Primer pair and method for identifying new Oudemansiella oosporium strain HCS

Abstract

The invention discloses a primer pair and a method for identifying a new Oudemansiella oosporoides strain HCS, and belongs to the technical field of specific molecular markers, the preservation number of the new Oudemansiella oosporoides strain HCS is CGMCC NO.41593, and the sequences of the primer pair Y6-F1 / Y6-R2 are as shown in SEQ ID NO.2 and SEQ ID NO.3. The specific method comprises the following steps: extracting DNA of an Oudemansiella oosporoides strain to be detected; carrying out PCR (Polymerase Chain Reaction) amplification by taking the extracted DNA of the sample to be detected as an amplification template and a molecular specific labeled primer consisting of the sequence shown by the primer as an amplification primer; and carrying out agarose gel electrophoresis detection on the PCR product. The primer pair has the advantages that the primer pair can be used for quickly identifying the strain HCS, the operation is simple and convenient, the specificity is strong, the accuracy is high, and a technical basis is provided for protecting a new variety of the strain HCS.

Description

Technical Field

[0001] The invention relates to the technical field of specific molecular markers, and in particular to a primer pair and a method for identifying a new strain HCS of Odetteria oosporea. Background Art

[0002] Oudemansiella raphanipes belongs to the genus Oudemansiella, family Physalacriceae, order Agaricales, class Agaricomycetes. It is also known as long-root mushroom, long-root money mushroom, dew chicken mushroom, etc. Because its appearance is similar to that of wild chicken mushroom and its color is dark brown, its trade name is black-skinned chicken mushroom. Oudemansiella raphanipes has a crisp and tender taste, and its fruiting body is rich in protein, amino acids, polysaccharides, vitamin C, polyphenols and other ingredients. It has rich nutritional value. Its polysaccharides not only have strong antioxidant capacity, but also can prevent intestinal barrier damage. Petroleum ether extract can effectively inhibit the activity of plant pathogens. Because of its extremely high nutritional value and medicinal value, it is very popular among consumers and has great market potential.

[0003] Although Agaricus oosporeus has been cultivated in factories, the commercial strains on the market are very single, with low yield and unstable quality. The strain problem has greatly restricted the industrial development of Agaricus oosporeus. The phenomenon of "same name but different things" and "same thing but different names" is serious in the market, resulting in great confusion in the classification and identification of Agaricus oosporeus.

[0004] Traditional classification and identification of edible fungi are mainly based on the morphological characteristics of fruiting bodies. However, edible fungi are easily affected by environmental factors such as temperature, light, humidity, and carbon dioxide concentration during the growth and development of fruiting bodies. Even for the same strain, its morphological characteristics usually vary to a certain extent in different environments. Traditional classification methods can no longer meet the needs, and the operation is cumbersome and the identification cycle is long. With the development of molecular biology technology, various molecular marker technologies have gradually been applied to the field of edible fungi. ISSR (inter-simplesequence repeat) is a microsatellite-based molecular marker developed by Zietkeiwitcz et al. in 1994 based on the SSR (simplesequence repeats) molecular marker technology. It is now widely used in the fields of edible fungi germplasm resource identification, kinship analysis, and DNA fingerprint map construction. Molecular markers are genetic markers established based on the variation of nucleotide sequences in genetic material between individuals, which can directly reflect the genetic differences of species. Summary of the invention

[0005] The technical problem to be solved by the present invention is to provide a primer pair and method for identifying a new strain HCS of Odetteria oosporeana in view of the deficiencies mentioned in the above background technology.

[0006] In order to solve the above technical problems, the technical solution provided by the present invention is as follows: the HCS preservation number of the new strain of Agaricus oosporei is CGMCC NO.41593; the primer pair is Y6-F1 / Y6-R2, the upstream primer sequence is: 5'-GCTTACTCTCGTGCGATGAAG-3'; the downstream primer sequence is: 5'-GAGGATAGTACACAGTGTGATGC-3',

[0007] A method for identifying a new strain of Odetteria oosporei HCS, comprising the following steps:

[0008] Step 1: extracting DNA from the Odetteria oosporea strain to be tested;

[0009] Step 2: Using the sample DNA extracted in step 1 as an amplification template and the molecular specific labeled primers composed of the sequences shown in the primers as amplification primers, PCR amplification is performed;

[0010] Step 3: Perform agarose gel electrophoresis on the PCR product of step 2 to obtain the specific DNA fragment of strain HCS.

[0011] As an improvement, the specific extraction method of step 1 is: after the strain is activated, it is transferred to PDA culture medium, cultured in the dark at 24°C for 10 days, then the mycelium is scraped, DNA is extracted using a fungal DNA extraction kit, and stored at -20°C.

[0012] As an improvement, the amplification system in the step 2 is: 2×Rapid Taq Master Mix 10 μL, 10 μmol / L primer 1 μL, DNA template 1 μL, ddH2O 8 μL, and the amplification program is 94°C pre-denaturation for 4 min, 94°C denaturation for 30 s, 60°C annealing for 30 s, 72°C extension for 60 s, 35 cycles, 72°C extension for 7 min, and storage at 4°C.

[0013] As an improvement, the electrophoresis in step three is to subject the amplified product in step two to gel electrophoresis at 1.5% agarose and 120V to obtain a specific DNA fragment of strain HCS.

[0014] As an improvement, the nucleic acid sequence of the specific molecular marker amplified by the primer pair Y6-F1 / Y6-R2 is shown as SEQ ID NO.1.

[0015] After adopting the above structure, the present invention has the following advantages: 1. The specific molecular marker of Odetteria oosporei HCS is simple, fast and accurate to operate, has a small error compared to traditional morphological identification, is not affected by environmental conditions, and is more intuitive.

[0016] 2. Based on the gene sequencing and bioinformatics analysis of Agaricus oosporeus, the present invention designs amplification primers for Agaricus oosporeus strain HCS, which have strong specificity, can specifically amplify the DNA extracted from HCS, and can amplify a 557bp fragment, but has no amplification effect on other Agaricus oosporeus strains. BRIEF DESCRIPTION OF THE DRAWINGS

[0017] Figure 1 This is a schematic diagram of the ISSR-PCR amplification results of 12 Oudenafil oospore strains using ISSR universal primer U880, which is a molecular marker method for specifically identifying Oudenafil oospore strains HCS.

[0018] Figure 2 This is a schematic diagram of the amplification results of the specific marker primer pair Y6-F1 / Y6-R2, which is a molecular marker for specifically identifying the HCS of the Agaricus oosporeus strain, on 12 Agaricus oosporeus strains. DETAILED DESCRIPTION

[0019] The present invention is described in further detail below.

[0020] 1. Patent name: A primer pair and method for identifying a new strain of Agaricus oosporeus HCS, the nucleotide sequence of which is as shown in SEQ ID NO.1. The strain HCS is a strain of Agaricus oosporeus with high yield and strong disease resistance obtained by separation, purification, domestication and cultivation from wild Agaricus oosporeus fruiting bodies collected from Yuelu Mountain, Changsha City, Hunan Province. The strain HCS has been deposited in the General Microbiological Center of China Microbiological Culture Collection Administration, No. 3, No. 1 Beichen West Road, Chaoyang District, Beijing, Institute of Microbiology, Chinese Academy of Sciences, Postal Code 100101, Deposit Number: CGMCC NO.41593, Deposit Date: November 11, 2024.

[0021] 2. The present invention provides a primer pair for rapid identification of a new strain of Odetteria oosporea HCS, comprising an upstream primer SEQ ID NO.2 and a downstream primer SEQ ID NO.3.

[0022] SEQ ID NO.1:

[0023] GCTTACTCTCGTGCGATGAAGATATACGTTCTCGACTGTACAATAGTAAGTGGTGGCAGCGGCTGCAGCACCGCGTCTGG

[0024] AGACGCGTAACTCTCACGTGCCCGCTTCAGATAACCTCTTGGGGTTGCTACACCGCCCGCCGCGGCAAGAGACTCTCCTG

[0025] CACGGTCAAGTCATGGCTTCGCAGATAAGTCACACCAATTCTTGTGGCATCCGTCCACTGCGCACAGATTCGAATTCTTG

[0026] ATGGTGATGAGAAATCCGCGCCAGCTCCCCGGTACGAACATCCATCCATATGGCAGCGAATAGTAATACGTGCGGAAGAT

[0027] CCAAGGCCCAGAGTTGACGTCCAGCGCCAAACTGAGCTGGAAAAATCGGATGTTGGTAATAAGCAAATTAGAATCCGGAAA

[0028] GTATTCATTCACCCCCTAGATATCGTCCCGGCCCGCGCGCCACACCGACTGAGCCGTGTATCCGAATCCAATCAGACCCC

[0029] TTTCGTTCGTCCTCAAGGCATAATTGGGGGCGTTAATAACGCCCCCATCATCATGCATCACACTGTGTACTATCCTC;

[0030] SEQ ID NO.2: GCTTACTCTCGTGCGATGAAG;

[0031] SEQ ID NO.3: GAGGATAGTACACAGGTTGATGC;

[0032] SEQ ID NO.4: GGAGAGGAGAGGAGA;

[0033] The primer pair is Y6-F1 / Y6-R2, the upstream primer sequence is: 5'-GCTTACTCTCGTGCGATGAAG-3'; the downstream primer sequence is: 5'-GAGGATAGTACACAGTGTGATGC-3',

[0034] The Y6-F1 and Y6-R2 correspond to SEQ ID NO.2 and SEQ ID NO.3 respectively.

[0035] 3. The present invention provides a method for rapidly identifying Odetteria oosporea HCS, using primer pairs for identification.

[0036] The method comprises: extracting genomic DNA of the to-be-tested Odetteria oosporea as a template, performing PCR amplification using upstream and downstream primers, and determining that the Odetteria oosporea is HCS if the amplified product contains the specific molecular marker shown in 1.

[0037] The present invention also provides specific steps for using the molecular specific marker primers composed of the sequences shown in SEQ ID NO.2 and SEQ ID NO.3 in identifying strain HCS:

[0038] Step 1: extracting DNA from the Odetteria oosporea strain to be tested;

[0039] Step 2: Using the DNA of the sample to be tested extracted in step 1 as an amplification template, and using the molecular specific labeled primers composed of the sequences shown in SEQ ID NO.2 and SEQ ID NO.3 as amplification primers, PCR amplification is performed;

[0040] Step 3: Perform agarose gel electrophoresis on the PCR product of step 2. If a 557 bp fragment appears in the electrophoresis result, the sample to be tested is strain HCS, otherwise it is not.

[0041] The nucleic acid sequence of the specific molecular marker amplified by the primer pair Y6-F1 / Y6-R2 is shown in SEQ ID NO.1. Specific embodiment:

[0043] 1. Test materials

[0044] The test strains were 12 strains of Agaricus oosporeans as shown in Table 1, among which the HCS parent of the new Agaricus oosporeans strain was a wild Agaricus oosporeans fruiting body collected from Yuelu Mountain in Changsha City, Hunan Province on May 22, 2022. It was obtained through systematic domestication and breeding, and was deposited in the China General Microbiological Culture Collection Center (CGMCC) on November 11, 2024, with the deposit number CGMCC NO.41593, and the deposit address is: Institute of Microbiology, Chinese Academy of Sciences, No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing.

[0045] Table 1 Test strains

[0046]

[0047] 2. Obtaining HCS-specific DNA fragments of Oudena oosporeensis strains

[0048] (1) After activation, the 12 strains were transferred to PDA medium and cultured in the dark at 24°C for 10 days. Mycelium was scraped and DNA was extracted using a fungal DNA extraction kit and stored at -20°C.

[0049] (2) Thirty primers were randomly selected from 100 ISSR universal primers from Columbia University, and the DNA of 12 strains was used as a template for screening. Finally, primer U880 (5'-GGAGAGGAGAGGAGA-3', SEQ ID NO.4) was used for amplification. The amplification system was: 2×Rapid Taq Master Mix 10μL, 10μmol / L primer 1μL, DNA template 1μL, ddH2O8μL. The amplification program was 94℃ pre-denaturation for 4min, 94℃ denaturation for 30s, 57℃ annealing for 30s, 72℃ extension for 120s, 35 cycles, 72℃ extension for 7min, and storage at 4℃.

[0050] (3) The amplified product was subjected to gel electrophoresis at 120V on 1.5% agarose gel and observed and photographed on a gel imager. The results are as follows: Figure 1 As shown (lanes 1-11 are H1-2, H1-4, HW, HCS, HP, HFZ, HDS, HY, HJD, HZW, HZH, and HGT, respectively), a specific DNA fragment of strain HCS was obtained.

[0051] 3. Design of specific molecular markers for strain HCS

[0052] (1) The obtained specific DNA fragment of strain HCS was recovered by gel, cloned, and sequenced to obtain a specific sequence of 795 bp in length.

[0053] Method: Select Figure 1 The clear bands marked on the gel image were excised and purified, and the purified products were connected to the pEASY-T&BZero vector and transformed into Trans1-T1 competent cells, spread on LB solid medium containing AMP, and cultured at 37°C overnight. Single colonies were picked and inoculated into LB liquid medium and cultured for 6-8 hours. After the bacterial solution was verified as a positive clone by primer amplification, fresh bacterial solution was used to sequence the vector insert fragment.

[0054] (2) Use Snapgene software to design specific primers for the obtained sequences, complete primer synthesis and sequencing of amplified products.

[0055] Obtain strain HCS molecular marker primers: Y6-F1 / Y6-R2

[0056] Y6-F1: 5'-GCTTACTCTCGTGCGATGAAG-3'

[0057] Y6-R2: 5'-GAGGATAGTACACAGGTTGATGC-3'

[0058] 4. Verification of specific molecular markers

[0059] PCR amplification was performed using DNA from 12 Oudenbergia oosporea strains as templates and Y6-F1 and Y6-R2 as primers. The amplification system included 10 μL of 2×Rapid Taq Master Mix, 0.5 μL of each 10 μmol / L primer, 1 μL of DNA template, and 8 μL of ddH2O.

[0060] The amplification program was 94°C pre-denaturation for 4 min, 94°C denaturation for 30 s, 60°C annealing for 30 s, 72°C extension for 60 s, 35 cycles, 72°C extension for 7 min, and storage at 4°C.

[0061] The amplification results were detected by 1% agarose gel electrophoresis at a voltage of 120V. Figure 2 shown.

[0062] Depend on Figure 2 It can be seen that strain HCS can amplify a specific fragment of 557 bp in size, while other Odetteria oosporea strains have no bands, which indicates that the specific molecular marker of Odetteria oosporea strain HCS of the present invention has extremely high specificity and can be used for rapid identification of strain HCS among different strains of Odetteria oosporea.

[0063] The present invention and its implementation methods are described above, and such description is not restrictive, and the actual structure is not limited thereto. In short, if a person skilled in the art is inspired by it, and does not deviate from the purpose of the invention, and does not creatively design a structure and implementation method similar to the technical solution, they should all fall within the protection scope of the present invention.

Claims

1. A primer pair for identifying a new strain of Odetteria oosporei HCS, characterized in that: The HCS preservation number of the new strain of Odetteria oosporea is CGMCC NO.41593; the primer pair is Y6-F1 / Y6-R2, the upstream primer sequence is: 5'-GCTTACTCTCGTGCGATGAAG-3'; the downstream primer sequence is: 5'-GAGGATAGTACACAGTGTGATGC-3'.

2. A method for identifying the Odetteria oosporea strain HCS, characterized in that: The following steps are involved: Step (1): extracting DNA from the Odetteria oosporea strain to be tested; Step (2): using the DNA of the sample to be tested extracted in step (1) as an amplification template and using the molecular specific labeled primers composed of the sequences shown in the primers as amplification primers to perform PCR amplification; Step (3): Detect the PCR product of step (2) by agarose gel electrophoresis.

3. A method for identifying the Odetteria oosporea strain HCS according to claim 2, characterized in that: The specific extraction method of step (1) is as follows: after the strain is activated, it is transferred to PDA culture medium, cultured in the dark at 24°C for 10 days, then the mycelium is scraped, DNA is extracted using a fungal DNA extraction kit, and stored at -20°C.

4. A method for identifying the Odetteria oosporea strain HCS according to claim 2, characterized in that: The amplification system in step (2) is: 2×RapidTaq Master Mix 10 μL, 1 μL of 10 μmol / L primer, 1 μL of DNA template, 8 μL of ddH2O, and the amplification program is 94°C pre-denaturation for 4 min, 94°C denaturation for 30 s, 60°C annealing for 30 s, 72°C extension for 60 s, 35 cycles, 72°C extension for 7 min, and storage at 4°C.

5. A method for identifying the Odetteria oosporea strain HCS according to claim 2, characterized in that: The electrophoresis in step (3) is to perform gel electrophoresis on the amplified product in step 2 through 1%-1.5% agarose and 120V. If a 557bp fragment appears in the amplification result, it can be determined that the sample to be tested is the Odetteria oosporea strain HCS.

6. A method for identifying the Odetteria oosporea strain HCS according to claim 5, characterized in that: The nucleic acid sequence of the specific molecular marker amplified by the primer pair Y6-F1 / Y6-R2 is shown in SEQ ID NO.1.

Images