Bacillus subtilis capable of producing cellulase at high yield as well as construction method and application of bacillus subtilis

Abstract

The invention relates to bacillus subtilis for high-yield cellulase as well as a construction method and application of the bacillus subtilis, and belongs to the technical field of microbial genetic engineering. The invention provides bacillus subtilis K3P2C capable of realizing high yield of cellulase, which is preserved in the China Center for Type Culture Collection (CCTCC), and the preservation number is CCTCC No.M20241787. The bacillus subtilis K3P2C has the advantages that the bacillus subtilis K3P2C is capable of realizing high yield of cellulase, and the preservation number is CCTCC No.M20241787; the bacillus subtilis K3P2C disclosed by the invention can be used for producing cellulase with high yield and high activity, can be used for effectively degrading a lignocellulose structure on the surface layer of the crop straw, and has an important effect on improving the physical and chemical properties of the crop straw.

Description

Technical Field

[0001] The invention relates to the technical field of microbial genetic engineering, and in particular to a Bacillus subtilis with high cellulase production, and a construction method and application thereof. Background Art

[0002] Wheat straw is a common agricultural waste and biomass energy source, with cellulose, hemicellulose and lignin contents of 35% to 40%, 20% to 30% and 8% to 15% respectively, and is rich in mineral elements such as calcium, phosphorus, potassium and magnesium. However, due to the close interweaving of cellulose, hemicellulose and lignin, the molecular structure of wheat straw is extremely stable, and it is difficult to effectively degrade and utilize it by mechanical methods. Therefore, it is usually burned or buried, resulting in resource waste and environmental pollution.

[0003] Cellulase is a complex enzyme system composed of multiple synergistic enzymes. It belongs to the glycoside hydrolase (GHs, EC3.2.1) in carbohydrate enzymes (CAZymes). It can catalyze and degrade cellulose and its derivatives. According to the functional differences of the cellulase system, it can be divided into endo-β-1,4-glucanase (EG, EC3.2.1.4), exo-β-1,4-glucanase (CBH, EC3.2.1.91) and β-glucosidase (CB, EC3.2.1.21). Studies have found that the complete degradation of cellulose macromolecules into glucose requires the synergistic action of the above enzyme systems, specifically: EG randomly cleaves the β-1,4 glycosidic bonds in the non-crystalline region of cellulose to produce oligosaccharides, which are then further degraded by CBH and degraded from the non-reducing sugar end of cellulose to produce cellobiose. CB then acts on cellobiose and produces glucose monomers, thus completing the entire degradation process. In the natural environment, cellulose in organic waste or biomass is mainly degraded by cellulase produced by various bacteria, fungi, animals and plants. However, the cellulase produced by microorganisms, animals and plants often has a low content and a single enzyme system, and cannot efficiently degrade cellulose.

[0004] Although Bacillus subtilis can be used to express heterologous cellulase genes, and even some wild Bacillus subtilis can produce cellulase, the metabolic mechanisms and metabolites of wild strains have not been fully studied and have not passed safety assessments, so there are certain risks in industrial applications. Summary of the invention

[0005] The purpose of the present invention is to provide a Bacillus subtilis with high cellulase production and a construction method and application thereof, so as to solve the problems that the cellulase produced by the prior art has a single type, low yield and degradation activity, and insufficient safety in industrial application.

[0006] In order to achieve the above-mentioned object of the invention, the present invention provides the following technical solutions:

[0007] The invention provides a Bacillus subtilis with high cellulase production, wherein the Bacillus subtilis is Bacillus subtilis K3P2C, which is deposited in China Center for Type Culture Collection, with a deposit address of Wuhan University, Wuhan, China, a deposit date of August 14, 2024, and a deposit number of CCTCC No.M20241787.

[0008] The present invention also provides the use of the Bacillus subtilis in preparing a high-yield cellulase preparation;

[0009] The cellulase comprises one or more of endo-β-1,4-glucanase, exo-β-1,4-glucanase and β-glucosidase.

[0010] The present invention also provides a method for constructing the Bacillus subtilis, comprising the following steps:

[0011] (1) Insert the gene expression cassette P 12 -BglC-2006-TB4, P 12 -LipA-2006-TB4 and P 43 -YwbN-Bf1-TH1 was knocked into Bacillus subtilis 168 to obtain the recombinant bacterium BSKI3Cel;

[0012] (2) The cellulase expression vector pJOE2006Bf was transformed into the recombinant bacterium BSKI3Cel to obtain Bacillus subtilis K3P2C.

[0013] Preferably, the P 12 - The nucleotide sequence of BglC-2006-TB4 is shown in SEQ ID NO.1;

[0014] The P 12 - The nucleotide sequence of LipA-2006-TB4 is shown in SEQ ID NO.2;

[0015] The P 43 The nucleotide sequence of -YwbN-Bf1-TH1 is shown in SEQ ID NO.3.

[0016] Preferably, P 12 - BglC-2006-TB4 was knocked into the sprE locus of Bacillus subtilis 168 strain;

[0017] P 12- LipA-2006-TB4 was knocked into the lacZ site of Bacillus subtilis 168 strain;

[0018] P 43 -YwbN-Bf1-TH1 was knocked into the thrC site of Bacillus subtilis 168 strain.

[0019] Preferably, the cellulase expression vector pJOE2006Bf in step (2) is constructed by: inserting the gene expression cassette P 12 -BglC-2006-TB4, P 12 -LipA-2006-TB4 was connected with the pJOE8999 shuttle expression vector to obtain the cellulase expression vector pJOE2006Bf.

[0020] The present invention also provides the application of the construction method in preparing a high-yield cellulase preparation;

[0021] The cellulase comprises one or more of endo-β-1,4-glucanase, exo-β-1,4-glucanase and β-glucosidase.

[0022] The present invention also provides a bacterial agent for high-yield cellulase, wherein the bacterial agent comprises the Bacillus subtilis.

[0023] The present invention also provides the Bacillus subtilis, the Bacillus subtilis K3P2C prepared by the construction method, and the use of the bacterial agent in degrading crop straw.

[0024] The present invention has the following technical effects and advantages:

[0025] The present invention is based on Bacillus subtilis 168 strain, and different cellulase genes are expressed in the strain through CRISPR / Cas9 gene editing and vector expression technology, and the expression amount of cellulase is increased by knock-in site optimization, signal peptide optimization, terminator optimization, etc., so as to construct a Bacillus subtilis K3P2C strain with high cellulase production;

[0026] The Bacillus subtilis K3P2C constructed by the present invention can produce high-yield and high-activity endo-β-1,4-glucanase, exo-β-1,4-glucanase and β-glucosidase, can effectively degrade hemicellulose, neutral detergent fiber and acid detergent fiber in crop straws, significantly improve the pH of fermentation products, can make the components such as cellulose, hemicellulose, lignin and pectin in the surface layer of crop straws disappear during enzymatic hydrolysis and fermentation, more effectively degrade the lignocellulose structure of the surface layer of crop straws, promote the increase of voids and the enlargement of pore size, thereby helping to improve the adsorption performance of crop straws to microorganisms and digestive enzymes, and playing an important role in improving the physical and chemical properties of crop straws. BRIEF DESCRIPTION OF THE DRAWINGS

[0027] Figure 1 This is the JOEKI2006 vector map;

[0028] Figure 2 The construction process of each vector and strain;

[0029] Figure 3 is the endo-β-1,4-glucanase activity of each strain, where A is the EG activity of each gene-edited single-site strain, and B is the EG activity of each gene-edited dual-site strain;

[0030] Figure 4 is the β-glucosidase activity of each strain, where A is the CB activity of each gene-edited single-site strain, and B is the CB activity of each gene-edited dual-site strain;

[0031] Figure 5 is the cellulase activity of strains expressing various cellulases, where A is the EG activity of each strain, B is the CBH activity of each strain, and C is the CB activity of each strain;

[0032] Figure 6 are the cellulase activities of the recombinant bacteria BSKI3Cel and Bacillus subtilis K3P2C at different times, wherein A is the EG activity of the recombinant bacteria BSKI3Cel and Bacillus subtilis K3P2C at different times, B is the CBH activity of the recombinant bacteria BSKI3Cel and Bacillus subtilis K3P2C at different times, and C is the CB activity of the recombinant bacteria BSKI3Cel and Bacillus subtilis K3P2C at different times;

[0033] Figure 7 This is the surface structure of wheat straw after being degraded by Bacillus subtilis, where A is the EB0 group, B is the EB4 group, C is the EB8 group, and D is the WT8 group. DETAILED DESCRIPTION

[0034] The invention provides a Bacillus subtilis with high cellulase production, wherein the Bacillus subtilis is Bacillus subtilis K3P2C, which is deposited in China Center for Type Culture Collection, with a deposit address of Wuhan University, Wuhan, China, a deposit date of August 14, 2024, and a deposit number of CCTCC No.M20241787.

[0035] The present invention also provides the use of the Bacillus subtilis in preparing a high-yield cellulase preparation;

[0036] The cellulase comprises one or more of endo-β-1,4-glucanase, exo-β-1,4-glucanase and β-glucosidase.

[0037] The present invention also provides a method for constructing the Bacillus subtilis, comprising the following steps:

[0038] (1) Insert the gene expression cassette P 12 -BglC-2006-TB4, P 12 -LipA-2006-TB4 and P 43 -YwbN-Bf1-TH1 was knocked into Bacillus subtilis 168 to obtain the recombinant bacterium BSKI3Cel;

[0039] (2) The cellulase expression vector pJOE2006Bf was transformed into the recombinant bacterium BSKI3Cel to obtain Bacillus subtilis K3P2C.

[0040] In the present invention, the P 12 - The nucleotide sequence of BglC-2006-TB4 is shown in SEQ ID NO.1;

[0041] The P 12 - The nucleotide sequence of LipA-2006-TB4 is shown in SEQ ID NO.2;

[0042] The P 43 The nucleotide sequence of -YwbN-Bf1-TH1 is shown in SEQ ID NO.3.

[0043] In the present invention, P 12 - BglC-2006-TB4 was knocked into the sprE site of Bacillus subtilis 168 strain;

[0044] P 12- LipA-2006-TB4 was knocked into the lacZ site of Bacillus subtilis 168 strain;

[0045] P 43 -YwbN-Bf1-TH1 was knocked into the thrC site of Bacillus subtilis 168 strain.

[0046] In the present invention, the cellulase expression vector pJOE2006Bf described in step (2) is constructed by: inserting the gene expression cassette P 12 -BglC-2006-TB4, P 12 -LipA-2006-TB4 was connected with the pJOE8999 shuttle expression vector to obtain the cellulase expression vector pJOE2006Bf.

[0047] The present invention also provides the application of the construction method in preparing a high-yield cellulase preparation;

[0048] The cellulase comprises one or more of endo-β-1,4-glucanase, exo-β-1,4-glucanase and β-glucosidase.

[0049] The present invention also provides a bacterial agent for high-yield cellulase, wherein the bacterial agent comprises the Bacillus subtilis.

[0050] The present invention also provides the Bacillus subtilis, the Bacillus subtilis K3P2C prepared by the construction method, and the use of the bacterial agent in degrading crop straw.

[0051] The technical solutions provided by the present invention are described in detail below in conjunction with the embodiments, but they should not be construed as limiting the protection scope of the present invention.

[0052] Among the strains of the present invention, Bacillus subtilis RLI2019 strain and B. subtilis 168 strain were both from Northwest Agriculture and Forestry University, and Escherichia coli JM109 competent cells and E. coli JM110 competent cells were purchased from Shanghai Angyu Biotechnology Co., Ltd.;

[0053] Among the reagents of the present invention, LB culture medium was purchased from Qingdao High-Tech Industrial Park Haibo Biotechnology Co., Ltd., 2×PhantaMax MasterMix (item number: P515) used for amplifying the target fragment, 2×RapidTaqMasterMix (item number: P222) used for vector identification, and Mut ExpressⅡFastMutagenesis KitV2 (item number: C214) used for point mutation were purchased from Nanjing Novogene Biotechnology Co., Ltd., the seamless cloning kit (item number: 10912ES) used for vector connection was purchased from Yisheng Biotechnology (Shanghai) Co., Ltd., SanPrep ColumnPlasmid Mini-Preps Kit (item number: B518191) used for plasmid extraction, and SanPrep ColumnPlasmid Mini-Preps Kit (item number: B518191) used for gel recovery DNA Gel Extraction Kit (Cat. No.: B518131) was purchased from Sangon Biotech (Shanghai) Co., Ltd., hemicellulose content detection kit (Cat. No.: BC4440) and lignin content detection kit (Cat. No.: BC4200) were purchased from Beijing Solebow Technology Co., Ltd., conductive gel was purchased from Nissin Co., Ltd., Japan, and pET-Bf vector was synthesized by Beijing Qingke Biotechnology Co., Ltd.

[0054] Among the instruments of the present invention, the A200I fiber analyzer was purchased from ANKOM, USA, and the Nano SEM-450 field emission scanning electron microscope was purchased from Thermo, USA;

[0055] The primer sequences of the present invention were all commissioned to be synthesized by Sangon Biotechnology (Shanghai) Co., Ltd.

[0056] Example 1: Construction and transformation of gene editing vector JOEKI2006

[0057] The coding sequences of the endoglucanase gene 2006 from Bacillus subtilis RLI2019 strain (NCBI GenBank ID: CP123621.1) and the endoglucanase gene from B. subtilis 168 strain (NCBI GenBank ID: CP136402.1) were downloaded from NCBI for comparison, and the sgRNA primers sgeglSF / sgeglSR targeting the eglS site of B. subtilis 168 strain were designed. After annealing, sgeglS (as shown in SEQ ID NO.4) was obtained. The primers were prepared according to the method described by Altenbuchner in the literature (Altenbuchner J. Editing of the Bacillus subtilis genome by the CRISPR-Cas9 system [J]. Appl Environ Microb, 2016, 82(17): 1-7) was used to connect sgeglS to the pJOE8999 shuttle expression vector backbone, and the vector JOEsgeglS was obtained after identification with primer JDsgRNA; the 2006 gene expression cassette, upstream homology arms and downstream homology arms were amplified using primers FUHA2006F / FDHA2006R with B. subtilis RLI2019 strain as a template, and the JOEsgeglS vector backbone was amplified using primers FDHAJOEF2 / FJOE2006R with the JOEsgeglS vector as a template, and the two were connected to obtain the vector JOEKI2006 (such as Figure 1 ); the JOEKI2006 vector was transformed into Escherichiacoli JM109 competent cells, and the plasmid was extracted after identification using primers JDKIF / JDKIR, and then the plasmid was transformed into E.coli JM110 competent cells to obtain a demethylated plasmid; the demethylated plasmid was transformed into B.subtilis 168 strain and inoculated into LB medium containing 0.2% D-mannose for culture and Cas9 gene induction expression, and then the B.subtilis 168 strain was cultured at 50°C for 20h to obtain the BSKI2006 strain; the BSKI2006 strain was continuously subcultured 10 times at 37°C and 220rpm, each culture for 24h, and then the cellulase activity of the BSKI2006 strain was detected to identify the genetic stability. The primer sequences and strains are shown in Tables 1-2.

[0058] The nucleotide sequence of sgeglS is shown in SEQ ID NO.4.

[0059] SEQ ID NO.4:TTAGTTAAGCTTTTTTTTGG

[0060] Example 2: Expression and Optimization of Endoglucanase Gene 2006

[0061] sgRNA primers sgsprEF / sgsprER, sgnprEF / sgnprER, sgthrCF / sgthrCR, sglacZF / sglacZR targeting sprE, nprE, thrC, and lacZ sites of B. subtilis 168 strain were designed respectively, and sgsprE, sgnprE, sgthrC, and sglacZ (as shown in SEQ ID NOs. 5 to 8) were annealed. Each sgRNA was connected to the pJOE8999 shuttle expression vector backbone according to the method described in Example 1 to obtain vectors JOEsgsprE, JOEsgnprE, JOEsgthrC, and JOEsglacZ; primers FJOEUHAsprF / FP were used to express B. subtilis 168 strain as a template. 43 UHAsprR、FUHAsprP 43 F / FblCP 43 R, F2006DHAsprF / FJOEDHAsprR respectively amplified the upstream homology arm targeting sprE site, P 43 promoter, targeting the downstream homology arm of the sprE site, using the B. subtilis RLI2019 strain as a template using primers FP 43 The 2006 gene (including the signal peptide BglC) was amplified using primers FDHAJOEF / FUHAJOER2 with the JOEsgsprE vector as a template, and the vector JOEsprP was obtained after ligation. 43 BglC2006 was transformed into BSsprP according to the method described in Example 1 43 BglC2006 strain.

[0062] Using B. subtilis 168 as a template and primers FP 43 PhoBF / F2006PhoBR、FP 43 PhoDF / F2006PhoDR、FP 43 YwbF / F2006YwbR、FP 43 LipF / F2006LipR amplified the signal peptides PhoB, PhoD, YwbN, and LipA respectively, and used JOESprP 43 BglC2006 vector was used as template and primers FSP2006F / FSPP 43 R respectively amplified the JOESprP used to connect the signal peptides PhoB, YwbN, and LipA 43BglC2006 vector backbone, using primers FSP2006F / FphoDP 43 R amplification of JOESprP for ligation of signal peptide PhoD 43 BglC2006 vector backbone, and the vector JOEsprP 43 PhoB2006、JOEsprP 43 PhoD2006、JOEsprP 43 Ywb2006、JOEsprP 43 Lip2006, respectively, to obtain BSsprP 43 PhoB2006、BSsprP 43 PhoD2006、BSsprP 43 Ywb2006、BSsprP 43 Lip2006 strain.

[0063] Using B. subtilis 168 as template and primers FJOEUHAlacF / FP 43 UHAlacR and F2006DHAlacF / FJOEDHAlacR respectively amplified the upstream homology arm targeting the lacZ site and the downstream homology arm targeting the lacZ site, and JOEsprP 43 BglC2006 vector was used as template and primers FUHAlacP 43 F / FDHA2006R2 amplified P 43 -BglC-2006 gene expression cassette, using JOEsglacZ vector as template and primers FDHAJOEF / FUHAJOER2 to amplify JOEsglacZ vector backbone, and then connect to obtain vector JOElacP 43 BglC2006, transformed to obtain BSlacP 43 BglC2006 strain.

[0064] Using B. subtilis 168 as template and primers FJOEUHAthrF / FP 43 UHAthrR and F2006DHAthrF / FJOEDHAthrR respectively amplified the upstream homology arm targeting the thrC site and the downstream homology arm targeting the thrC site, and JOESprP 43 BglC2006 vector was used as template and primer FUHAthrP 43 F / FDHAthr2006R amplification P 43-BglC-2006 gene expression cassette, using JOEsgthrC vector as template and primers FDHAJOEF / FUHAJOER2 to amplify JOEsgthrC vector backbone, and then connect to obtain vector JOEthrP 43 BglC2006, transformed to obtain BThrP 43 BglC2006 strain.

[0065] Using B. subtilis 168 as template and primers FJOEUHAnprF / FP 43 UHAnprR and F2006DHAnprF / FJOEDHAnprR amplified the upstream homology arm targeting the nprE site and the downstream homology arm targeting the nprE site, respectively, and JOEsprP 43 BglC2006 vector was used as template and primers FUHAnprP 43 F / FDHAnpr2006R amplification 43 -BglC-2006 gene expression cassette, using JOEsgnprE vector as template and primers FDHAJOEF / FUHAJOER2 to amplify JOEsgnprE vector backbone, and then connect to obtain vector JOEnprP 43 BglC2006, transformed to BSnprP 43 BglC2006 strain.

[0066] JOEsprP 43 The BglC2006 vector was used as a template and primers M2006TB9F / M2006TB9R, M2006TB4F / M2006TB4R, M2006TB5F / M2006TB5R, and M2006TH1F / M2006TH1R were used in JOESprP 43 The terminators TB9, TB4, TB5, and TH1 were introduced into the end of the 2006 gene of the BglC2006 vector by point mutation, thereby obtaining the vectors JOEsprP 43 BglC2006TB9、JOEsprP 43 BglC2006TB4、JOEsprP 43 BglC2006TB5、JOEsprP 43 BglC2006TH1, BSsprP 43 BglC2006TB9、BSsprP 43 BglC2006TB4、BSsprP 43 BglC2006TB5、BSsprP 43 BglC2006TH1 strain.

[0067] Referring to the method disclosed in Xiao et al. (Xiao J, Peng B, Su Z, et al. Facilitating protein expression with portable 5'-UTR secondary structures in Bacillus licheniformis [J]. Acs Synth Biol, 2020, 9 (5): 1051-1058), primers MP 4312 eglSF / MP 4312 RJOEsprP 43 The 5'-UTR of the BglC2006TB4 vector was replaced with UTR-12, thereby converting P 43 Promoter optimization to P 12 Promoter, get vector JOEsprP 12 BglC2006TB4, transformed to obtain BSsprP 12 BglC2006TB4 strain.

[0068] JOEsprP 12 BglC2006TB4 vector was used as template and primers PJOEP 12 F / PJOETB4R amplification 12 -BglC-2006-TB4 gene expression cassette (as shown in SEQ ID NO.1), using pJOE8999 shuttle expression vector as template and primers PTeJOEF / PP 12 JOER amplified the pJOE8999 shuttle expression vector backbone without the Cas9 gene and connected it to obtain the vector pJOEP 12 BglC2006TB4, after transformation, obtained BSpP 12 BglC2006TB4 strain.

[0069] JOEsprP 12 BglC2006TB4 vector was used as template and primers FUHAlacP 12 F / FDHAlacTB4R amplification P 12 -BglC-2006-TB4 gene expression cassette, with JOElacP 43 BglC2006 vector was used as template and primers FTH1DHAlacF / FP were used. 12 lacR amplification JOElacP 43 BglC2006 vector backbone, after ligation, the vector JOElacP 12 BglC2006TB4. Using B. subtilis 168 strain as template and primers FP12 PhoBF / F2006PhoBR、FP 12 PhoDF / F2006PhoDR、FP 12 YwbF / F2006YwbR、FP 12 LipF / F2006LipR amplified the signal peptides PhoB, PhoD, YwbN, and LipA respectively, and used JOElacP 12 BglC2006TB4 vector was used as template and primers FSP2006F / FSPP 12 R amplification of JOElacP for connecting signal peptides PhoB, PhoD, YwbN, LipA 12 BglC2006TB4 vector backbone, JOElacP 12 PhoB2006TB4、JOElacP 12 PhoD2006TB4、JOElacP 12 Ywb2006TB4、JOElacP 12 Lip2006TB4;JOElacP 12 BglC2006TB4、JOElacP 12 PhoB2006TB4、JOElacP 12 PhoD2006TB4、JOElacP 12 Ywb2006TB4、JOElacP 12 Lip2006TB4 and JOEKI2006 vectors were respectively 12 The BglC2006TB4 strain was expressed to obtain BSsprlacBglC2006, BSsprlacPhoB2006, BSsprlacPhoD2006, BSsprlacYwb2006, BSsprlacLip2006, and BSspreglS2006 strains. Figure 2 The primer sequences and strains are shown in Tables 1-2.

[0070] P 12 -The nucleotide sequence of the BglC-2006-TB4 gene expression cassette is shown in SEQ ID NO.1.

[0071] SEQ ID NO.1:

[0072]

[0073] The nucleotide sequence of sgsprE is shown in SEQ ID NO.5.

[0074] SEQ ID NO.5: GAGTGAGAAGCAAAAAATTG

[0075] The nucleotide sequence of sgnprE is shown in SEQ ID NO.6.

[0076] SEQ ID NO.6: GAAAGCACGACTGATGCCCT

[0077] The nucleotide sequence of sgthrC is shown in SEQ ID NO.7.

[0078] SEQ ID NO.7:GAGCTTCATGTCAAAACGGA

[0079] The nucleotide sequence of sglacZ is shown in SEQ ID NO.8.

[0080] SEQ ID NO.8: GGCGTAAATGTTGTGCGGAT

[0081] Example 3: Expression and optimization of the bifunctional cellulase gene Bf1

[0082] Using B. subtilis 168 as template and primers FJOEUHAnprF2 / FP 43 UHAnprR、FUHAnprP 43 F / FSPP 43 R.FP 43 LipF / FBfLipR and FBfDHAnprF / FJOEDHAnprR2 respectively amplify the upstream homology arm UHAnpr targeting the nprE site and the promoter P 43 , signal peptide LipA, downstream homology arm DHAnpr targeting nprE site, using pET-Bf vector as template and primers FLipBfF / FDHAnprBfR to amplify bifunctional cellulase gene Bf1, using JOEsgnprE vector as template and primers FDHAJOEF2 / FUHAJOER to amplify JOEsgnprE vector backbone, and then connect to obtain vector JOEnprP 43 LipBf, transformed into BSnprP 43 LipBf strain.

[0083] JOEnprP 43LipBf vector was used as template and primers MBfTB9F / MBfTB9R, MBfTB5F / MBfTB5R, MBfTH1F / MBfTH1R, and MBfTB4F / MBfTB4R were used in JOEnprP 43 The terminators TB9, TB5, TH1, and TB4 were introduced into the end of the Bf1 gene of the LipBf vector by point mutation, thereby obtaining the vectors JOEnprP 43 LipBfTB9、JOEnprP 43 LipBfTB5、JOEnprP 43 LipBfTH1、JOEnprP 43 LipBfTB4, BSnprP 43 LipBfTB9, BSnprP 43 LipBfTB5、BSnprP 43 LipBfTH1, BSnprP 43 LipBfTB4 strain.

[0084] Using B. subtilis 168 as template and primers FJOEUHAlacF2 / FP 43 UHAlacR and FTH1DHAlacF / FJOEDHAlacR2 respectively amplify the upstream homology arm UHAlac targeting the lacZ site and the downstream homology arm DHAlac targeting the lacZ site, and JOEnprP 43 LipBfTH1 vector was used as template and primer FUHAlacP 43 F / FDHAlacTH1R amplification P 43 -LipA-Bf1-TH1 gene expression cassette, using JOEsglacZ vector as template and primers FDHAJOEF2 / FUHAJOER to amplify the JOEsglacZ vector backbone, and then connect to obtain the vector JOElacP 43 LipBfTH1, transformed into BSlacP 43 LipBfTH1 strain.

[0085] Using B. subtilis 168 as template and primers FJOEUHAthrF2 / FP 43 UHAthrR and FTH1DHAthrF / FJOEDHAthrR2 respectively amplify the upstream homology arm UHAthr targeting the thrC site and the downstream homology arm DHAthr targeting the thrC site, and JOEnprP 43 LipBfTH1 vector was used as template and primer FUHAthrP 43F / FDHAthrTH1R amplification P 43 -LipA-Bf1-TH1 gene expression cassette, using JOEsgthrC vector as template and primers FDHAJOEF2 / FUHAJOER to amplify JOEsgthrC vector backbone, and then connect to obtain vector JOEthrP 43 LipBfTH1, converted to BThrP 43 LipBfTH1 strain.

[0086] Using B. subtilis 168 as template and primers FJOEUHAsprF2 / FP 43 UHAsprR and FTH1DHAsprF / FJOEDHAsprR2 respectively amplify the upstream homology arm UHAspr targeting the sprE site and the downstream homology arm DHAspr targeting the sprE site, with JOEnprP 43 LipBfTH1 vector was used as template and primer FUHAsprP 43 F / FDHAsprTH1R amplification P 43 -LipA-Bf1-TH1 gene expression cassette, using JOEsgsprE vector as template and primers FDHAJOEF2 / FUHAJOER to amplify JOEsgsprE vector backbone, and then connect to obtain vector JOEsprP 43 LipBfTH1, transformed into BSsprP 43 LipBfTH1 strain.

[0087] Using B. subtilis 168 as a template and primers FP 43 blCF2 / FBfblCR、FP 43 YwbF / FBfYwbR、FP 43 phoDF / FBfphoDR、FP 43 phoBF / FBfphoBR amplified the signal peptides BglC, YwbN, PhoD, and PhoB, respectively, and JOEthrP 43 LipBfTH1 vector was used as template and primers FblCBfF / FSPP 43 R respectively amplified the JOEthrP used to connect the signal peptides BglC, YwbN, PhoD, and PhoB 43 LipBfTH1 vector backbone, after ligation, the vectors JOEthrP 43 BglCBfTH1、JOEthrP 43 YwbBfTH1、JOEthrP 43 PhoDBfTH1、JOEthrP 43PhoBBfTH1, respectively converted to BSThrP 43 BglCBfTH1、BSthrP 43 YwbBfTH1,BSthrP 43 PhoDBfTH1、BSthrP 43 PhoBBfTH1 strain.

[0088] Referring to the method described in Example 2, primer MP 43 YjB 4312 RJOEthrP 43 The 5'-UTR of the YwbBfTH1 vector was replaced with UTR-12, thereby converting P 43 Promoter optimization to P 12 Promoter, get vector JOEthrP 12 YwbBfTH1, converted to BThrP 12 YwbBfTH1 strain.

[0089] Using B. subtilis 168 as a template and primers FP 43 PhoBF / FBfPhoBR、FP 43 PhoDF / FBfPhoDR amplified the signal peptides PhoB and PhoD respectively, and JOElacP 43 LipBfTH1 vector was used as template and primers FblCBfF / FSPP 43 R amplification of JOElacP used to connect signal peptides PhoB and PhoD 43 LipBfTH1 vector backbone, JOElacP 43 PhoBfTH1、JOElacP 43 PhoDBfTH1;JOElacP 43 LipBfTH1、JOElacP 43 PhoBfTH1、JOElacP 43 The PhoDBfTH1 vector was expressed in the BThrYwbBfTH1 strain to obtain the BThrlacLipBf, BThrlacPhoBBf, and BThrlacPhoDBf strains.

[0090] JOEthrP 43 YwbBfTH1 vector was used as template and primers PJOEP 43 F / PJOETH1R amplification 43-YwbN-Bf1-TH1 gene expression cassette (as shown in SEQ ID NO.3), using pJOE8999 shuttle expression vector as template and primers PTeJOEF / PP 43 JOER amplified the pJOE8999 shuttle expression vector backbone and connected it to obtain the vector pJOEP 43 YwbBfTH1, converted to BSpP 43 The results of YwbBfTH1 strain were as follows Figure 2 The primer sequences and strains are shown in Tables 1-2.

[0091] P 43 The nucleotide sequence of the -YwbN-Bf1-TH1 gene expression cassette is shown in SEQ ID NO.3.

[0092] SEQ ID NO.3:

[0093]

[0094] Example 4: Co-expression of cellulase and construction of Bacillus subtilis K3P2C

[0095] JOEsprP 12 BglC2006TB4 vector was used as template and primers PJOEP 43 F / PP 43 TB4R amplification 12 -BglC-2006-TB4 gene expression cassette, with JOEthrP 43 YwbBfTH1 vector was used as template and primer PTB4P was used 43 F / PJOETH1R amplification 43 -YwbN-Bf1-TH1 gene expression cassette, using pJOE8999 shuttle expression vector as template and primers PTeJOEF / PP 43 The shuttle expression vector backbone of pJOE8999 was amplified by JOER, and the cellulase expression vector pJOE2006Bf was obtained after ligation; the cellulase expression vector pJOE2006Bf was transformed into B. subtilis 168 strain to obtain the BSp2006Bf strain.

[0096] JOEthrP 43 YwbBfTH1 vector in BSsprP 12 BglC2006TB4 strain, thereby achieving P 43 -YwbN-Bf1-TH1 gene expression cassette knocked into BSsprP 12 The thrC site of the BglC2006TB4 strain was transformed to obtain the BSspr2006thrBf strain.

[0097] JOElacP 12 The Lip2006TB4 vector was expressed in the BSspr2006thrBf strain, thereby achieving the P 12 -LipA-2006-TB4 gene expression cassette was knocked into the lacZ site of B. subtilis 168 strain to obtain the recombinant bacterium BSKI3Cel.

[0098] The cellulase expression vector pJOE2006Bf was transformed into the recombinant bacterium BSKI3Cel to obtain Bacillus subtilis K3P2C. Figure 2 The primer sequences and strains are shown in Tables 1-2.

[0099] P 12-The nucleotide sequence of the LipA-2006-TB4 gene expression cassette is shown in SEQ ID NO.2.

[0100] SEQ ID NO.2:

[0101]

[0102] Table 1 Primer sequences for constructing each vector

[0103]

[0104]

[0105]

[0106]

[0107]

[0108] Table 2 Transformed strains and their characteristics

[0109]

[0110]

[0111] Experimental Example 1: Determination of endo-β-1,4-glucanase activity in cellulase

[0112] Each strain was cultured in LB medium containing 1% CMC-Na (sodium carboxymethyl cellulose) at 37°C and 220 rpm for 24 h, and the bacterial solution was centrifuged to obtain the enzyme solution of each strain; referring to the DNS method disclosed by Wang et al. in the literature (Wang Z, Tang H, Liu G, et al. Compound probiotics producing cellulase could replace cellulase preparations during solid-state fermentation of millet bran [J]. Bioresour Technol, 2023, 385: 129457), the endo-β-1,4-glucanase (EG) activity of each strain was determined using 1% CMC-Na as a substrate. The results are as follows Figure 3 and as shown in Table 3, wherein 168WT represents B. subtilis 168 strain.

[0113] EG enzyme activity unit definition: the amount of enzyme solution required to degrade and release 1 μg of reducing sugar from 1% CMC-Na per minute at 50°C.

[0114] The results showed that the EG activity of BSKI2006 strain obtained by knocking in the gene expression cassette containing the endoglucanase gene 2006 from B. subtilis RLI2019 strain into the eglS site of B. subtilis 168 strain was increased by 59.18% compared with that of B. subtilis 168 strain; BSsprP 43 The EG activity of strain BglC2006 was 6.82 times higher than that of strain B. subtilis 168, indicating that P 43 The promoter cooperated with the signal peptide BglC from B. subtilis RLI2019 to have the best EG secretion effect on the 2006 gene; 43 -BSsprP obtained by knocking in the BglC-2006 gene expression cassette into the sprE locus 43 The BglC2006 strain had the highest expression efficiency of the 2006 gene. There was no significant difference in the expression efficiency of the 2006 gene after knocking it into the nprE and lacZ sites respectively. 43 -BglC-2006 gene expression cassette end addition of terminator TB4 has the best effect on promoting 2006 gene secretion EG; 43 -P of BglC-2006-TB4 gene expression cassette 43 Promoter optimization to P 12 The promoter can enhance EG activity; in BSsprP 12 The eglS and lacZ loci of the BglC2006TB4 strain were knocked into P 12 -YwbN-2006 and P 12 -LipA-2006 gene expression cassette, which can increase EG activity by 6.42% and 12.96% respectively; in addition, to verify P 12 -BglC-2006-TB4 gene expression cassette expression effect, knocking out the Cas9 gene on the pJOE8999 shuttle expression vector backbone and increasing P 12 -BglC-2006-TB4 gene expression cassette, the obtained BSpP 12 The EG activity of strain BglC2006TB4 was only 73.32 U / mL.

[0115] Table 3 Endo-β-1,4-glucanase activity of each strain

[0116]

[0117]

[0118] Experimental Example 2: Determination of β-glucosidase activity in cellulase

[0119] Each strain was cultured in LB medium containing 1% CMC-Na at 37°C and 220 rpm for 24 h, and the bacterial solution was centrifuged to obtain the enzyme solution of each strain; 100 μL of the enzyme solution of each strain was reacted with 50 μL of 5 mmol / L 4-nitrophenyl-D-pyranoglucoside (pNPG) at 50°C for 30 min, and then 200 μL of 1 mol / L Na2CO3 was added to terminate the reaction and the OD was measured. 410nm The β-glucosidase (CB) activity of each strain was obtained by Figure 4 and as shown in Table 4, wherein 168WT represents B. subtilis 168 strain.

[0120] CB enzyme activity unit definition: the amount of enzyme solution required to degrade and release 1 μg pNP from pNPG per minute at 50°C.

[0121] The results showed that B. subtilis 168 strain had no CB activity; 43 -LipA-Bf1-TB9 gene expression cassette knocked into the nprE site of B. subtilis 168 strain to obtain BSnprP 43 The LipBfTB9 strain had a CB activity of 57.46 U / mL; 43 -The terminator TB9 of the LipA-Bf1-TB9 gene expression cassette was optimized to TH1, which can enhance CB activity; 43 -LipA-Bf1-TH1 gene expression cassette knocked into the thrC site of B. subtilis 168 strain, the expression efficiency of Bf1 gene was the highest; signal peptide YwbN had the best promoting effect on Bf1 gene secretion of CB; using P 12 After the promoter expressed the Bf1 gene, there was no significant change in CB activity.

[0122] Table 4 β-glucosidase activity of each strain

[0123] Strain name CB activity (U / mL) Strain name CB activity (U / mL) 168WT 0 <![CDATA[BSthrP 43 YwbBfTH1]]> 349.26 <![CDATA[BSnprP 43 LipBfTB9]]> 57.46 <![CDATA[BSthrP 43 phoDBfTH1]]> 106.78 <![CDATA[BSnprP 43 LipBfTB5]]> 84.31 <![CDATA[BSthrP 43 phoBBfTH1]]> 125.10 <![CDATA[BSnprP 43 LipBfTH1]]> 136.32 <![CDATA[BSthrP 12 YwbBfTH1]]> 358.03 <![CDATA[BSnprP 43 LipBfTB4]]> 116.50 <![CDATA[BSpP 43 YwbBfTH1]]> 203.62 <![CDATA[BSlacP 43 LipBfTH1]]> 127.42 BSthrlacLipBf 330.91 <![CDATA[BSthrP 43 LipBfTH1]]> 181.11 BSthrlacPhoBBf 329.75 <![CDATA[BSsprP 43 LipBfTH1]]> 148.12 BSthrlacPhoDBf 342.13 <![CDATA[BSthrP 43 blCBfTH1]]> 112.04

[0124] Experimental Example 3: Determination of cellulase activity

[0125] Each strain was cultured in LB medium containing 1% CMC-Na at 37°C and 220 rpm for 24 h, and the bacterial solution was centrifuged to obtain the enzyme solution of each strain; 100 μL of the enzyme solution of each strain was reacted with 50 μL of 1 mg / mL 4-nitrophenyl-β-D-cellobioside (HPLC) at 50°C for 30 min, and then 200 μL of 1 mol / L Na2CO3 was added to terminate the reaction and the OD was measured. 410nmThe exo-β-1,4-glucanase (CBH) activity of each strain was obtained, and the EG and CB activities of each strain were determined according to the method described in Examples 1 to 2. The results are as follows Figure 5 As shown in Table 5, 168WT represents B. subtilis 168 strain, and BSK3P2C represents Bacillus subtilis K3P2C.

[0126] CBH enzyme activity unit definition: the amount of enzyme solution required to degrade and release 1 μg pNP from HPLC per minute at 50°C.

[0127] The cellulase activities of the recombinant bacteria BSKI3Cel and Bacillus subtilis K3P2C were measured at different times. Figure 6 As shown in Tables 6 and 7.

[0128] The results showed that the simultaneous expression of P 12 -BglC-2006-TB4 and P 43 -YwbN-Bf1-TH1 gene expression cassette to obtain the BSp2006Bf strain, whose EG, CBH and CB activities were 59.51U / mL, 247.99U / mL and 183.08U / mL respectively; 12 -BglC-2006-TB4 and P 43 -YwbN-Bf1-TH1 gene expression cassettes were knocked into the sprE and thrC sites of B. subtilis 168 to obtain the BSspr2006thrBf strain, whose EG, CBH and CB activities were 106.85 U / mL, 453.70 U / mL and 359.25 U / mL, respectively; 12 -LipA-2006-TB4 gene expression cassette was knocked into the lacZ site of BSspr2006thrBf strain to obtain the recombinant bacterium BSKI3Cel, whose EG, CBH and CB activities were 129.59 U / mL, 596.75 U / mL and 447.42 U / mL, respectively; the cellulase expression vector pJOE2006Bf was transformed into the recombinant bacterium BSKI3Cel to obtain Bacillus subtilis K3P2C, whose EG, CBH and CB activities were 267.82 U / mL, 1413.84 U / mL and 943.66 U / mL, respectively.

[0129] The recombinant bacteria BSKI3Cel and Bacillus subtilis K3P2C both had high cellulase activity on the 7th to 9th day. The recombinant bacteria BSKI3Cel had the highest EG and CBH activities of 407.89 U / mL and 2291.45 U / mL on the 7th day, respectively, and the highest CB activity of 2168.45 U / mL on the 9th day. Bacillus subtilis K3P2C had the highest EG and CB activities of 536.78 U / mL and 3510.75 U / mL on the 9th day, respectively, and the highest CBH activity of 3078.46 U / mL on the 7th day.

[0130] Table 5 Cellulase activity of each strain

[0131]

[0132]

[0133] Table 6 Cellulase activity of recombinant bacteria BSKI3Cel at different times

[0134] Time (d) EG activity (U / mL) CBH activity (U / mL) CB activity (U / mL) 1 129.59 596.75 447.42 2 217.79 698.46 662.44 3 334.79 963.62 1323.94 4 366.81 1149.37 1575.79 5 388.55 1176.25 1592.98 6 393.15 1447.00 1800.15 7 407.89 2291.45 2127.29 8 404.53 2240.52 2084.96 9 396.58 1700.39 2168.45 10 343.07 783.01 882.75

[0135] Table 7 Cellulase activity of Bacillus subtilis K3P2C at different times

[0136] Time (d) EG activity (U / mL) CBH activity (U / mL) CB activity (U / mL) 1 267.82 1413.84 943.66 2 293.10 1513.51 1145.21 3 329.88 1590.47 1435.11 4 436.37 1830.31 1581.59 5 487.73 2394.52 1720.82 6 485.82 2656.54 2159.45 7 518.09 3078.46 2390.09 8 533.16 2959.83 2829.61 9 536.78 2847.00 3510.75 10 344.29 928.89 962.46

[0137] Experimental Example 4: Straw degradation effect of Bacillus subtilis K3P2C

[0138] The concentration of live bacteria was 5.0×10 8CFU / mL of Bacillus subtilis K3P2C bacterial solution was inoculated at a ratio of 5% in 112.5 mL of infiltration medium containing 0.5% NH4NO3, 0.1% MgSO4·7H2O, and 0.1% NaCl. The infiltration medium was prepared according to the method disclosed by Liu et al. in the literature (Liu G, Zhang K, Gong H, et al. Whole genome sequencing and the lignocellulose degradation potential of Bacillus subtilis RLI2019 isolated from the intestine of termites[J]. Biotechnol Biofuels Bioprod, 2023, 16(1): 130); 30 g of wheat straw that was sterilized and dried to constant weight and passed through a 2 mm sieve was added to the infiltration medium and mixed, and solid-state fermentation was carried out at 37°C; fermentation samples were collected on the 0th, 4th, and 8th days of solid-state fermentation as EB0 group, EB4 group, and EB8 group, respectively, and B. subtilis was used for the infiltration medium. The fermentation sample of strain 168 subjected to solid-state fermentation for 8 days under the same conditions was used as the control (WT8 group).

[0139] The water content, dry matter and pH of each fermentation sample were determined according to the method disclosed by Su et al. in the literature (Su W, Jiang Z, Wang C, et al. Dynamics of defatted rice branin physicochemical characteristics, microbiota and metabolic functions during two-stage co-fermentation [J]. Int J Food Microbiol, 2022, 362: 109489); the lignin content and hemicellulose content in each fermentation sample were determined by a lignin content detection kit and a hemicellulose content detection kit, respectively; the neutral detergent fiber (NDF) content and acid detergent fiber (ADF) content in each fermentation sample were determined by an A200I fiber analyzer, and the results are shown in Table 8.

[0140] After drying, crushing and passing through a 400-mesh sieve, each fermentation sample was fixed on an operating table containing conductive glue and subjected to gold spraying treatment according to the method disclosed by Liu et al. in the literature (Liu G, Zhang K, Gong H, et al. Whole genome sequencing and the lignocellulose degradation potential of Bacillus subtilis RLI2019 isolated from the intestine oftermites [J]. Biotechnol Biofuels Bioprod, 2023, 16 (1): 130). The morphology of each fermentation sample was observed using a Nano SEM-450 field emission scanning electron microscope. The results are shown in Figure 2. Figure 7 shown.

[0141] The solid-state fermentation results showed that compared with the EB0 group, the hemicellulose, NDF and ADF contents of the fermented samples in the EB8 group were significantly reduced by 26.42%, 7.46% and 9.93%, respectively, and the pH was significantly increased by 37.84%; compared with the WT8 group, the hemicellulose, NDF and ADF contents of the fermented samples in the EB8 group were significantly reduced by 17.08%, 6.71% and 8.92%, respectively, and the pH was significantly increased by 2.93%. This indicates that Bacillus subtilis K3P2C can effectively degrade hemicellulose, NDF and ADF in wheat straw and significantly increase the pH of the fermentation product.

[0142] Scanning electron microscopy results showed that the surface of wheat straw in group EB0 was relatively smooth, the surface of wheat straw in group EB4 showed concave-convex structure and contained a small amount of corrugated texture, and the surface of wheat straw in group EB8 showed significantly increased concave-convex structure and corrugated texture, and was loose and porous. This was due to the enzymatic hydrolysis and fermentation process of Bacillus subtilis K3P2C, which resulted in the loss of cellulose, hemicellulose, lignin and pectin on the surface of wheat bran, increased voids and larger pore sizes, which helped to improve its adsorption performance for cellulose biomass; only a small amount of corrugated structure appeared on the surface of wheat straw in group WT8. This indicated that Bacillus subtilis K3P2C could more effectively degrade the lignocellulose structure on the surface of crop straw, which played an important role in improving the physical and chemical properties of crop straw.

[0143] Table 8 Degradation results of wheat straw by Bacillus subtilis K3P2C

[0144]

[0145]

[0146] As can be seen from the above embodiments, the present invention provides a high-yield cellulase Bacillus subtilis and its construction method and application. The Bacillus subtilis K3P2C constructed by the present invention can produce high-yield and high-activity endo-β-1,4-glucanase, exo-β-1,4-glucanase and β-glucosidase, can effectively degrade hemicellulose, NDF and ADF in crop straw, significantly improve the pH of fermentation products, and can make the surface cellulose, hemicellulose, lignin and pectin of crop straw missing during enzymatic hydrolysis and fermentation, more effectively degrade the lignocellulose structure of the surface of crop straw, promote the increase of voids and the enlargement of pore size, thereby helping to improve the adsorption performance of crop straw to microorganisms and digestive enzymes, and playing an important role in improving the physical and chemical properties of crop straw.

[0147] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principle of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention.

Claims

1. A Bacillus subtilis with high cellulase production, characterized in that: The Bacillus subtilis is Bacillus subtilis K3P2C, which is deposited in the China Center for Type Culture Collection, the deposit address is Wuhan University, Wuhan, China, the deposit date is August 14, 2024, and the deposit number is CCTCC No.M20241787.

2. Use of the Bacillus subtilis according to claim 1 in preparing a preparation for high-yield cellulase; The cellulase comprises one or more of endo-β-1,4-glucanase, exo-β-1,4-glucanase and β-glucosidase.

3. The method for constructing Bacillus subtilis according to claim 1, characterized in that: The steps include: (1) Insert the gene expression cassette P 12 -BglC-2006-TB4, P 12 -LipA-2006-TB4 and P 43 -YwbN-Bf1-TH1 was knocked into Bacillus subtilis 168 to obtain the recombinant bacterium BSKI3Cel; (2) The cellulase expression vector pJOE2006Bf was transformed into the recombinant bacterium BSKI3Cel to obtain Bacillus subtilis K3P2C.

4. The construction method according to claim 3, characterized in that: The P 12 - The nucleotide sequence of BglC-2006-TB4 is shown in SEQ ID NO.1; The P 12 - The nucleotide sequence of LipA-2006-TB4 is shown in SEQ ID NO.2; The P 43 The nucleotide sequence of -YwbN-Bf1-TH1 is shown in SEQ ID NO.

3.

5. The construction method according to claim 4, characterized in that: P 12 - BglC-2006-TB4 was knocked into the sprE locus of Bacillus subtilis 168 strain; P 12 - LipA-2006-TB4 was knocked into the lacZ site of Bacillus subtilis 168 strain; P 43 -YwbN-Bf1-TH1 was knocked into the thrC site of Bacillus subtilis 168 strain.

6. The construction method according to claim 5, characterized in that: The construction method of the cellulase expression vector pJOE2006Bf in step (2) is as follows: 12 -BglC-2006-TB4, P 12 -LipA-2006-TB4 was connected with the pJOE8999 shuttle expression vector to obtain the cellulase expression vector pJOE2006Bf.

7. Use of the construction method according to any one of claims 3 to 6 in the preparation of a high-yield cellulase preparation; The cellulase comprises one or more of endo-β-1,4-glucanase, exo-β-1,4-glucanase and β-glucosidase.

8. A bacterial agent for high-yield cellulase, characterized in that: The bacterial agent comprises the Bacillus subtilis according to claim 1.

9. Use of the Bacillus subtilis according to claim 1, the Bacillus subtilis K3P2C prepared by the construction method according to any one of claims 3 to 6, and the microbial agent according to claim 8 in degrading crop straw.

Images