Indel molecular marker closely linked with shape of fleshy root of radish and application of Indel molecular marker

Abstract

The invention belongs to the technical field of biology, and particularly relates to an Indel molecular marker closely linked with the shape of a fleshy root of a radish, a primer, a kit and a method for amplifying the Indel molecular marker and application of the Indel molecular marker. The first Indel marker and the second Indel marker are located in the 19.6-20.1 Mb interval of the chromosome 7 of the radish genome. The nucleotide sequence of the first Indel marker is deleted by 4bp in the extreme long radish compared with the nucleotide sequence of the first Indel marker in the extreme round radish; the nucleotide sequence of the second Indel marker is deleted by 25bp in the extreme long radish compared with the nucleotide sequence of the second Indel marker in the extreme round radish. Quantitative character sites for controlling the shape of the fleshy root of the radish are excavated, the molecular marker closely related to the root shape is developed, and materials with excellent root shape characters can be identified and selected more quickly and accurately, so that the breeding process is accelerated, and the breeding efficiency is improved.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology, and particularly relates to an Indel molecular marker closely linked to the shape of radish fleshy roots, and primers, a kit, a method and application for amplifying the Indel molecular marker. Background Art

[0002] Radish (Raphanus sativus L.) is an important vegetable crop native to my country, with an average annual planting area of ​​16 million mu. For a long time, it has not only been a staple vegetable to ensure the supply of autumn and winter vegetables in my country and increase farmers' income, but also a new type of vegetable that meets people's needs for a better life and good health. The edible organ of radish is the fleshy root. The root shape is an important trait that affects the commodity quality of radish. It not only determines the sensory quality of the product, but also affects the preferences of consumers, the efficiency of transportation and processing, and ultimately determines the market price of radish. Taking Changbai radish as an example, the straight root shape and the long cylindrical shape with a good tail are one of the characteristics that an excellent variety must have. Therefore, it is necessary to establish an efficient molecular-assisted breeding technology system for the shape of radish fleshy roots. Since radish root shape is a quantitative trait and is easily affected by environmental conditions, its phenotypic evaluation and related genetic research are relatively difficult, which seriously hinders the development of molecular markers closely related to root shape and the rapid identification and screening of root shape during breeding. Summary of the invention

[0003] In order to solve the above problems existing in the prior art, the present invention provides an Indel molecular marker closely linked to the shape of radish fleshy roots, and primers, a kit, a method and an application for amplifying the Indel molecular marker.

[0004] The first aspect of the present invention provides an Indel marker closely linked to the shape of radish fleshy roots, including a first Indel marker and / or a second Indel marker; the nucleotide sequence of the first Indel marker is not deleted and / or deleted TAAA, and the nucleotide sequence of the second Indel marker is not deleted and / or deleted CGCTTTTGCACCCTACCACCGTCGC.

[0005] The second aspect of the present invention provides a primer set for identifying / assisting in identifying the shape of radish fleshy roots, which is used to identify the first Indel marker and / or the second Indel marker provided in the first aspect of the present invention.

[0006] The third aspect of the present invention provides a kit for identifying / assisting in identifying the shape of radish fleshy roots, comprising the primer set provided by the second aspect of the present invention.

[0007] The fourth aspect of the present invention provides a method for identifying / assisting the shape of radish fleshy roots, comprising the use of the Indel marker tightly linked to the shape of radish fleshy roots provided by the first aspect of the present invention, and / or the primer set for identifying / assisting the shape of radish fleshy roots provided by the second aspect of the invention, and / or the kit for identifying / assisting the shape of radish fleshy roots provided by the third aspect of the present invention.

[0008] The fifth aspect of the present invention provides an application of the first Indel marker and / or the second Indel marker provided by the first aspect of the present invention, and / or the primer set for identifying the first Indel marker (RLin41) and / or the second Indel marker (RLin92) provided by the second aspect of the present invention, and / or the kit for identifying / assisting identification of radish fleshy root shape provided by the third aspect of the present invention, and / or the method for identifying / assisting identification of radish fleshy root shape provided by the fourth aspect of the present invention in the identification / assisting identification of radish fleshy root shape, and in radish breeding / assisting breeding.

[0009] Compared with the prior art, the present invention has the following beneficial effects:

[0010] 1. The present invention has discovered the quantitative trait loci that control the shape of radish fleshy roots and developed molecular markers closely related to root shape, which can more quickly and accurately identify and select materials with excellent root shape traits, thereby accelerating the breeding process and improving breeding efficiency.

[0011] 2. As consumers pay more attention to the shape of radish fleshy roots, the molecular markers of the present invention can help breeders quickly respond to market demand and improve the production efficiency of radishes with specific root shapes, thereby enhancing market competitiveness.

[0012] 3. The identification method of the present invention is simple to operate and saves resources; the various operation steps of the identification method work synergistically to achieve excellent results. BRIEF DESCRIPTION OF THE DRAWINGS

[0013] Figure 1 The following are photos of representative plants of the parents, F1 and F2 populations of Example 1 and a bar graph of the root shape index, root length and root width of radishes in the F2 population.

[0014] Figure 2 This is the root shape BSA-seq result diagram of Example 1.

[0015] Figure 3 This is the QTL linkage map of the root shape index in Example 1.

[0016] Figure 4This is an electrophoresis diagram of the PCR amplification product of the RLin41 marker of Example 2 of the present invention, which reflects the typing of the RLin41 marker on the parents (G27, G28) and F2 plants with different fleshy root shapes.

[0017] Figure 5 This is an electrophoresis diagram of the PCR amplification product of RLin92 primers in Example 2 of the present invention, which reflects the typing of RLin92 markers on parents (G27, G28) and F2 plants with different fleshy root shapes. DETAILED DESCRIPTION

[0018] To make the technical solution, purpose and advantages of the present invention clearer, the present invention is further described in detail below through specific implementation examples. It should be understood that the specific implementation methods described herein are only used to illustrate and explain the present invention, and are not used to limit the present invention.

[0019] In a first aspect, the present invention provides Indel molecular markers that are closely linked to the shape of radish fleshy roots, including a first Indel marker (RLin41) and / or a second Indel marker (RLin92).

[0020] The nucleotide sequence of the first Indel marker (RLin41) is not deleted and / or deleted TAAA, and the nucleotide sequence of the second Indel marker (RLin92) is not deleted and / or deleted CGCTTTTGCACCCTACCACCGTCGC.

[0021] As a preferred embodiment, the first Indel marker and the second Indel marker are both located in the 19.6-20.1Mb ​​interval of chromosome 7 of the radish genome. The nucleotide sequence of the first Indel marker (RLin41) lacks 4bp in the extremely elongated radish compared to the extremely round radish: TAAA; the nucleotide sequence of the second Indel marker (RLin92) lacks 25bp in the extremely elongated radish compared to the extremely round radish: CGCTTTTGCACCCTACCACCGTCGC.

[0022] As a preferred embodiment, the size of the first Indel marker (RLin41) in the extremely round radish is 187 bp, and its nucleotide sequence is shown in Sequence 1:

[0023] TGAAAGTCACGTATCTCCGACCTAATGTCATTCATTATGTAAGTTACAAACTTCTATCAACAGTTTTTCTGTGCTTTCAACAATATTTTCTGTGAATATCTTTTCATGGTAAG TAAATATTACCTCTGATCAGTAAATATTTATAATTATTTTTAAACTACAAAAGTGATTGGCTGGAGTGTAACA (sequence 1).

[0024] The size of the first Indel marker (RLin41) in the extremely elongated radish is 183 bp, and its nucleotide sequence is shown in Sequence 2:

[0025] TGAAAGTCACGTATCTCCGACCTAATGTCATTCATTATGTAAGTTACAAACTTCTATCAACAGTTTTTCTGTGCTTTCAACAATATTTTTCTGTGAATATCTTTTCATGGTAAGTATTACCTCTGATCAGTAAATATTTATAATTATTTTTAAACTACAAAAGTGATTGGCTGGAGTGTAACA (sequence 2).

[0026] As a preferred embodiment, the size of the second Indel marker (RLin92) in the extremely round radish is 166 bp, and its nucleotide sequence is shown in Sequence 3:

[0027] ACCAACGGCCCGTATATTCCGGCTACATAGACTCCTGGAGAAGACGAATATCCCGCCTTGAAGTGATCATCCT CGCTTTTGCACCCTACCACCGTCGC CAGCTTCCCGTTGACCGTTTTGGAGACAGCAGATACATCTCCGGAGATGAAGACGCCATTTGTCACCG (Sequence 3).

[0028] The size of the second Indel marker (RLin92) in the extremely elongated radish is 141 bp, and its nucleotide sequence is shown in SEQ ID NO:

[0029] ACCAACGGCCCGTATATTCCGGCTACATAGACTCCTGGAGAAGACG AATATCCCGCCTTGAAGTGATCATCCTCAGCTTCCCGTTGACCGTTTTGG AGACAGCAGATACATCTCCGGAGATGAAGACGCCATTTGTCACCG (Sequence 4).

[0030] In a second aspect of the present invention, a primer set for identifying the first Indel marker (RLin41) and / or the second Indel marker (RLin92) is provided, and the nucleotide sequences thereof are shown in the following sequences 5-8.

[0031] Primer set for identification of the first Indel marker (RLin41):

[0032] Forward primer: 5′-TGAAAGTCACGTATCTCCGACC-3′ (SEQ ID NO: 5);

[0033] Reverse primer: 5′-TGTTACACTCCAGCCAATCACT-3′ (SEQ ID NO: 6);

[0034] Primer set for identification of the second Indel marker (RLin92):

[0035] Forward primer: 5′-ACCAACGGCCCGTATATTCC-3′ (SEQ ID NO: 7);

[0036] Reverse primer: 5'-CGGTGACAAATGGCGTCTTC-3' (SEQ ID NO: 8).

[0037] The third aspect of the present invention provides a kit for identifying / assisting in identifying the shape of radish fleshy roots, the kit comprising the primer set for identifying the first Indel marker (RLin41) and / or the second Indel marker (RLin92) provided in the second aspect of the present invention.

[0038] According to the third aspect of the present invention, the kit may further include at least one of a PCR amplification buffer, dNTPs, and Taq enzyme.

[0039] In a fourth aspect, the present invention provides a method for identifying / assisting the shape of radish fleshy roots using the first Indel marker and / or the second Indel marker provided by the first aspect of the present invention, and / or the primer set for identifying the first Indel marker (RLin41) and / or the second Indel marker (RLin92) provided by the second aspect of the present invention, and / or the kit for identifying / assisting the shape of radish fleshy roots provided by the third aspect of the present invention.

[0040] According to the fourth aspect of the present invention, the method comprises the steps of performing PCR amplification reaction on the radish genome using the primer set of the first Indel marker and / or the second Indel marker provided by the second aspect of the present invention, and then detecting and analyzing the PCR amplification product.

[0041] As a preferred embodiment, the operation of detecting and analyzing the PCR amplification products may be, for example: performing electrophoresis (such as polypropylene gel electrophoresis) on the PCR amplification products and then detecting and analyzing the electrophoresis bands; or sequencing the PCR amplification products.

[0042] As a preferred embodiment, the reaction system (10 μL) of the PCR amplification reaction includes: 5 μL of Rapid TaqMaster Mix, 0.5 μL of forward primer, 0.5 μL of reverse primer, 100-200 ng of radish genomic DNA, and ddH2O to make up to 10 μL.

[0043] As a preferred embodiment, the PCR amplification program is: pre-denaturation at 94°C for 4 min; denaturation at 94°C for 15 s, annealing at 55°C for 15 s, extension at 72°C for 20 s, for a total of 35 cycles; extension at 72°C for 5 min; and storage at 4°C.

[0044] As a preferred embodiment, the operation of detecting and analyzing the PCR amplification product may include:

[0045] If the primer set used to amplify the first Indel marker (RLin41) amplifies a target band of 187 bp in size, and / or the primer set used to amplify the second Indel marker (RLin92) amplifies a target band of 166 bp in size, the fleshy root shape of the radish is extremely round;

[0046] If the primer set used to amplify the first Indel marker (RLin41) amplifies a target band of 183 bp in size, and / or the primer set used to amplify the second Indel marker (RLin92) amplifies a target band of 141 bp in size, the fleshy root shape of the radish is extremely elongated;

[0047] If the primer set used to amplify the first Indel marker (RLin41) amplifies two target bands of 187bp and 183bp in size, and / or the primer set used to amplify the second Indel marker (RLin92) amplifies two target bands of 166bp and 141bp in size, the shape of the fleshy root of radish is intermediate.

[0048] In a fifth aspect, the present invention provides a method of using the first Indel marker and / or the second Indel marker provided by the first aspect of the present invention, and / or the primer set for identifying the first Indel marker (RLin41) and / or the second Indel marker (RLin92) provided by the second aspect of the present invention, and / or the kit for identifying / assisting identification of the shape of radish fleshy roots provided by the third aspect of the present invention, and / or the method for identifying / assisting identification of the shape of radish fleshy roots provided by the fourth aspect of the present invention, in the identification / assisting identification of the shape of radish fleshy roots, and in radish breeding / assisting breeding.

[0049] The various reagents, materials, etc. used in the following examples, unless otherwise specified, are all products that can be obtained from commercial channels; the various tests and detection methods used in the following examples, unless otherwise specified, are all conventional tests and detection methods in the art and can be obtained from textbooks, reference books or academic journals.

[0050] Example 1

[0051] This embodiment is used to describe the process of obtaining the first Indel marker and the second Indel marker.

[0052] 1. Obtaining the root shape index

[0053] Two high-generation radish inbred lines G27 (oblate, female parent) and G28 (slender, male parent) were used as parent materials. G27 is the radish variety "Jinghong No. 6", and G28 is the radish variety "Jingyan Qiubai", both purchased from Jingyan Yinong (Beijing) Seed Technology Co., Ltd. The website showing the parents is as follows:

[0054] Jinghong No. 6: http: / / www.jyseeds.com / list_161 / 936.html;

[0055] Jingyan Qiubai: http: / / www.jyseeds.com / list_162 / 939.html.

[0056] G27 and G28 were used to construct the F1 and F2 segregating populations (e.g. Figure 1 The root length (the distance from the head of the main root to the end) and root diameter (maximum diameter) of the parents, offspring F1 and F2 segregating plants were measured, and the root shape index (RSI) was obtained by calculating the root length / root diameter ratio. The calculation formula of RSI is: RSI = root length / root diameter. According to the numerical range of RSI, the shape of radish fleshy roots is divided into: extremely round (0.8≤RSI≤1.5), extremely long (RSI>4), and intermediate (1.5<RSI≤4).

[0057] like Figure 1 As shown in the bar graph of the root shape index, root length and root width of radish in the F2 population, the root shape index (RSI), root length and root width in the F2 population all showed a continuous normal distribution; and the normal distribution is a continuous, symmetrical distribution pattern, which usually appears in natural populations. When a trait is controlled by multiple genes, and each gene contributes less to the trait, then the cumulative effect of these genes may cause the trait to show continuous variation in the population, thus forming a normal distribution; therefore, the above shows that radish length and round root shape are quantitative traits controlled by multiple genes.

[0058] 2. Obtaining the main QTL loci

[0059] 1. The CTAB method was used to extract DNA from the parents, extreme round and extreme long F2 generation plants, and the DNA of the extreme plants was mixed in equal amounts to construct the round R pool and the long L pool, respectively.

[0060] 2. The parental materials and the F2 population extreme root shape pool were resequenced with high-depth whole genome using the Illumina HiSeq 2500 sequencing platform. The radish "XYB36-2" was used as the reference genome (http: / / brassicadb.cn / ), and the obtained sequence data was compared with the reference genome, and SNPs were identified through the comparison algorithm.

[0061] 3. Calculate the SNP index according to the allele frequency of each SNP locus in the two mixed pools, and obtain the △(SNP-index) value according to the formula △(SNP-index)=SNP-index(extreme trait L)-SNP-index(extreme trait R). Select the 99% confidence level as the screening threshold, and obtain the main effect QTL loci related to the fleshy root shape of radish according to the △(SNP-index) value. Figure 2 As shown, the QTL significantly related to fleshy root shape was preliminarily located in the 15.94-20.40Mb interval of chromosome 7 using BSA seq technology and was named QTL7.1.

[0062] 4. Molecular markers were developed within the above-mentioned preliminary positioning interval using high-depth parental resequencing data and reference genome information. After screening out stable and repeatable markers by PCR amplification and typing verification of parents and some offspring individuals, typing analysis was performed on all F2 offspring individuals to obtain the genetic information of the markers in the offspring.

[0063] 5. Then, JoinMap 4.0 software was used for linkage mapping, and the Kosambi function was used to convert the recombination exchange rate into the genetic distance unit cM on the chromosome map. Subsequently, MapQTL 4.0 software was used for QTLs analysis. Figure 3 As shown, through these analyses, QTL7.1 was finely mapped to the 19.6-20.1 Mb interval on chromosome 7, which is located between Indel markers RLin41 and RLin92.

[0064] 3. Screening and obtaining Indel molecular markers and primers

[0065] The genomic DNA of young leaves of different radish genetic materials was extracted using the modified CTAB method (Aboul-Maaty, N.AF., Oraby, H.AS. Extraction of high-quality genomic DNA from different plant orders applying a modified CTAB-based method. Bull Natl Res Cent 43, 25(2019). https: / / doi.org / 10.1186 / s42269-019-0066-1), and the whole genomic DNA was dissolved using ddH2O.

[0066] 1. Using high-depth parental resequencing data and reference genome information, 22 pairs of primers were designed within the above-mentioned preliminary positioning interval to detect polymorphic Indel sites closely linked to the shape of radish fleshy roots; 22 molecular markers based on these polymorphic sites were further developed, as shown in Table 1.

[0067] Table 1: 22 pairs of primers for Indel markers

[0068] Marker Name Forward Primer (5'-3') Reverse Primer (5'-3') RLin-98 CTTTCATTCCACCTGCCAGC TATCACTGGTCAGTCCCCGA RLin-95 CCCCTGTGAACAAAACCACC ATACGATGAGCAGGCAGTGG RLin-92 ACCAACGGCCCGTATATTCC CGGTGACAAATGGCGTCTTC RLin-89 GAGAGAGAGAGAGCAACTGCA AGCAATAAGATCCCACAGTAGAAAGA RLin-153 GCTCTTGTTGCGATCTCTTCA CTTTCATTCGGCGGCTCATC RLin-41 TGAAAGTCACGTATCTCCGACC TGTTACACTCCAGCCAATCACT RLin-39 TGGTCAAGAAGTGGGCACT TGTCTGACTGCATAATATGAAACGG RLin-34 ACTGGTACAACACTGGCGTA CAACAGGTCTCACGGACTGT RLin-28 GCGGGCGTTTGAATACAGAT TGAAGTCAGCGTCAACGACT RLin-23 GATGGCCCATAATTGTGACCA CTCTGTTCCATAAAAACTATTTGACCA RLin-17 TGTAAGGAGGTTGTGTGTCGT TCTCTATGCACGCAGACACC RLin-14 ACCAATCGCCTTCCCTCTAG GGCCTGGGAGGTTTGATAGG RLin-101 CCCACGTTGAGGGTTATGGT ACGAACTCTCAACGTGGGTC RLin-137 AACAATCATCTTTGTTGGACAGAAAT TCCCCTCCCTCAAGTCAAAA RLin-124 TCCCAACTCTCGCAAACTCC AATCCAAACGTTTACATTGCTTCA RLin-7 CGCGAATGCTCATTTCCGTT CGTTTCTCCTTGCCTCTGGT RLin-121 AACCTTTGCCTTTGACTCGC TTGAAGGCTGCAAACAGGTG RLin-118 TCTGGTCAGGAGCTAACCTCT GCAAGTCTTCCGAGGCTTTG RLin-115 ATGGAGGCTACTTCTGTGGT GGTGAAATGAAGAAGCGAGCC RLin-5 CAGCAGTTTTAAGAATCTCAGCGA GCTGGTGACATTTGTCTCGG RLin-105 TCGTATCCAATGACTCACAAGCT AGGGCCAAATGACAGTTCGT RLin-1 GTCACAGGAGCAGAGCTTGA CAGTGAACGTTCGACTTGCC

[0069] 2. Extract genomic DNA from the above-mentioned parents and offspring F2 population, and use the above 22 pairs of primers to perform PCR amplification reaction.

[0070] The PCR amplification reaction system (10 μL) includes: Rapid Taq Master Mix 5 μL, forward primer 0.5 μL, reverse primer 0.5 μL, radish genomic DNA 100-200 ng, and ddH2O to make up to 10 μL.

[0071] The procedure of PCR amplification reaction was as follows: pre-denaturation at 94°C for 4 min; denaturation at 94°C for 15 s, annealing at 55°C for 15 s, extension at 72°C for 20 s, 35 cycles; extension at 72°C for 5 min; storage temperature at 4°C.

[0072] 3. The PCR amplification product was subjected to 8% polyacrylamide gel electrophoresis and separated at 160V constant power for 1.5h. After silver staining, the band type was counted under a film observation lamp. Finally, RLin41 and RLin92 linked to the trait of radish fleshy root shape were screened out as the Indel molecular markers of the present invention.

[0073] Example 2

[0074] This example is used to illustrate a method for identifying / assisting in identifying the shape of radish fleshy roots using a first Indel marker and a second Indel marker.

[0075] S1: 23 extremely long and 23 extremely round F2 generation radish plants (whose parents are the same as those in Example 1) were selected, and the genomic DNA of each radish plant was extracted according to the improved CTAB method of Example 1.

[0076] S2: Using the primer sets for amplifying the RLin41 marker and the RLin92 marker, respectively, and taking each radish genome as a template, a PCR amplification reaction is performed according to the PCR amplification reaction system and procedure of Example 1 to obtain the PCR amplification products of each individual plant.

[0077] S3: The above PCR amplification products were subjected to 8% polyacrylamide gel electrophoresis at 160V constant power for 1.5h, and then silver-stained.

[0078] S4: Detect the electrophoresis bands under the film observation light, perform band type statistics, and analyze and determine the genotype of each allele.

[0079] The above belt types are divided into:

[0080] Type a: The band pattern is consistent with that of the circular parent, that is, the primer set used to amplify the Rlin41 marker amplifies a target band of 187 bp, and the primer set used to amplify the Rlin92 marker amplifies a band of 166 bp;

[0081] Type b: The band pattern is consistent with that of the long parent, that is, the primer set used to amplify the Rlin41 marker amplifies a target band of 183 bp, and the primer set used to amplify the Rlin92 marker amplifies a band of 141 bp;

[0082] Type h: heterozygous banding type, that is, the primer set used to amplify the Rlin41 marker amplifies two target bands of 187 bp and 183 bp, and / or the primer set used to amplify the Rlin92 marker amplifies two target bands of 166 bp and 141 bp.

[0083] The results showed (see Table 2) that among the 23 extremely round plants, 19 were consistent with the round parent G27, and 4 were heterozygous; among the 23 extremely elongated plants, 20 were consistent with the elongated parent G28, and 3 were heterozygous plants; that is, the marker typing accuracy rate reached (46-4-3) / 46=84.8%; by comparing the fleshy root shape and indel marker typing test results, it was proved that the indel marker was closely related to the fleshy root shape, and the indel marker could be used to identify / assist in the identification of the fleshy root shape of radish.

[0084] Table 2: Genotype statistics of indel markers RLin41 and RLin92 in extreme pools

[0085]

[0086]

[0087] In Table 2, the DNA electrophoresis bands of each individual strain in the extreme circular pool are shown in the following order from top to bottom: Figure 4 The 1st to 23rd columns of the R pool marked with numbers in Figure 5 The 1st to 23rd columns of the R pool are marked with numbers in the figure; the DNA electrophoresis bands of each individual strain in the extremely long pool are shown in the figure from top to bottom. Figure 4 The 1st to 23rd columns of Lpool marked with numbers in Figure 5 Columns 1 to 23 of the L pool are marked with numbers.

[0088] like Figure 4 As shown, PCR amplification was performed using the primer set for amplifying the RLin41 marker. Parent G27 only amplified a target band of 187 bp, and parent G28 only amplified a band of 183 bp; the 2nd, 4th, 12th, and 17th columns of the extreme circular pool all amplified target bands of 187 bp and 183 bp (the two bands were too close to be connected as one), and the other extreme circular pools only amplified a target band of 187 bp; the 8th, 11th, and 18th columns of the extreme elongated pool all amplified target bands of 187 bp and 183 bp, and the other extreme elongated pools only amplified a target band of 183 bp.

[0089] like Figure 5 As shown, using primer RLin92 for PCR amplification, parent G27 only amplified a target band of 166 bp, and parent G28 only amplified a band of 141 bp; the 2nd, 4th, 12th, and 17th columns of the extreme circular pool amplified target bands of 166 bp and 141 bp, and other extreme circular pools only amplified a target band of 166 bp; the 8th, 11th, and 18th columns of the extreme elongated pool amplified target bands of 166 bp and 141 bp, and other extreme elongated pools only amplified a target band of 141 bp.

[0090] It can be seen from this that the root shape of the radish plant for which only a target band of 187 bp was obtained by PCR amplification using the primer set for amplifying the RLin41 marker, and the root shape of the radish plant for which only a target band of 166 bp was obtained by PCR amplification using the primer set for amplifying the RLin92 marker, were both extremely round; the root shape of the radish plant for which only a target band of 183 bp was obtained by PCR amplification using the primer set for amplifying the RLin41 marker, and the root shape of the radish plant for which only a target band of 141 bp was obtained by PCR amplification using the primer set for amplifying the RLin92 marker, were both extremely long; therefore, the RLin41 marker, RLin92 marker and the corresponding primer sets can be used to identify extremely round and extremely long radish root shapes.

[0091] Example 3

[0092] This example is used to illustrate the practical application of the method of using the first Indel marker and the second Indel marker to identify / assist in identifying the shape of radish fleshy roots in the process of radish backcross breeding.

[0093] Taking the example of combining disease resistance (clubroot) with round root shape (i.e., breeding a stable round-root radish variety resistant to clubroot), the extremely round clubroot-susceptible material R046 (RSI is 0.9) was used as the female parent and the extremely elongated clubroot-resistant material R055 (RSI is 7.5) was used as the male parent to hybridize to obtain F1, which was then self-pollinated to obtain F2.

[0094] S1: 100 F2 generation radish seed samples were selected and sown in plug trays. Leaves of radish seedlings were collected and genomic DNA of each radish plant was extracted according to the method of Example 1.

[0095] S2-S4: Perform the operations of S2-S4 in Example 2.

[0096] The results showed that among the 100 samples, 25 were of band type a, 25 were of band type b, and 50 were of band type h.

[0097] The seedlings with band type a were planted in the experimental field, and after the radish grew to maturity, the radish fleshy roots were collected, and the root shape index was calculated and the number of various root shapes was counted according to the method in Example 1. The results showed that among the 25 radishes with band type a, 23 had extremely round fleshy roots (RSI was within the range of 1.0-1.4), indicating that the method provided by the present invention can more accurately identify the shape of radish fleshy roots, and the method can be applied to molecular marker-assisted breeding of radish fleshy root shape.

[0098] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. For those skilled in the art, the present invention may have various modifications and variations. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present invention shall be included in the protection scope of the present invention.

Claims

1. Indel markers closely linked to the shape of radish fleshy roots, including a first Indel marker and / or a second Indel marker; the nucleotide sequence of the first Indel marker is not deleted and / or deleted TAAA, and the nucleotide sequence of the second Indel marker is not deleted and / or deleted CGCTTTTGCACCCTACCACCGTCGC.

2. The Indel marker according to claim 1, characterized in that: The nucleotide sequence of the first Indel marker is shown in SEQ ID NO: 1 and / or SEQ ID NO: 2; The nucleotide sequence of the second Indel marker is shown in SEQ ID NO: 3 and / or SEQ ID NO:

4.

3. A primer set for identifying / assisting in identifying the shape of radish fleshy roots, characterized in that: The primer set is used to identify the first Indel marker and / or the second Indel marker according to claim 2.

4. The Indel primer according to claim 3, characterized in that: Primer set for identifying the first Indel marker: The forward primer was: 5′-TGAAAGTCACGTATCTCCGACC-3′; The reverse primer was: 5′-TGTTACACTCCAGCCAATCACT-3′; Primer set for identifying the second Indel marker: The forward primer was: 5′-ACCAACGGCCCGTATATTCC-3′; The reverse primer was: 5'-CGGTGACAAATGGCGTCTTC-3'.

5. A kit for identifying / assisting in identifying the shape of radish fleshy roots, characterized in that: The kit comprises the primer set according to claim 3 or 4.

6. The kit according to claim 5, characterized in that: The kit further comprises at least one of a PCR amplification buffer, dNTPs and a Taq enzyme.

7. A method for identifying / assisting in identifying the shape of radish fleshy roots, characterized in that: The method comprises the operation of using the Indel marker tightly linked to the shape of radish fleshy roots as described in claim 1 or 2, and / or the primer set for identifying / assisting in identifying the shape of radish fleshy roots as described in claim 3 or 4, and / or the kit for identifying / assisting in identifying the shape of radish fleshy roots as described in claim 5 or 6.

8. The method according to claim 7, characterized in that: The method comprises using the radish genome as a template, using the primer set of claim 4 to perform a PCR amplification reaction on the radish genome, then detecting and analyzing the PCR amplification product, and identifying it according to the following judgment method: If the primer set used to amplify the first Indel marker amplifies a target band of 187 bp in size, and / or the primer set used to amplify the second Indel marker amplifies a target band of 166 bp in size, the fleshy root of the radish is extremely round in shape; If the primer set used to amplify the first Indel marker amplifies a target band with a size of 183 bp, and / or the primer set used to amplify the second Indel marker amplifies a target band with a size of 141 bp, the shape of the fleshy root of the radish is extremely elongated; If the primer set used to amplify the first Indel marker simultaneously amplifies two target bands of 187 bp and 183 bp in size, and / or the primer set used to amplify the second Indel marker simultaneously amplifies two target bands of 166 bp and 141 bp in size, the shape of the fleshy root of the radish is intermediate.

9. The method according to claim 7 or 8, characterized in that: The procedure of the PCR amplification reaction is: pre-denaturation at 94°C for 4 min; denaturation at 94°C for 15 s, annealing at 55°C for 15 s, extension at 72°C for 20 s, for a total of 35 cycles; extension at 72°C for 5 min; and storage temperature at 4°C.

10. Use of the first Indel marker and / or the second Indel marker according to claim 1 or 2, the primer according to claim 3 or 4, the kit according to claim 5 or 6, and the method according to any one of claims 7 to 9 in identification / assisted identification of radish fleshy root shape, and in radish breeding / assisted breeding.

Images