-purple eggplants are screened out, technical support is provided for eggplant molecular marker-assisted selective breeding, and the KASP molecular marker 21QP381 has important application value in production.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology, and more specifically, relates to a KASP molecular marker related to anthocyanins in eggplant peel and application thereof. Background Art

[0002] Anthocyanidin, also known as flower pigment, is a type of water-soluble natural pigment widely found in plants in nature. It is the main coloring substance in fruits, vegetables and flowers. Under different pH conditions of plant cell vacuoles, anthocyanidins make the petals appear colorful. There are 6 main types of anthocyanidins, namely geranium pigment, cornflower pigment, delphinium pigment, peony pigment, morning glory pigment and mallow pigment. Anthocyanidins in natural state exist in the form of glycosides, called anthocyanins, and there are very few free anthocyanins. Anthocyanidins are mainly used for food coloring, and can also be used in dyes, medicines, cosmetics and other aspects.

[0003] Eggplant (Solanum melongena L., 2n = 24), also known as Luosu, Kunlun melon, etc., is an annual herbaceous to subshrub plant of the genus Solanum in the Solanaceae family. It is one of the important vegetable crops in many countries such as my country, Southeast Asia and Africa because of its good taste, rich nutrients, and the fact that it is a popular vegetable that can be supplied year after year. Eggplant is rich in nutrients, and the fruit contains ingredients such as protein, fat, carbohydrates, carotene, chlorophyll, anthocyanin, various vitamins and alkaloids. Eggplant fruit has the characteristics of diverse eating methods, good taste, and economical price, and is deeply loved by consumers.

[0004] As the second origin and secondary evolution center of eggplant, China has rich eggplant seed resources. Eggplant has a variety of agronomic traits, among which eggplant fruit color is one of the most intuitive agronomic traits of eggplant. Among the existing eggplant varieties, the fruit colors include purple-black, purple-red, light purple, green and white. The rich fruit colors and varieties provide consumers with more choices. The color of eggplant fruit is mainly determined by the content of anthocyanins and chlorophyll. In eggplant, the anthocyanin content determines the depth of purple of the peel; chlorophyll gives the peel green color. When there is no anthocyanin in the peel or the concentration of anthocyanin is low, the fruit appears green; when anthocyanin and chlorophyll coexist, the fruit appears purple-black; if both anthocyanin and chlorophyll are absent, the fruit appears white.

[0005] At present, many people have studied the genes and transcription factors that regulate anthocyanins in eggplant fruits. However, most of them are through bioinformatics methods such as transcriptome, metabolome, and GWAS (genome-wide association study), which are difficult to convert into effective molecular markers and apply. In existing studies, there are few KASP molecular markers that are closely linked to the purple trait of eggplant fruits, and the accuracy of the developed KASP molecular markers is not high enough when verified in natural populations.

[0006] Therefore, it is very meaningful to develop a KASP molecular marker that is closely linked to the anthocyanin traits in eggplant peel and can efficiently and accurately identify whether the eggplant peel contains anthocyanins. Summary of the invention

[0007] Based on this, the purpose of the present invention is to provide a KASP molecular marker related to anthocyanins in eggplant peel and its application. Using the KASP molecular marker, whether the eggplant peel contains anthocyanins can be efficiently identified, and the accuracy of the correspondence between genotype and phenotype is high when verified in natural populations.

[0008] The technical solutions for achieving the above-mentioned invention objectives include the following.

[0009] In a first aspect, the present invention provides a KASP molecular marker related to anthocyanins in eggplant peel. The KASP molecular marker is located at position 76516913 of chromosome 10 of the eggplant genome, and a point mutation from C to G occurs at position 76516913.

[0010] In a second aspect of the present invention, a KASP primer for amplifying the KASP molecular marker associated with anthocyanins in eggplant peel is provided. The KASP primer comprises an upstream primer F as shown in SEQ ID NO: 1. P1 , an upstream primer F having a sequence as shown in SEQ ID NO: 2 P2 , and a downstream primer R whose sequence is shown in SEQ ID NO:3.

[0011] The third aspect of the present invention provides the use of the above-mentioned KASP molecular marker or KASP primer in early identification of eggplant peel color, auxiliary breeding of eggplant varieties containing anthocyanins in the peel, or preparation of a kit for detecting eggplant peel color.

[0012] The fourth aspect of the present invention provides a kit for detecting the color of eggplant peel, comprising the above-mentioned KASP primers for amplifying the above-mentioned KASP molecular markers related to anthocyanins in eggplant peel.

[0013] In a fifth aspect, the present invention provides a method for identifying the color of eggplant peel, comprising the following steps: using the DNA of the eggplant to be identified as a template and the above-mentioned KASP primers as amplification primers, performing PCR amplification, and then analyzing the genotyping data.

[0014] The present invention has the following beneficial effects:

[0015] The present invention develops a KASP molecular marker 21QP381 for identifying whether anthocyanins are present in eggplant peel based on fine positioning, and uses 264 eggplant varieties from all over the country as materials to verify the applicability of the KASP molecular marker 21QP381. The results show that the accuracy of the correspondence between genotype and phenotype is as high as 97.35%, indicating that the molecular marker developed by the present invention has better applicability, and the genotyping of the KASP molecular marker 21QP381 in F2, F3, F4 and natural populations is very clear. The KASP molecular marker 21QP381 of the present invention can be used to achieve high-throughput rapid identification of the color of eggplant fruits at the eggplant seedling stage, screen out purple eggplants and non-purple eggplants, provide technical support for eggplant molecular marker-assisted selection breeding, and has important application value in production. BRIEF DESCRIPTION OF THE DRAWINGS

[0016] Figure 1 The phenotypes of the parents and F1 materials in Example 1 of the present invention, as well as their respective anthocyanin contents.

[0017] Figure 2 This is the fruit color distribution of the F2 population in Example 1 of the present invention.

[0018] Figure 3 This is the visualization result of BSA-seq in Example 1 of the present invention.

[0019] Figure 4 This is the genetic map of the F2 population and the results of progeny identification in Example 1 of the present invention.

[0020] Figure 5 It is the genetic map of the F3 population and the distribution map of molecular marker genotypes and traits in Example 1 of the present invention.

[0021] Figure 6 This is the genetic map and progeny identification map of the F4 population in Example 1 of the present invention.

[0022] Figure 7 This is the genotyping of the molecular marker 21QP381 in Example 1 of the present invention in F2, F3, F4, natural populations and advanced inbred lines. DETAILED DESCRIPTION

[0023] In order to facilitate the understanding of the present invention, the present invention will be described more fully below. The present invention can be implemented in many different forms and is not limited to the embodiments described herein. On the contrary, the purpose of providing these embodiments is to make the understanding of the disclosure of the present invention more thorough and comprehensive.

[0024] Unless otherwise defined, all technical and scientific terms used in the present invention have the same meaning as those commonly understood by those skilled in the art to which the present invention belongs. The terms used in the specification of the present invention are only for the purpose of describing specific embodiments and are not intended to limit the present invention. The term "and / or" used in the present invention includes any and all combinations of one or more of the related listed items.

[0025] The experimental methods in the following examples without specifying specific conditions are usually carried out under conventional conditions or conditions recommended by the manufacturers. The various commonly used chemical reagents used in the examples are all commercially available products.

[0026] Based on many years of research experience on tightly linked molecular markers for eggplant peel color, the inventors of the present invention used "BW2" as the male parent (Male, genotype is G / G, and the peel does not contain anthocyanins) and "21E27" as the female parent (Female, genotype is C / C, and the peel contains anthocyanins), hybridized to obtain F1, self-pollinated F1 to obtain a segregating population F2, collected seeds from F2 fruits and sowed to obtain F3, and continued to collect seeds in the same way to obtain F4 and F5, which were used as research materials, and BSA mixed pool sequencing, KASP molecular marker development, KASP genotyping, construction of genetic linkage map, and initial positioning and fine positioning of eggplant purple-black fruit genes were carried out in sequence. In the process of fine positioning, by statistically analyzing the genotypes and phenotypes after molecular marker genotyping, it was found that the molecular marker 21QP381 was significantly positive in F2 and F5. 2：3 、F 3：4 The corresponding genotypes in the population were most closely related to the phenotypes, with a correspondence rate of 100%. Therefore, the molecular marker 21QP381 can be used as a KASP molecular marker to identify whether anthocyanins are present in the eggplant peel. Further IGV alignment analysis of the resequencing sequences of the parents "21E27" and "BW2" revealed that the molecular marker 21QP381 had a SNP site from C to G at position 76516913 of chromosome 10 in the eggplant genome HQ-1315 version. The genotype of the green eggplant "BW2" at this site was "G / G", and the genotype of the "purple black eggplant" at this site was "C / C". On this basis, 264 eggplant varieties from all over the country were used as materials to verify the applicability of the KASP molecular marker 21QP381. The accuracy of the correspondence between the genotype and the phenotype was as high as 97.35%, and the genotyping of the KASP molecular marker 21QP381 in F2, F3, F4 and natural populations was very clear.

[0027] In some embodiments of the present invention, a KASP molecular marker related to anthocyanins in eggplant peel is disclosed. The KASP molecular marker is located at position 76516913 of chromosome 10 of the eggplant genome, and a point mutation C→G occurs at the base at position 76516913; when the base at position 76516913 is C, the color of the eggplant peel is purple, and the eggplant peel contains anthocyanins; when the base at position 76516913 is G, the color of the eggplant peel is green, and the eggplant peel does not contain anthocyanins.

[0028] In other embodiments of the present invention, KASP primers for amplifying the KASP molecular markers related to anthocyanins in eggplant peel are disclosed, wherein the KASP primers include an upstream primer F as shown in SEQ ID NO: 1. P1 , upstream primer F with a sequence as shown in SEQ ID NO: 2 P2 , and a downstream primer R whose sequence is shown in SEQ ID NO:3.

[0029] In other embodiments of the present invention, the use of the above-mentioned KASP molecular markers or KASP primers in the early identification of eggplant peel color is disclosed.

[0030] In other embodiments of the present invention, the use of the above-mentioned KASP molecular markers or KASP primers in assisted breeding of eggplant varieties containing anthocyanins in the peel is disclosed.

[0031] In other embodiments of the present invention, the use of the above-mentioned KASP molecular marker or KASP primer in preparing a kit for detecting the color of eggplant peel is disclosed.

[0032] In other embodiments of the present invention, a kit for detecting the color of eggplant peel is disclosed, comprising the above-mentioned KASP primers for amplifying the above-mentioned KASP molecular markers related to anthocyanins in eggplant peel.

[0033] In other embodiments of the present invention, a method for identifying the color of eggplant peel is disclosed, comprising the following steps: using the DNA of the eggplant to be identified as a template, using the above-mentioned KASP primers as amplification primers, performing PCR amplification, and analyzing the genotyping data.

[0034] In some embodiments, the PCR amplification reaction system includes: KASP MIX 2.5±0.1 μL, 8-12 μM upstream primer F p1 0.075±0.005μL, 8~12μM upstream primer F p2 0.075±0.005μL, 8-12μM downstream primer R0.2±0.05μL, template DNA 2±0.2μL, ddH2O add to 5μL.

[0035] In some embodiments, the reaction procedure of the PCR amplification is:

[0036] Step 1: 94°C for 15 min;

[0037] Step 2: 94℃ for 20s;

[0038] Step 3: 78℃ for 10s;

[0039] Step 4: 65℃1min;

[0040] Go back to step 2, 10 cycles;

[0041] Step 6: 94℃20s;

[0042] Step 7: 57℃1min;

[0043] Return to step 6 and repeat 30 times.

[0044] In some embodiments, the analyzing genotyping data includes the following steps: when the genotype is G / G, the fruit skin color is green; when the genotype is C / C, the fruit skin color is purple-black; when the genotype is C / G, the fruit skin color is purple-black.

[0045] The present invention is described in detail below with reference to the accompanying drawings and specific embodiments.

[0046] Example 1 Development of KASP molecular marker 21QP381 tightly linked to anthocyanins in eggplant fruit

[0047] 1. Experimental Materials

[0048] The experimental materials used in this experiment: the eggplant high-generation inbred line "BW2", the fruit color is green, and the high-generation inbred line "21E27", the fruit color is purple-black; "BW2" is the male parent (Male, genotype is G / G, the fruit peel does not contain anthocyanins), "21E27" is the female parent (Female, genotype is C / C, the fruit peel contains anthocyanins), hybridization to obtain F1, F1 self-pollination to obtain the segregating population F2, F2 fruit collection seeds sowing to obtain F3, the same method continues to collect seeds to obtain F4 and F5. Eggplant materials were planted at the Qilin North Experimental Base of South China Agricultural University and carried out routine field management. The phenotypes of the parents and F1 materials, as well as their respective anthocyanin contents are shown in Figure 2. Figure 1 shown.

[0049] 2. Experimental Methods

[0050] 1. Extraction of genomic DNA from eggplant to be tested

[0051] Extract the genomic DNA of the eggplant to be tested. Use the modified CTAB method to extract the genomic DNA. The formula of 2% CTAB reagent is shown in Table 1.

[0052] Table 1

[0053] Reagents Usage Tris 12.12g NaCl 82g EDTA 7.44g PVP 2g CTAB 20g <![CDATA[dd H2O]]> Up to 1000mL

[0054] The prepared CTAB was sterilized in an autoclave at 121°C for 20 min. After cooling, 1 / 1000 of β-mercaptoethanol was added (operated in a fume hood).

[0055] The specific steps for extracting eggplant genomic DNA are as follows:

[0056] a. Sampling: Take young eggplant leaves and place them in a 2 mL centrifuge tube;

[0057] b. Freeze drying: open the lid of the 2 mL centrifuge tube containing the leaves and place it in a freeze dryer at -80°C and 1 mbar for 48 hours;

[0058] c. Tissue disruption: Add 2 steel beads to a 2 mL centrifuge tube, grind in a tissue disruptor at 60 Hz for 1 min, and then centrifuge at 10,000 rpm for 30 s.

[0059] d. Extraction: Add 750 μL of 2% CTAB extracting solution and shake vigorously to allow the sample to fully react with it. Place the centrifuge tube in a constant temperature metal bath at 65°C for 45 minutes, shaking once every 20 minutes during the process.

[0060] e. Phase separation: Add 750 μL of chloroform:isoamyl alcohol (24:1) mixture to a 2 mL centrifuge tube in a fume hood, shake vigorously to mix thoroughly, and then centrifuge at 10,000 rpm for 6 min.

[0061] f. Precipitate DNA: After centrifugation, take 375 μL of supernatant into a new 1.5 mL centrifuge tube, add 750 μL of pre-cooled anhydrous ethanol, shake gently to mix, and place in a -20°C low-temperature refrigerator for 1 hour.

[0062] g. Purification: Place the centrifuge tube in a centrifuge and centrifuge at 12,000 rpm for 6 minutes, discard the supernatant, add 750 μL 70% ethanol to rinse twice, dry the liquid on the surface of the centrifuge tube with a paper towel, place it in a 65°C oven for 1 to 2 hours, and dry it.

[0063] h. Dissolution and storage: Add 100 μL of sterilized ultrapure water to each centrifuge tube to dissolve, place on a horizontal shaker at 30 rpm at room temperature for 12 hours, and finally store in a -20°C low-temperature refrigerator.

[0064] 2. Extraction and determination of anthocyanin content in eggplant peel

[0065] The anthocyanin content of eggplant exocarp was determined by spectrophotometric pH difference method, and the specific operation was as follows:

[0066] Working solution: pH = 1.0 buffer (50mM KCl and 150mM HCl), pH = 4.5 buffer (400mM sodium acetate and 204mM HCl)

[0067] a. Grind 100 mg of eggplant sample into powder in liquid nitrogen;

[0068] b. Add 100 mg of eggplant sample into 2 mL of working solution;

[0069] c. Centrifuge the mixture at 14000 rpm, 10 min, 4°C;

[0070] d. Take the supernatant and measure it with a 510nm wavelength spectrophotometer;

[0071] Calculation formula: Total anthocyanins (mg / g FW) = (A1-A2) × 484.8 / 24.825 × dilution factor

[0072] Note: A1 represents the reading of the supernatant in pH=1.0 buffer at a wavelength of 510nm; A2 represents the reading of the supernatant in pH=4.5 buffer at a wavelength of 510nm; 484.8 is the molecular weight of cyanidin-3-O-glucoside; 24.825 is the molar absorbance at a wavelength of 510nm.

[0073] 3. BSA pool sequencing

[0074] The fruit color of the F2 population was statistically analyzed, and 20 extreme green eggplant populations and 20 extreme purple-black eggplant populations were selected according to the fruit color distribution. The DNA of the two populations was mixed in equal amounts to form a green eggplant pool and a purple-black eggplant pool for BSA mixed pool sequencing. The parents "green eggplant BW2" and "21E27" were resequenced, with a parent sequencing depth of 20×, and a green eggplant pool and a purple-black eggplant pool sequencing depth of 30×. Eggplant HQ-1315 was used as the reference genome (https: / / solgenomics.net / ), and reliable SNP sites were obtained through BWA, SAM, and GATK software. The SNP-index of each SNP site in each mixed pool was calculated using the parent "21E27" as a reference. According to the obtained data, the SNP-index of the green eggplant pool was subtracted from the SNP-index of the purple-black eggplant pool to obtain △(SNP-index), and the distribution map of SNP-index and △(SNP-index) was drawn using the above data. Based on the eggplant reference genome HQ-1315 published in the Sol Genomics Network database (SGN), the SNP sites of green eggplant "BW2" and "21E27" in the parental resequencing results were compared, and the different SNP sites between the two parents were selected for the development of molecular markers.

[0075] 4. KASP molecular marker development

[0076] Using the screened SNP sites, the vcf file and fast file obtained from the BSA result analysis were used to develop molecular markers. The specific steps are as follows:

[0077] a. Find the SNP site in the target interval in the vcf file, and use the physical location of the site to find the 250bp gene sequence before and after the SNP site in the fast file;

[0078] b. In the SNPPrimer function area of ​​the website http: / / www.snpway.com / , enter the gene sequence of 250 bp before and after the corresponding SNP site to generate a front primer F with a linker sequence of GAAGGTGACCAAGTTCATGCT and a FAM fluorescence match at the 5' end of the primer. P1 , SNP site F with a linker sequence of GAAGGTCGGAGTCAACGGATT matching the HEX fluorescence P2 , and the rear primer R after the SNP site.

[0079] Primer design must meet the following conditions: the length of the amplified target fragment product is between 60 and 200 bp, and the shorter the better if all conditions are met; the primer Tm value is between 57 and 61°C, and the smaller the difference in Tm values ​​between the front and rear primers, the better; the primer CG content is between 30% and 80%; a primer cannot have five consecutive identical bases.

[0080] The primers were compared by BLAST on the website https: / / solgenomics.net / tools / blast / for primer specificity. At the same time, attention should be paid to the changes in the secondary structure of the allele-specific primers after adding the universal adapter and the stability of the dimer.

[0081] The primers were synthesized by Shanghai Sangon Biotechnology Co., Ltd. and the homozygous method was purified by PAGE gel. The synthesized primers need to be dissolved in ultrapure water. Low-quality water or high-concentration TE buffer will affect the genotyping effect.

[0082] 5. KASP genotyping

[0083] The amplification reaction of KASP genotyping was carried out in a 384-well fluorescence quantitative PCR instrument. Before the program started, the sample number corresponding to each well should be set, and two parents, F1 and blank controls should be set.

[0084] The extracted genomic DNA of the sample to be tested was diluted to 5 ng / μL-50 ng / μL as a template for the amplification reaction. The KASP reaction system should be prepared on ice, and KASP MIX should be stored away from light. After the system is prepared, centrifuge at 1200 rpm for 1 min. The PCR reaction system is shown in Table 2. The KASP amplification reaction procedure is shown in Table 3.

[0085] Table 2

[0086] Composition Usage amount / μL KASP MIX 2X 2.5 <![CDATA[F p1 (10μM)]]> 0.075 <![CDATA[F p2 (10μM)]]> 0.075 R(10μM) 0.2 Template DNA 2 <![CDATA[ddH2O]]> 0.15

[0087] Table 3

[0088] Program number Operation requirements time 1 94℃ 15min 2 94℃ 20s 3 78℃ 10s 4 65℃(0.5℃ drop for each cycle) 1min 5 Return to step 2, 10 cycles 6 94℃ 20s 7 57℃ 1min 8 Return to step 6, 30 cycles 9 Plate reading

[0089] KASP genotyping data analysis: The final fluorescence signal was analyzed using CFX Maestro V4.1, the analysis software that comes with the C1000 Touch, to obtain the SNP typing results. The yellow circles that are displayed on the X-axis, that is, the signal of the Allele 1 channel reported by the sample, are the alleles connected to the FAM fluorescent connector; the blue squares that are displayed on the Y-axis, that is, the signal of the Allele 2 channel reported by the sample, are the alleles connected to the HEX fluorescent connector; the samples that are displayed as green triangles above the diagonal of the XY axis are the heterozygous types of the two alleles.

[0090] 6. Construction of genetic linkage map and preliminary gene location

[0091] The available KASP molecular markers were designed and screened within the 95% confidence interval discovered by BSA-seq, and genotyping was performed in different types of segregating populations, and the results were organized into an EXCEL table. The genotype identical to the green eggplant parent was replaced with "0", the genotype identical to the purple-black eggplant parent was replaced with "2", the heterozygous type was replaced with "1", and the undefined or no signal was replaced with "-1". The genetic distance was calculated using the MAP function of QTL Ici Mapping 4.2 to construct a genetic linkage map. The Kosambi mapping function was used to convert the recombination frequency to estimate the mapping distance in cM. The BIP function of QTL Ici Mapping was then used to perform QTL analysis on the eggplant fruit color trait, and the LOD value of 2.5 was used as the threshold for judging the existence of QTL to obtain the gene positioning results.

[0092] 3. Experimental Results

[0093] 1. Analysis of the genetic laws of eggplant fruit color

[0094] The characteristics of the two parent populations of green eggplant "BW2" and "21E27", and the F1 and F2 segregating populations were investigated and statistically analyzed. The fruit color of the F2 population was assigned a value based on the anthocyanin content: 1 (green eggplant), 2 (light purple), 3 (purple-red), 4 (dark purple), and 5 (purple-black). The results are as follows Figure 2 Among the 175 purple and green eggplant segregating populations, there were 121 purple eggplants (phenotypic values: 2, 3, 4, 5) and 54 green eggplants (phenotypic value: 1), with a broad heritability of 0.97; the fruit color trait of the F2 segregating population met the purple eggplant: green eggplant = 3:1 (x 2 =1.8867, P=0.157), indicating that the eggplant fruit color conforms to Mendel's law of inheritance controlled by a single gene, and that the eggplant fruit color has a stable genetic effect, with purple eggplant being a dominant trait over green eggplant. At the same time, the purple depth of eggplant fruit in the F2 group varies greatly, and it is speculated that there are other loci that regulate the degree of purple in the fruit.

[0095] 2. Preliminary localization of purple-black fruit gene in eggplant

[0096] The F1 (BW2×21E27) was obtained by hybridization of green eggplant "BW2" and "21E27" parents, and the F1 was self-pollinated to obtain the F2 segregation population. In the F2 population of 175 plants, 20 green eggplants and 20 purple-black eggplants were selected to construct the green eggplant pool and the purple-black eggplant pool, respectively. The genomic DNA of the two populations was extracted by the improved CTAB method. Finally, the gene controlling the color of eggplant fruit was located in the interval of 64.4Mb-81.6Mb (95% confidence level) of Chr 10 by BSA-seq, with a total length of about 17.2Mb. Figure 3 shown.

[0097] According to the target region on chr10 in the BSA-seq results, 54 pairs of KASP molecular markers were developed using high-quality SNP sites in the region. After screening and testing of parental and F1 genotypes, 34 pairs of KASP molecular markers were finally selected for population genotyping, and the molecular marker polymorphism accounted for 63%. The 34 pairs of polymorphic molecular markers were used to genotype the 175 F2 populations, and finally 17 pairs of fine-positioning key molecular markers were selected to construct a genetic map. The names of the molecular marker primers and the corresponding sequences (see the sequence list for details) are 22QP119 (SEQ ID NO: 19-21), 22QP158 (SEQ ID NO: 4-6), 22QP116 (SEQ ID NO: 7-9), 21QP450 (SEQ ID NO: 10-12), 22QP107 (SEQ ID NO: 13-15),

[0098] 22QP113 (SEQ ID NO: 16~18), 21QP381 (SEQ ID NO: 1~3), 22QP152 (SEQ ID NO: 22~24),

[0099] 21QP421 (SEQ ID NO: 25~27), 21QP418 (SEQ ID NO: 28~30), 21QP415 (SEQ ID NO: 31~33),

[0100] 21QP394 (SEQ ID NO: 34~36), 22QP92 (SEQ ID NO: 37~39), 21QP406 (SEQ ID NO: 40~42), 21QP403 (SEQ ID NO: 43~45), 21QP438 (SEQ ID NO: 46~48), 22QP95 (SEQ ID NO:49~51).

[0101] The results of F2 population genotyping were used to calculate genetic distances using the MAP function of QTL Ici Mapping 4.2 to construct a genetic linkage map; combined with the fruit color survey data of each plant, the BIP function of Ici Mapping was used to conduct QTL analysis on eggplant fruit color traits. Based on the ICIM method, the LOD value of 2.5 was used as the threshold for judging the existence of QTL, and finally a QTL locus related to the purple color of eggplant fruit was detected between molecular markers 22QP107 and 21QP421. The LOD value of this QTL locus is 104.1718, the PVE is 89.3262%, the physical distance between the molecular markers at both ends of the positioning interval is 13.6Mb, and the genetic distance is 10.62CM. The accuracy of the initial positioning interval was further verified by progeny identification of key plants. The results are as follows Figure 4 shown.

[0102] 3. Fine positioning

[0103] To further reduce the positioning range, expand F 2：3 The population was expanded to 864 strains, and 106 recombinant strains were screened. New KASP molecular markers were developed within the initial positioning interval in order to further narrow the positioning interval. 2：3 The genetic distance of all molecular marker genotyping results of the population was calculated using the above method to construct a genetic linkage map; combined with the fruit color survey data of the recombinant individual plants, the QTL analysis of eggplant fruit color traits was performed using the BIP function of Ici Mapping. Based on the ICIM method, the LOD value of 2.5 was used as the threshold for judging the existence of QTL, and the interval was finally located between 21QP421 and molecular marker 21QP450. The interval genetic distance was 3.71CM and the physical distance was 13.6Mb. The results are as follows Figure 5 The names of the molecular marker primers and their corresponding sequences (see the sequence listing for details) are 21QP394 (SEQ ID NOs: 34-36), 21QP415 (SEQ ID NOs: 31-33), 21QP418 (SEQ ID NOs: 28-30), 21QP421 (SEQ ID NOs: 25-27), 22QP152 (SEQ ID NOs: 22-24), 22QP107 (SEQ ID NOs: 13-15), 21QP381 (SEQ ID NOs: 1-3), 22QP113 (SEQ ID NOs: 16-18), 21QP450 (SEQ ID NOs: 10-12), and 22QP116 (SEQ ID NOs: 7-9).

[0104] Since the positioning interval of the F3 population did not decrease compared with that of the F2 population, the F 3：4The population eventually reached 864 strains of F 3：4 In the population, recombinant plants were screened by molecular markers at both ends of the initial positioning interval, and a total of 52 recombinant plants were screened. Through the above method, new molecular markers were developed to encrypt the initial positioning interval. Finally, the key QTL was located between the two markers 23QP578 and 23QP602, with a physical distance of 86kb and a genetic distance of 0.58CM. The accuracy of the positioning interval was further verified by the identification of the offspring of the key plants. The results are as follows Figure 6 The names of the molecular marker primers and their corresponding sequences (see the sequence table for details) are 21QP394 (SEQ ID NOs: 34-36), 23QP205 (SEQ ID NOs: 52-54), 23QP202 (SEQ ID NOs: 55-57), 23QP199 (SEQ ID NOs: 58-60), 23QP193 (SEQ ID NOs: 61-63), 23QP190 (SEQ ID NOs: 64-66), 23QP187 (SEQ ID NOs: 67-69), 23QP572 (SEQ ID NOs: 70-72), 22QP152 (SEQ ID NOs: 22-24), 22QP107 (SEQ ID NOs: 13-15), 22QP113 (SEQ ID NOs: 16-18), 23QP581 (SEQ ID NOs: 73-75), 23QP578 (SEQ ID NOs: 76-77), 23QP587 (SEQ ID NOs: 78-79), 23QP588 (SEQ ID NOs: 80-81), 23QP589 (SEQ ID NOs: 81-82), 23QP580 (SEQ ID NOs: 82-83), 23QP581 (SEQ ID NOs: 83-84), 23QP582 (SEQ ID NOs: 84-85), 23QP583 (SEQ ID NOs: 85-86), 23QP584 (SEQ ID NOs: 86-87), 23QP585 (SEQ ID NOs: 87-88), 23QP587 (SEQ ID NOs: 88-89), 23QP58 NO:76~78), 21QP381 (SEQ ID NO:1~3), 23QP602 (SEQ ID NO:79~81), 23QP459 (SEQ ID NO:82~84), 23QP566 (SEQ ID NO:85~87), 23QP518 (SEQ ID NO:88~90).

[0105] 4. Development of molecular markers closely linked to purple-black fruit of eggplant

[0106] In the process of fine positioning, the genotype and phenotype after molecular marker genotyping were statistically analyzed and it was found that KASP molecular marker 21QP381 was significantly expressed in F2 and F 2：3 、F 3：4 The corresponding genotypes in the population were most closely related to the phenotypes, with a correspondence rate of 100%, as shown in Table 4. The resequencing sequences of the parents "21E27" and "BW2" were analyzed by IGV alignment, and it was found that the molecular marker 21QP381 had a SNP site from C to G at position 76516913 of chromosome 10 in the eggplant genome HQ-1315 version. The genotype of green eggplant "BW2" at this site was "G / G", and the genotype of "21E27" at this site was "C / C".

[0107] In F2, F 2：3 、F 3：4 In the population, after 21QP381 genotyping, when the genotype is consistent with "BW2", the eggplant fruit is green, when the genotype is consistent with "21E27", the eggplant fruit is purple, and when the genotype is heterozygous, the eggplant fruit is purple. The corresponding relationship between genotype and phenotype is shown in Table 4, where A is the "BW2" genotype, that is, G / G, B is the "21E27" genotype, that is, "C / C", and H is the heterozygous genotype, that is, C / G. The genotyping results are shown in Figure 7 .

[0108] Table 4 Correspondence between genotype and phenotype of molecular marker 21QP381 in F2, F3 and F4 populations

[0109]

[0110] Therefore, 21QP381 can be used as a KASP molecular marker to identify whether eggplant peel contains anthocyanins. The primers for amplifying the KASP molecular marker include:

[0111] F P1 (SEQ ID NO:1):

[0112] GAAGGTGACCAAGTTCATGCT CAAAACATCCAAATTTGCCCATGG,

[0113] F P2 (SEQ ID NO:2):

[0114] GAAGGTCGGAGTCAACGGATT CAAAACATCCAAATTTGCCCATGC,

[0115] R (SEQ ID NO: 3):

[0116] GGGTACACATATACAAGGGTGACA.

[0117] Example 2 Validation of KASP molecular marker 21QP381 in natural populations of eggplant

[0118] The purple eggplant peel color is closely related to the anthocyanin content. In order to verify the applicability of the molecular marker, a total of 264 eggplant varieties from all over the country displayed at the 2021 Guangdong Seed Expo and the homozygous high-generation inbred lines constructed by the applicant's research group were used as materials. The list of eggplant materials is shown in Table 5.

[0119] Table 5 Natural population variety / inbred line information

[0120]

[0121]

[0122]

[0123]

[0124]

[0125]

[0126]

[0127] The eggplant genomic DNA was extracted using the modified CTAB method (see Example 1), and the natural population was genotyped using the molecular marker 21QP381 according to the KASP PCR amplification system and amplification program shown in Tables 2 and 3. The corresponding relationship between the genotyping results and the phenotypes is shown in Table 6.

[0128] Table 6 Correspondence between genotype and phenotype of molecular marker 21QP381 in natural populations

[0129]

[0130] As shown in Table 6, there were 22 strains with the "BW2(A)" genotype (2 strains with anthocyanins in the outer peel and 20 strains without anthocyanins), 238 strains with the "21E27(B)" genotype (235 strains with anthocyanins in the outer peel and 3 strains without anthocyanins), 3 strains with heterozygous genotypes (1 strain with anthocyanins in the outer peel and 2 strains without anthocyanins), and one strain with incorrect genotyping. The accuracy of genotype-phenotype correspondence was 97.35%. The genotyping results are shown in Table 6. Figure 7 .

[0131] Therefore, 21QP381 can be used as a molecular marker to identify whether eggplant peel contains anthocyanins.

[0132] The above-mentioned embodiments only express several implementation methods of the present invention, and the descriptions thereof are relatively specific and detailed, but they cannot be understood as limiting the scope of the invention patent. It should be pointed out that, for ordinary technicians in this field, several variations and improvements can be made without departing from the concept of the present invention, and these all belong to the protection scope of the present invention. Therefore, the protection scope of the patent of the present invention shall be subject to the attached claims.

Claims

1. A KASP molecular marker related to anthocyanins in eggplant peel, characterized in that: The KASP molecular marker is located at position 76516913 of chromosome 10 of the eggplant genome, and a point mutation of C→G occurs at the base at position 76516913.

2. A KASP primer for amplifying the above-mentioned KASP molecular marker related to anthocyanins in eggplant peel, characterized in that: The KASP primers include an upstream primer F as shown in SEQ ID NO:

1. P1 , an upstream primer F having a sequence as shown in SEQ ID NO: 2 P2 , and a downstream primer R whose sequence is shown in SEQ ID NO:

3.

3. Use of the KASP molecular marker according to claim 1 or the KASP primer according to claim 2 in early identification of eggplant peel color.

4. Use of the KASP molecular marker according to claim 1 or the KASP primer according to claim 2 in assisted breeding of eggplant varieties containing anthocyanins in the peel.

5. Use of the KASP molecular marker according to claim 1 or the KASP primer according to claim 2 in preparing a kit for detecting eggplant peel color.

6. A kit for detecting the color of eggplant peel, characterized in that: The invention comprises the KASP primers for amplifying the KASP molecular marker related to anthocyanins in eggplant peel as described in claim 2.

7. A method for identifying the color of eggplant peel, characterized in that: The following steps are involved: The DNA of the eggplant to be identified is used as a template, and the KASP primers described in claim 2 are used as amplification primers. After PCR amplification, the genotyping data is analyzed.

8. The method for identifying the color of eggplant peel according to claim 7, characterized in that: The PCR amplification reaction system includes: KASP MIX 2.5±0.1 μL, 8-12 μM upstream primer F p1 0.075±0.005μL, 8~12μM upstream primer F p2 0.075±0.005μL, 8-12μM downstream primer R 0.2±0.05μL, template DNA 2±0.2μL, ddH2O added to 5μL.

9. The method for identifying the color of eggplant peel according to claim 7, characterized in that: The reaction procedure of the PCR amplification is: Step 1: 94°C for 15 min; Step 2: 94℃ for 20s; Step 3: 78℃ for 10s; Step 4: 65℃1min; Go back to step 2, 10 cycles; Step 6: 94℃20s; Step 7: 57℃1min; Return to step 6 and repeat 30 times.

10. The method for identifying the color of eggplant peel according to any one of claims 7 to 9, characterized in that: The analysis of genotyping data comprises the following steps: when the genotype is G / G, the fruit peel color is green; when the genotype is C / C, the fruit peel color is purple-black; when the genotype is C / G, the fruit peel color is purple-black.

Images