Application of vitis amurensis VaWRKY72 gene in cold resistance of plants

Abstract

The invention belongs to the technical field of molecular biology and genetic engineering, and particularly relates to application of a vitis amurensis VaWRKY72 gene in improving cold resistance of plants. According to the invention, the cold-resistant effect of the over-expressed vitis amurensis VaWRKY72 gene in regulation and control of arabidopsis thaliana and grape is found for the first time. Through overexpression of the vitis amurensis VaWRKY72 gene in arabidopsis thaliana and grape, it is found that the vitis amurensis VaWRKY72 gene can be used for improving the cold stress resistance by reducing the malondialdehyde content, reducing the electrolyte permeability, improving the proline content and the activity of peroxidase, catalase and superoxide dismutase, eliminating excessive ROS and promoting the expression of cold stress related genes. Therefore, the tolerance of the plant to low-temperature stress is improved.

Description

Technical Field

[0001] The invention belongs to the technical fields of molecular biology and genetic engineering, and particularly relates to application of a Vitis amurensis VaWRKY72 gene in plant cold resistance. Background Art

[0002] Wild grape (Vitis amurensis Rupr.) is considered to be the most cold-resistant germplasm resource in the genus Vitis. It can withstand extreme low temperatures of -40℃ to -50℃ and is widely used as a parent for hybrid breeding. However, the traditional hybrid breeding process is cumbersome and time-consuming. At present, although cold-resistant grape varieties have been cultivated in China, they cannot meet the needs of my country's grape and wine industry in terms of yield and quality. With the development of molecular biology, genetic engineering breeding has become a new approach. Therefore, exploring cold-resistant genes in wild grapes and exploring their functions and mechanisms of action have important theoretical significance and practical value for improving the cold resistance of grape varieties.

[0003] Through further research on the cold tolerance of grapes, it was found that the VaERF080 gene and the VaERF087 gene improved the cold tolerance of transgenic Arabidopsis by increasing the activity of antioxidant enzymes and regulating the expression of cold-induced related genes; the VaERF092 gene enhanced the plant's tolerance to cold stress by binding to the GCC-box on the promoter of the VaWRKY33 gene. Therefore, it is necessary to conduct further research to discover new grape genes for improving the cold tolerance of plants. Summary of the invention

[0004] In order to solve the above technical problems, the present invention aims to clarify the application of the Vitis amurensis VaWRKY72 gene in promoting plant cold resistance, provide new applications for the VaWRKY72 gene, and also provide a new way to improve the cold resistance of plants.

[0005] To achieve the above purpose, the present invention adopts the following technical solution.

[0006] The first aspect of the present invention provides an application of the Vitis amurensis VaWRKY72 gene in plant cold resistance. The nucleotide sequence of the Vitis amurensis VaWRKY72 gene is shown in SEQ ID NO.1.

[0007] The plants include Arabidopsis thaliana and grape.

[0008] The inventors cloned the VaWRKY72 gene from Vitis amurensis 'Shuangyou' and analyzed its subcellular localization and transcriptional autoactivation activity. Figure 2The results showed that the VaWRKY72 gene of Vitis amurensis was overexpressed in Arabidopsis thaliana to demonstrate its cold resistance. At the same time, the transient transformation experiment was used to transfer the gene into 'Chardonnay' grapes to verify its cold resistance function and whether it regulates the expression of grape-related genes, thus clarifying the mechanism of action of the VaWRKY72 gene of Vitis amurensis in grape cold stress.

[0009] The complete open reading frame sequence of the VaWRKY72 gene of Vitis amurensis is 1782 bp in length and encodes 593 amino acids.

[0010] The second aspect of the present invention provides a recombinant expression vector comprising the Vitis amurensis VaWRKY72 gene.

[0011] In another preferred embodiment, the recombinant expression vector is obtained by inserting the VaWRKY72 gene between the Kpn I and BamHI sites of the pCAMBIA2300-GFP overexpression vector plasmid.

[0012] The third aspect of the present invention provides a recombinant engineered bacterium comprising the recombinant expression vector.

[0013] In another preferred embodiment, the recombinant engineered bacteria are obtained by transferring the recombinant expression vector into Agrobacterium competent cells GV3101 (pSoup).

[0014] The engineered bacteria can be understood as the engineered bacteria used by those skilled in the art in the transgenic process, such as Agrobacterium competent cells GV3101 (pSoup). However, with the development of science and technology, the selection of the engineered bacteria may change, or the application fields for non-transgenic purposes also involve the use of vectors and engineered bacteria, but only those containing the gene or the vector of the present invention are within the scope of protection of the present invention.

[0015] The fourth aspect of the present invention provides the use of the recombinant expression vector in cultivating cold-resistant transgenic plants. Compared with the wild type, the cold resistance of the transgenic plants is improved.

[0016] In another preferred embodiment, the plants include Arabidopsis thaliana and grape.

[0017] The fifth aspect of the present invention provides the use of the recombinant engineered bacteria in cultivating cold-resistant transgenic plants. Compared with the wild type, the cold resistance of the transgenic plants is improved.

[0018] In another preferred embodiment, the plants include Arabidopsis thaliana and grape.

[0019] The fifth aspect of the present invention provides a method for improving the cold tolerance of plants, comprising the steps of overexpressing the Vitis amurensis VaWRKY72 gene in the plant;

[0020] The plants include Arabidopsis thaliana and grape.

[0021] Compared with the prior art, the present invention has the following beneficial effects:

[0022] The present invention first discovered the role of overexpression of Vitis amurensis 'Shuangyou' VaWRKY72 gene in regulating the cold tolerance of Arabidopsis and grapes. By overexpressing Vitis amurensis VaWRKY72 gene in Arabidopsis and grapes, it was found that Vitis amurensis 'Shuangyou' VaWRKY72 gene reduced malondialdehyde content, reduced electrolyte permeability, increased proline content and the activities of peroxidase, catalase, and superoxide dismutase, removed excess ROS, and promoted the expression of cold stress-related genes, thereby improving the tolerance of plants to low temperature stress. BRIEF DESCRIPTION OF THE DRAWINGS

[0023] Figure 1 The expression pattern analysis and basic characteristics of VaWRKY72 gene in Vitis amurensis. a is the expression pattern of VaWRKY72 gene in stem, petiole, leaf and inflorescence of Vitis amurensis; b is the expression analysis of VaWRKY72 gene in response to low temperature stress; c is the chromosome location of VaWRKY72 gene, black lines represent introns, gray squares represent exons, and blue boxes represent conserved WRKY domains; d is the phylogenetic analysis of VaWRKY72 and its homologous genes; e is the comparison of conserved domains of VaWRKY72 gene and its homologous genes; single-factor ANOVA variance analysis (P<0.05) was used.

[0024] Figure 2 Subcellular localization and transcriptional self-activation activity analysis of VaWRKY72 gene in Vitis amurensis; a is the subcellular localization of VaWRKY72 gene, scale bar = 10 μm; b is the transcriptional self-activation activity analysis of VaWRKY72 gene in yeast, pGBKT7-53+pGADT7-T is the positive control, pGBKT7-Lam+pGADT7-T is the negative control, and pGBKT7 DNA-BD is the pGBKT7 empty vector.

[0025] Figure 3 Analysis of cold stress in Arabidopsis seedlings overexpressing VaWRKY72 gene of Vitis amurensis. a~b are root length analysis of wild type (WT) and transgenic VaWRKY72 gene lines (OE#2, OE#3 and OE#5); c~d are freeze resistance mortality analysis of wild type (WT) and transgenic VaWRKY72 gene lines (OE#2, OE#3 and OE#5); single-factor ANOVA analysis of variance (P<0.05), scale bar = 1 cm.

[0026] Figure 4This is a diagram for evaluating the cold tolerance of Arabidopsis thaliana overexpressing the VaWRKY72 gene of Vitis amurensis; a is a diagram of the morphological changes of the wild type (WT) and transgenic Arabidopsis lines (OE#2, OE#3 and OE#5) before and 4 hours after -6℃ low temperature stress treatment; b is a DAB staining diagram; c is a diagram of H2O2 content; d is a diagram of electrolyte permeability; e is a diagram of proline content; f is a diagram of malondialdehyde (MDA) content; g is a diagram of superoxide dismutase (SOD) activity; h is a diagram of peroxidase (POD) activity; i is a diagram of catalase (CAT) activity; one-way ANOVA analysis of variance was used (P<0.05), scale = 1 cm.

[0027] Figure 5 The relative expression levels of cold stress-related genes in wild type (WT) and transgenic Arabidopsis (OE#2, OE#3 and OE#5) under low temperature stress; a is AtCBF1; b is AtCBF2; c is AtCBF3; d is AtKIN1; e is AtCOR47; f is AtRD29A; Arabidopsis AtActin2 (AT3G18780.1) was used as an internal reference gene; one-way ANOVA analysis of variance was used (P<0.05).

[0028] Figure 6 The phenotypic observation and physiological and biochemical index analysis of 'Chardonnay' grape transiently transformed with VaWRKY72 gene after low temperature stress treatment. a is the phenotypic observation of wild type (WT) and transgenic lines (OE#2 and OE#3) before and after low temperature stress; b is DAB staining; c is H2O2 content; d is electrolyte permeability; e is proline content; f is malondialdehyde (MDA) content; g is superoxide dismutase (SOD) activity; h is peroxidase (POD) activity; i is catalase (CAT) activity; single-factor ANOVA variance analysis (P<0.05), scale = 1 cm.

[0029] Figure 7 Figure 2 shows the relative expression of cold stress-related genes in wild type (WT) and transiently transformed 'Chardonnay' grapes (OE#2 and OE#3) under low temperature stress. a is VvCBF1; b is VvCBF2; c is VvCBF3; d is VvCBF4; e is VvKIN2; f is VvCOR15. Grape VvActin1 (Vitvi04g01613.t01) was used as an internal reference gene, and one-way ANOVA analysis of variance was performed (P<0.05).

[0030] Figure 8 Diagram of the mechanism of action of the VaWRKY72 gene of Vitis amurensis to improve the cold tolerance of Arabidopsis thaliana and 'Chardonnay' grape. DETAILED DESCRIPTION

[0031] The present invention is described in detail below in conjunction with the accompanying drawings and specific examples, but should not be construed as limiting the present invention. Unless otherwise specified, the technical means used in the following examples are conventional means well known to those skilled in the art, and the materials, reagents, etc. used in the following examples, unless otherwise specified, can be obtained from commercial sources.

[0032] The inventors previously conducted comparative transcriptome analysis of cold-resistant Vitis amurensis 'Shuangyou' and non-cold-resistant Vitis vinifera 'Red Globe' at different periods after low temperature treatment, and obtained the differentially expressed gene VaWRKY72 of Vitis amurensis. To further explore the response of VaWRKY72 gene to low temperature, the inventors analyzed the response of VaWRKY72 gene to low temperature and its expression pattern in different tissues of Vitis amurensis by RT-qPCR. Figure 1 As shown, the results showed that the VaWRKY72 gene of Vitis amurensis significantly responded to low temperature-induced expression, reaching a peak at 6 hours, and the expression level was highest in the leaves of Vitis amurensis.

[0033] The present invention provides a new use of the Vitis amurensis VaWRKY72 gene, the Vitis amurensis 'Shuangyou' VaWRKY72 gene or the VaWRKY72 gene, the coding region sequence of the VaWRKY72 gene is shown in SEQ ID NO.1:

[0034]

[0035] The amino acid sequence encoded by this gene is shown in SEQ ID NO.2:

[0036] *.

[0037] Example 1: Cloning of VaWRKY72 gene from Vitis amurensis 'Shuangyou'.

[0038] The present invention uses Vitis amurensis 'Shuangyou' as the test material, which is provided by the grape germplasm resource garden of Northwest Agriculture and Forestry University.

[0039] 1. Primer design

[0040] The designed primers and their nucleotide sequences are shown below:

[0041] GC-VaWRKY72-Kpn IF: GGTACC ATGGAGGCTGCTGCTTTGGAGATAC, as shown in SEQ ID NO. 3;

[0042] GC-VaWRKY72-BamH IR: GGATCC TCACTGGATATTATCTTTGTGATC A, as shown in SEQ ID NO.4.

[0043] 2. RNA Extraction

[0044] Using Omega Bio-Tek / The FFPE RNA Kit was used to extract total RNA from the test materials, and the Evo M-MLV Reverse Transcription Premix Kit (containing gDNA removal reagents for qPCR) Ver. 2 was used to reverse transcribe cDNA.

[0045] 3. Gene cloning

[0046] The obtained cDNA was used as a template and primers GC-VaWRKY72-Kpn IF and GC-VaWRKY72-BamHI-R were used. Max DNA Polymerase high-fidelity enzyme was used for PCR amplification to obtain the open reading frame sequence of VaWRKY72. The complete open reading frame sequence of this gene is 1782 bp in length and encodes 593 amino acids.

[0047] 4. Gel recovery and sequencing

[0048] The sequence of VaWRKY72 was analyzed as follows Figure 1 As shown in the results, it was found to be located on chromosome 1 of the grape reference genome, with 5 exons and an amino acid sequence similarity of 98.32% with the grape reference genome. In addition, sequencing results showed that VaWRKY72 has a highly conserved WRKYGQK domain, which contains a C2HC zinc finger structure belonging to the IIb subfamily. Phylogenetic tree analysis showed that VaWRKY72 has the highest genetic relationship with Hevea brasiliensis.

[0049] The PCR amplification product was recovered by gel gel and sequenced. The sequencing sequence is shown in SEQ ID NO.1.

[0050] After comparison, the coding region sequences of the VaWRKY72 gene were consistent, and the amino acid sequence of the encoded protein was shown in SEQ ID NO.2.

[0051] Example 2: Construction of recombinant plant overexpression vector

[0052] according to IIOne Step Cloning Kit instruction manual, one-step cloning method was used to construct vectors, and pCAMBIA2300-VaWRKY72-GFP and pGBKT7-VaWRKY72 recombinant vectors were obtained.

[0053] Example 3: Subcellular localization and transcriptional autoactivation activity analysis

[0054] Subcellular localization was performed according to the PEG-mediated Arabidopsis protoplast transformation method. Fluorescence was observed using a laser scanning confocal microscope. The excitation wavelength of GFP was 488 nm and that of mCherry was 552 nm. The steps for analyzing transcriptional autoactivation activity were performed according to the Clontech Gold Yeast Two-Hybrid System User Manual (PT4084-1). TM Yeast Transformation System 2 User Manual (PT1172-1) Instructions Transform the successfully constructed vector into Y2HGold yeast strain, spread it on SD / -Trp medium, and invert and culture it at 30℃ for 3-5 days. Pick a single clone and dilute it in 50μL ddH2O. Take 5μL of bacterial liquid and drop it on SD / -Trp, SD / -Trp / X-α-Gal (40μg mL -1 ) and SD / -Trp / X-α-Gal / AbA (200 ng mL -1 ) medium. After inverted culture at 30℃ for 3-5 days, the growth was observed. pGBKT7-53 and pGADT7-T were co-transformed as positive controls, and pGBKT7-Lam and pGADT7-T were co-transformed as negative controls.

[0055] like Figure 2 As shown in a, after VaWRKY72-GFP and AtHY5-mCherry were co-transformed into Arabidopsis protoplasts, green fluorescence was detected in the nucleus and overlapped with the red fluorescence of AtHY5, indicating that VaWRKY72 was localized in the nucleus. The full-length sequence pGBKT7-VaWRKY72 bait vector was constructed and transformed into the Y2HGold yeast strain. Compared with the transformation of the pGBKT7 empty vector, the positive control and the negative control, as shown in Figure 2 As shown in b, it was found that the transformants transformed with pGBKT7-VaWRKY72 grew normally and appeared blue on SD / -Trp / X-α-Gal medium, and also grew normally and appeared blue on SD / -Trp / X-α-Gal / AbA medium, and there was no significant difference in the plaque size, indicating that the full-length VaWRKY72 has transcriptional self-activation activity in yeast.

[0056] Example 4: Obtaining VaWRKY72 transgenic Arabidopsis strains

[0057] The pCAMBIA2300-VaWRKY72-GFP overexpression vector was transformed into Arabidopsis thaliana by Agrobacterium-mediated inflorescence infection. Three transgenic lines (OE#2, OE#3, and OE#5) were obtained by resistance screening of T3 plants and identification by PCR, Western blot, and RT-qPCR for subsequent experimental analysis.

[0058] Example 5: Obtaining VaWRKY72 transgenic grape strains

[0059] The whole plant transient transformation system of grapes mediated by Agrobacterium was used to transiently transform it into 'Chardonnay' grapes. The specific operation is as follows: select the 6-week-old 'Chardonnay' tissue culture seedlings with strong growth, take a 5mL syringe, use the needle tip to make a wound on the petiole of the grape tissue culture seedlings, and slowly inject the above-treated bacterial solution; ultrasonic for 2 minutes; vacuum, the pressure is 0.8MPa, each treatment is 20 minutes, and the recovery is 5 minutes. The treated tissue culture seedlings were cultured in the tissue culture room away from light, and after 12 hours, they were cultured under light (growth temperature 23-24℃, relative air humidity 55-65%, 16h light / 8h dark). Finally, two transgenic grape strains (OE#2 and OE#3) were selected by PCR detection and RT-qPCR analysis for subsequent experimental analysis.

[0060] Example 6: Overexpression of VaWRKY72 improves Arabidopsis thaliana's resistance to low temperature

[0061] Through testing, the wild type (WT) and three transgenic lines with higher transcription levels (OE#2, OE#3 and OE#5) were selected for low temperature (4°C) and freezing tolerance testing (-20°C). It was found that at 25°C, there was no significant difference in root length between the wild type and transgenic Arabidopsis lines, such as Figure 3 However, at 4°C, the root length of transgenic Arabidopsis seedlings was longer than that of the wild type.

[0062] In addition, if Figure 3 c and d, when the wild type and transgenic Arabidopsis were treated at -20℃ for 1h and recovered for 3d, the mortality rate of the wild type was 32.33%, while the mortality rates of the three transgenic lines were 9.66%, 5.61% and 11.3%, respectively. In addition, the 4-week-old wild type and three overexpression lines were cold acclimated at 4℃ for 3d and then cold treated at -6℃. There was almost no difference in the phenotypes of the wild type and transgenic lines before cold treatment. However, after the cold treatment, the leaves of the wild type showed low-temperature damage, while the leaves of the transgenic lines only showed slight wilting. After a 7-day recovery period at normal temperature, it was observed that almost all the wild types died, while the transgenic Arabidopsis recovered to green, as shown in Figure 2. Figure 4 As shown in a in .

[0063] To further investigate the cold resistance of VaWRKY72 in transgenic Arabidopsis, DAB histochemical staining, the content of physiological indicators and the determination of related enzyme activities were performed. Under suitable growth conditions, wild-type and transgenic Arabidopsis showed the same phenotype in DAB staining. However, after cold treatment, the DAB staining of the wild-type was darker than that of the transgenic, and the H2O2 content was lower than that of the wild-type, such as Figure 4 As shown in b and c in Figure 2. Before cold stress treatment, the electrolyte permeability, MDA and proline contents, and the activities of SOD, POD, and CAT enzymes of all plants were almost the same. However, after cold stress treatment, the electrolyte permeability and MDA content of transgenic plants were lower than those of the wild type. In addition, the proline content, SOD, POD, and CAT activities of transgenic plants were significantly higher than those of the wild type, as shown in Figure 2. Figure 4 In summary, overexpression of VaWRKY72 enhances the cold resistance of transgenic Arabidopsis.

[0064] Example 7: Overexpression of VaWRKY72 gene upregulates the expression of cold stress-related genes in Arabidopsis

[0065] To further explore the mechanism by which overexpression of VaWRKY72 gene enhanced the cold tolerance of transgenic lines, the transcription levels of AtCBF1, AtCBF2, AtCBF3 and AtCOR47 in the CBF-dependent pathway and AtRD29A and AtKIN1 in the ABA signaling pathway were analyzed under low temperature stress. Figure 5 As shown in the figure, in transgenic Arabidopsis, the expression levels of the above cold stress-related genes were significantly higher than those in the wild type, among which AtCBF1, AtCBF2 and AtCBF3 responded faster to low temperature stress, while AtKIN1, AtCOR47 and AtRD29A responded relatively slowly. This indicates that the VaWRKY72 gene enhances the cold resistance of transgenic Arabidopsis by increasing the transcription levels of cold stress-related genes.

[0066] Example 8: Transient overexpression of VaWRKY72 gene enhances cold resistance of 'Chardonnay' grapes

[0067] Transgenic grape plants were screened by PCR and RT-qPCR, and wild-type plants with consistent growth and 'Chardonnay' grape plants overexpressing VaWRKY72 gene (OE#2 and OE#3) were selected for cold acclimation at 10℃ for 1 day, and then cold treated at -2℃ for 36h. Figure 6As shown in a, the phenotypes of wild-type and VaWRKY72-overexpressing grapes were consistent before treatment. After low temperature stress, both wild-type and transgenic grape plants wilted to a certain extent, but the leaves of the grapes overexpressing VaWRKY72 only wilted slightly compared with the wild type. After 7 days of recovery, the leaves of wild-type and transgenic grapes partially turned yellow and withered, but the damage of wild-type was greater than that of transgenic grape plants.

[0068] like Figure 6 As shown in b and c, it was found that before low temperature stress treatment, the DAB staining of wild-type and transgenic grapes was relatively consistent, and there was no significant difference in H2O2 content. After low temperature stress treatment, the H2O2 content of both transgenic grape lines and wild-type lines increased, but the H2O2 content of transgenic grape Chardonnay was higher than that of the wild type. The electrolyte permeability, proline, MDA, SOD, POD and CAT activities of grape leaves were measured. Before low temperature stress treatment, the electrolyte permeability, MDA and proline contents, and the activities of SOD, POD and CAT enzymes of all plants were almost the same. After low temperature stress treatment, compared with wild-type grape plants, grape plants overexpressing the VaWRKY72 gene had lower MDA content and electrolyte permeability, while higher proline content and activities of SOD, POD and CAT, as shown in Figure 6 As shown in d~i, the above results indicate that transient overexpression of VaWRKY72 gene can improve the cold tolerance of "Chardonnay" grape.

[0069] Example 9: Overexpression of VaWRKY72 gene upregulates the expression of cold stress-related genes in 'Chardonnay' grapes

[0070] To further investigate the mechanism of action of VaWRKY72 gene in grape, the expression levels of cold stress-related genes (VvCBF1, VvCBF2, VvCBF3, VvCBF4, VvKIN2 and VvCOR15) were analyzed. Figure 7 As shown in Figure 2, VvCBF1, VvCBF2, VvCBF3, and VvCBF4 play an important role in the early response to low temperature stress in plants, while VvKIN2 and VvCOR15 are late response genes. Figure 8 shown.

[0071] Although preferred embodiments of the present invention have been described, additional changes and modifications may be made to these embodiments by those skilled in the art once the basic inventive concepts are known. Obviously, various changes and modifications may be made to the present invention by those skilled in the art without departing from the spirit and scope of the present invention. Thus, the present invention is intended to include such changes and modifications if they fall within the scope of the technical equivalents of the present invention.

Claims

1. Application of Vitis amurensis VaWRKY72 gene in plant cold resistance, characterized in that: The nucleotide sequence of the Vitis amurensis VaWRKY72 gene is shown in SEQ ID NO.

1. By overexpressing the Vitis amurensis VaWRKY72 gene in plants, the cold tolerance of transgenic plants is improved; The plants include Arabidopsis thaliana and grape.

2. A recombinant expression vector, characterized in that: The method comprises the Vitis amurensis VaWRKY72 gene as claimed in claim 1.

3. The recombinant expression vector according to claim 2, characterized in that The method is obtained by inserting the Vitis amurensis VaWRKY72 gene into the Kpn I and BamHI sites of the pCAMBIA2300-GFP overexpression vector plasmid.

4. A recombinant engineered bacterium comprising the recombinant expression vector according to claim 3.

5. The recombinant engineered bacterium according to claim 4, characterized in that The recombinant expression vector is transferred into Agrobacterium competent cells GV3101 (pSoup) to obtain the expression vector.

6. Use of the recombinant expression vector according to claim 2 or 3 in cultivating cold-resistant transgenic plants, characterized in that: Compared with the wild type, the transgenic plants showed improved cold tolerance.

7. Use of the recombinant expression vector according to claim 6 in cultivating cold-resistant transgenic plants, characterized in that: The plants include Arabidopsis thaliana and grape.

8. Use of the recombinant engineered bacteria according to claim 4 or 5 in cultivating cold-resistant transgenic plants, characterized in that: Compared with the wild type, the transgenic plants showed improved cold tolerance.

9. The use of the recombinant engineered bacteria in cultivating cold-resistant transgenic plants according to claim 8, characterized in that: The plants include Arabidopsis thaliana and grape.

10. A method for improving the cold resistance of plants, characterized in that: The method comprises the step of overexpressing the Vitis amurensis VaWRKY72 gene of claim 1 in a plant; The plants include Arabidopsis thaliana and grape.

Images