Colorimetric sensing system based on non-affinity aptamer and application of colorimetric sensing system in antibiotic detection

Abstract

The invention discloses a colorimetric sensing system based on a non-affinity aptamer and application of the colorimetric sensing system in antibiotic detection. Belongs to the technical field of analytical chemistry detection. According to the colorimetric sensing system of the non-affinity aptamer and the detection method, the technical bottleneck of the prior art is broken through, the non-affinity aptamer is successfully applied to detection of small molecular substances, detection of multi-target antibiotics such as kanamycin, tobramycin and chloramphenicol is realized, the application range of the non-affinity aptamer is widened, and the application range of the non-affinity aptamer is widened. The technical support is provided for the development of the non-affinity aptamer in the field of analytical chemistry detection.

Description

Technical Field

[0001] The invention relates to the technical field of analytical chemistry detection, and more particularly to a colorimetric sensing system based on non-affinity aptamers and its application in antibiotic detection. Background Art

[0002] Aptamers are a class of short single-stranded nucleic acid molecules obtained through in vitro screening technology. The specificity and affinity of aptamers are the two main characteristics of the working mechanism of aptamers. The specificity of aptamers refers to their ability to bind to specific target molecules. When designing aptamers, multiple rounds of screening and optimization are usually performed to ensure the selectivity of aptamers for target molecules. Aptamers with high specificity can effectively reduce background signals and improve signal contrast, making the detection process more accurate. For example, in environmental monitoring and food safety testing, specificity can ensure that aptamers only react with target pollutants without being affected by other interfering substances. The affinity of aptamers refers to the strength of their binding to target molecules. Affinity is usually expressed by the binding constant Kd. The lower the Kd value, the stronger the binding force between the aptamer and the target. Some high-affinity aptamers can bind to the target at picomolar or nanomolar concentrations. Affinity not only affects the detection sensitivity of aptamers, but also determines the effectiveness of their application in biological systems. Due to their high selectivity and sensitivity, nucleic acid aptamers are widely used in the field of biosensing, such as pesticide detection, heavy metal detection, antibiotic detection, and biological toxin detection.

[0003] Based on their unique specificity and affinity, nucleic acid aptamers have become a powerful tool for modern analytical detection, greatly improving their effectiveness in various applications. Unlike specific nucleic acid aptamers, some nucleic acids have weaker affinity for targets, namely non-affinity aptamers. Studies have shown that these non-affinity aptamers have different affinities for the same target molecule and also show different affinities for targets with similar structures. And because of their weak specific recognition ability, they have not yet been applied in the field of analytical detection, and there are no related studies on the use of non-affinity aptamers in multi-target small molecule detection, and there are no related articles on the design of corresponding non-affinity aptamer detection systems.

[0004] Therefore, expanding the application of non-affinity aptamers in the field of analytical chemistry detection technology and constructing a detection system and method for multi-target small molecules based on non-affinity aptamers are technical problems that technical personnel in this field urgently need to solve. Summary of the invention

[0005] In view of this, the present invention provides a colorimetric sensing system based on non-affinity aptamers and its application in antibiotic detection, which breaks through the technical bottleneck of the prior art, successfully applies non-affinity aptamers to the detection of small molecules, realizes the detection of multi-target antibiotics such as kanamycin, tobramycin and chloramphenicol, broadens the application scope of non-affinity aptamers, and provides technical support for the development of non-affinity aptamers in the field of analytical chemistry detection.

[0006] In order to achieve the above object, the present invention adopts the following technical solution:

[0007] A colorimetric sensing system based on a non-affinity aptamer is prepared by the following method:

[0008] (1) Preparation of gold nanoparticles: Heat chloroauric acid solution to boiling, slowly add sodium citrate solution, keep boiling and stirring continuously, cool naturally after a certain period of time, and set aside;

[0009] (2) Constructing a colorimetric sensing system: The nanogold solution prepared in step (1) is added to a microplate, and then a plurality of non-affinity aptamers are added to the microplate containing the nanogold solution, with each non-affinity aptamer being one unit, with each row or column being a unit, and incubated at room temperature to construct a colorimetric sensing system of non-affinity aptamers.

[0010] Preferably, the nano-gold particles prepared in step (1) have a particle size of 8-14 nm; the dripping speed of the sodium citrate solution is 0.1-100 μL / s; after the citric acid solution is dripped, the final concentration in the system is 0.1-200 μmol / L; and the boiling time is 5-45 min.

[0011] Preferably, the multiple non-affinity aptamers in step (2) include Apt-1, Apt-2, Apt-3, Apt-4, Apt-5, Apt-6 and Apt-7, and their sequences are as follows:

[0012] Apt-1: TAGCCAATTCGTCGACGGATCCGGGGTCTGGTGTTCTGCTT TGTTCTGTCGGGTCGTCTGCAGGTCGACGCATGCGTTT, SEQ ID NO.1;

[0013] Apt-2: GGGACTTGGTTTAGGTAATGAGTCCCGGTT, SEQ ID NO.2;

[0014] Apt-3:TCGACATCCATGGCACGTTATGTCGATTGG, SEQ ID NO.3;

[0015] Apt-4: GCGGGCGGTTGTATAGCGGTTGG, SEQ ID NO.4;

[0016] Apt-5: GGTTCGTACGGAATTCGCTAGCCCGGCGGCAGGCCACGGCT TGGGTTGGTCCCACTGCGCGTGGATCCGAGCTCCACGTG, SEQ ID NO.5;

[0017] Apt-6: GGGGGCACACATGTAGGTGCTGTCCAGGTGTGGTTGTGGTG GTT, SEQ ID NO.6;

[0018] Apt-7: ACTTCAGTGAGTTGTGGCACGGTCGGCGAGTCGGTGGTAGG GTT, SEQ ID NO.7;

[0019] The above-mentioned Apt-1, Apt-2, Apt-3, Apt-4, Apt-4, Apt-4, and Apt-7 non-affinity aptamers have different affinities for target molecules.

[0020] Preferably, the concentration of the non-affinity aptamer in step (2) is 0.1-5 μmol / L; the volume ratio of the nanogold solution to the non-affinity aptamer in each microwell is 14:1; and the room temperature incubation time is 10-60 min.

[0021] Another object of the present invention is to provide: application of the above-mentioned colorimetric sensing system based on non-affinity aptamers in antibiotic detection.

[0022] Another object of the present invention is to provide: a method for detecting antibiotics using a non-affinity aptamer colorimetric sensing system, wherein the method uses the non-affinity aptamer colorimetric sensing system to detect antibiotics, and specifically comprises the following steps:

[0023] (1) Adding the antibiotic solution to be detected into the microwells of the non-affinity aptamer colorimetric sensing system and incubating at room temperature;

[0024] (2) The sensor system signal data of different micropores are measured in turn, and the detection data are analyzed and the results are determined using a data analysis pattern recognition algorithm.

[0025] Preferably, the room temperature incubation time in step (1) is 5-40 min; and the antibiotic to be detected is kanamycin, tobramycin and / or chloramphenicol.

[0026] Preferably, the sensing system signal in step (2) can be a grayscale value, a fluorescence signal, an electrochemical signal or an ultraviolet absorption signal; and the data analysis pattern recognition algorithm can be principal component analysis PCA, linear discriminant analysis LDA or independent component analysis ICA.

[0027] Further preferably, when principal component analysis PCA is used for data analysis, the result can be determined based on whether the ellipses of different sample points intersect.

[0028] Further preferably, the result is judged according to whether the ellipses of sample points of different types of antibiotics with different concentrations intersect, which can be used to analyze the recognition thresholds of different types of antibiotics by the method.

[0029] It can be seen from the above technical solution that compared with the prior art, the present invention has the following beneficial effects:

[0030] (1) The present invention provides a colorimetric sensing system based on non-affinity aptamers, which breaks through the technical bottleneck of the prior art and successfully applies non-affinity aptamers to the detection of small molecules, thus realizing the detection of multi-target antibiotics such as kanamycin, tobramycin and chloramphenicol, broadening the application scope of non-affinity aptamers and providing technical support for the development of non-affinity aptamers in the field of analytical chemistry detection.

[0031] (2) The non-affinity aptamer-based colorimetric sensing system provided by the present invention has the characteristics of simple preparation, rapid response, high-throughput detection, reliable results, strong recognition, and intuitive analysis results.

[0032] (3) The method for detecting antibiotics using a non-affinity aptamer colorimetric sensing system provided by the present invention can achieve qualitative and quantitative detection of multiple antibiotics without adding salt ions, which is of great significance for environmental risk assessment and occupational exposure risk analysis. BRIEF DESCRIPTION OF THE DRAWINGS

[0033] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments or the description of the prior art will be briefly introduced below. Obviously, the drawings described below are only embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on the provided drawings without paying creative work.

[0034] Figure 1 For: UV-visible spectroscopy characterization of gold nanoparticles;

[0035] Figure 2 The invention relates to: a colorimetric sensing system of a non-affinity aptamer constructed;

[0036] Figure 3Figure 2: The results of different antibiotics tested in different aptamer-nanogold systems.

[0037] Figure 4 To: Construct antibiotic discrimination model using PCA method. DETAILED DESCRIPTION

[0038] The following will be combined with the drawings in the embodiments of the present invention to clearly and completely describe the technical solutions in the embodiments of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0039] Example 1

[0040] A colorimetric sensing system based on a non-affinity aptamer, the preparation method is as follows:

[0041] (1) Preparation of gold nanoparticles: 50 mL of chloroauric acid solution was added to a round-bottom flask, heated to boiling, and then 2 mL of 1% sodium citrate solution was slowly added dropwise at a rate of 0.1-100 μL / s. The mixture was heated and stirred for 10 min, and then the heating was stopped and the mixture was cooled to room temperature. AuNPs with a particle size of 12 nm were obtained and set aside. The results of UV-visible spectroscopy were as follows: Figure 1 As shown;

[0042] (2) Construction of colorimetric sensing system: Using a 96-well plate as the reaction system carrier, 140 μL of AuNPs solution was added to the wells in the first row and first column (denoted as A1), the wells in the first row and second column (denoted as A2), the wells in the first row and third column (denoted as A3), the wells in the first row and fourth column (denoted as A4), the wells in the first row and fifth column (denoted as A5), the wells in the first row and sixth column (denoted as A6), and the wells in the first row and seventh column (denoted as A7);

[0043] Similarly, add the hole in the 2nd row and 1st column (denoted as B1), the hole in the 2nd row and 2nd column (denoted as B2), the hole in the 2nd row and 3rd column (denoted as B3), the hole in the 2nd row and 4th column (denoted as B4), the hole in the 2nd row and 5th column (denoted as B5), the hole in the 2nd row and 6th column (denoted as B6), and the hole in the 2nd row and 7th column (denoted as B7);

[0044] Similarly, add the hole in the 3rd row and 1st column (denoted as C1), the hole in the 3rd row and 2nd column (denoted as C2), the hole in the 3rd row and 3rd column (denoted as C3), the hole in the 3rd row and 4th column (denoted as C4), the hole in the 3rd row and 5th column (denoted as C5), the hole in the 3rd row and 6th column (denoted as C6), and the hole in the 3rd row and 7th column (denoted as C7);

[0045] In the above microwells, each column is regarded as one unit, and each non-affinity aptamer is one unit, and 1 μM non-affinity aptamer solution is added respectively, as follows:

[0046] The first column is added with non-affinity aptamer Apt-1, the second column is added with non-affinity aptamer Apt-2, the third column is added with non-affinity aptamer Apt-3, the fourth column is added with non-affinity aptamer Apt-4, the fifth column is added with non-affinity aptamer Apt-4, the sixth column is added with non-affinity aptamer Apt-4, and the seventh column is added with non-affinity aptamer Apt-7; the above non-affinity aptamer sequences are as follows:

[0047] Apt-1: TAGCCAATTCGTCGACGGATCCGGGGTCTGGTGTTCTGCTT TGTTCTGTCGGGTCGTCTGCAGGTCGACGCATGCGTTT, SEQ ID NO.1;

[0048] Apt-2: GGGACTTGGTTTAGGTAATGAGTCCCGGTT, SEQ ID NO.2;

[0049] Apt-3:TCGACATCCATGGCACGTTATGTCGATTGG, SEQ ID NO.3;

[0050] Apt-4: GCGGGCGGTTGTATAGCGGTTGG, SEQ ID NO.4;

[0051] Apt-5: GGTTCGTACGGAATTCGCTAGCCCGGCGGCAGGCCACGGCT TGGGTTGGTCCCACTGCGCGTGGATCCGAGCTCCACGTG, SEQ ID NO.5;

[0052] Apt-6: GGGGGCACACATGTAGGTGCTGTCCAGGTGTGGTTGTGGTG GTT, SEQ ID NO.6;

[0053] Apt-7: ACTTCAGTGAGTTGTGGCACGGTCGGCGAGTCGGTGGTAGG GTT, SEQ ID NO.7;

[0054] The above-mentioned Apt-1, Apt-2, Apt-3, Apt-4, Apt-4, Apt-4, and Apt-7 non-affinity aptamers all have different affinities for the target molecules;

[0055] After the non-affinity aptamer was added, the mixture was incubated at room temperature for 30 min to obtain a colorimetric sensing system of the non-affinity aptamer. Figure 2 shown.

[0056] Example 2

[0057] A method for detecting antibiotics using a non-affinity aptamer colorimetric sensing system, wherein the non-affinity aptamer colorimetric sensing system prepared in Example 1 is used to detect antibiotics, and specifically comprises the following steps:

[0058] (1) 20 μM kanamycin (KANA), tobramycin (TBMS), and chloramphenicol (LMSS) solutions were added to the above-mentioned sensor detection system and incubated at room temperature for 5 min;

[0059] (2) After the room temperature incubation, the image was captured using a smartphone and converted into a grayscale image using PS. The grayscale value of each microwell was read to obtain seven sets of data: A1\B1\C1, A2\B2\C2, A3\B3\C3, A4\B4\C4, A5\B5\C5, A6\B6\C6, and A7\B7\C7. The results are as follows: Figure 3 shown.

[0060] (3) According to the above method, different concentrations (30, 20, 10, 5, 3 μM) of kanamycin, tobramycin, and chloramphenicol were added to the aptamer-nanogold system. After incubation at room temperature for 5 min, images were collected using a smartphone and converted into grayscale images using PS. The grayscale values ​​of each micropore were read to obtain the grayscale values ​​under different concentration conditions. The obtained data were used to construct an analysis model using the PCA method. The discriminant analysis results are shown in Figure 2. Figure 4 shown.

[0061] Result analysis: From Figure 3 It can be seen that the grayscale values ​​produced by adding the same antibiotic to different AuNPs+Apt-X colorimetric systems are quite different; the grayscale values ​​caused by adding different antibiotics to the same AuNPs+Apt-X colorimetric system are also different. This result shows that the signal changes caused by adding antibiotics to different Apt sensing systems are different. This result is mainly because the aptamers Apt1, Apt2, Apt3, Apt4, Apt5, Apt6, and Apt7 have different affinities for different target antibiotics.

[0062] from Figure 4It can be seen that the PCA method is used to analyze the colorimetric data. The sample points of three antibiotics kanamycin, tobramycin, and chloramphenicol at different concentrations (30, 20, 10, 5, and 3 μM) are significantly dispersed (the ellipses have no intersections), and there is no cross-overlap. It proves that the colorimetric sensing system data constructed based on Apt1, Apt2, Apt3, Apt4, Apt5, Apt6, and Apt7 can be used to construct a model using the PCA method, and the identification of target molecules kanamycin, tobramycin, and chloramphenicol in the concentration range of 30-3 μM can be achieved. This method realizes the specific detection of target molecules based on nonspecific aptamers, and realizes the detection of multiple target antibiotics.

[0063] Example 3

[0064] Identification performance and judgment criteria

[0065] When the kanamycin sample point ellipse does not intersect with the tobramycin and chloramphenicol sample point ellipses, it means that the AuNPs colorimetric system based on aptamers Apt1, Apt2, Apt3, Apt4, Apt5, Apt6, and Apt7 can be used for the specific identification of kanamycin with high recognition;

[0066] When the tobramycin sample point ellipse does not intersect with the kanamycin and chloramphenicol sample point ellipses, it means that the AuNPs colorimetric system based on aptamers Apt1, Apt2, Apt3, Apt4, Apt5, Apt6, and Apt7 can be used for specific identification of tobramycin with high recognition;

[0067] When the ellipse of the chloramphenicol sample point does not intersect with the ellipse of the tobramycin and kanamycin sample points, it means that the AuNPs colorimetric system based on aptamers Apt1, Apt2, Apt3, Apt4, Apt5, Apt6, and Apt7 can be used for the specific identification of chloramphenicol with high recognition;

[0068] When the kanamycin sample point ellipse intersects with the tobramycin sample point ellipse, it means that the AuNPs colorimetric system based on aptamers Apt1, Apt2, Apt3, Apt4, Apt5, Apt6, and Apt7 cannot distinguish between kanamycin and tobramycin;

[0069] When the kanamycin sample point ellipse intersects with the chloramphenicol sample point ellipse, it means that the AuNPs colorimetric system based on aptamers Apt1, Apt2, Apt3, Apt4, Apt5, Apt6, and Apt7 cannot distinguish between kanamycin and chloramphenicol;

[0070] When the chloramphenicol sample point ellipse intersects with the tobramycin sample point ellipse, it means that the AuNPs colorimetric system based on aptamers Apt1, Apt2, Apt3, Apt4, Apt5, Apt6, and Apt7 cannot distinguish chloramphenicol from tobramycin.

[0071] When the sample point ellipses of kanamycin, tobramycin, and chloramphenicol all intersect, it means that the AuNPs colorimetric system based on aptamers Apt1, Apt2, Apt3, Apt4, Apt5, Apt6, and Apt7 cannot distinguish between kanamycin, tobramycin, and chloramphenicol.

[0072] When the ellipses of kanamycin, tobramycin, and chloramphenicol sample points are tangent, it means that the AuNPs colorimetric system based on aptamers Apt1, Apt2, Apt3, Apt4, Apt5, Apt6, and Apt7 can distinguish and identify kanamycin, tobramycin, and chloramphenicol to the threshold critical point, and the corresponding minimum antibiotic concentration is the maximum recognition of the method.

[0073] The various embodiments in this specification are described in a progressive manner, and each embodiment focuses on the differences from other embodiments. The same or similar parts between the various embodiments can be referenced to each other.

[0074] The above description of the disclosed embodiments enables one skilled in the art to implement or use the present invention. Various modifications to these embodiments will be apparent to one skilled in the art, and the general principles defined herein may be implemented in other embodiments without departing from the spirit or scope of the present invention. Therefore, the present invention will not be limited to the embodiments shown herein, but rather to the widest scope consistent with the principles and novel features disclosed herein.

Claims

1. A colorimetric sensing system based on non-affinity aptamers, characterized in that: Prepared by the following method: (1) Preparation of gold nanoparticles: Heat chloroauric acid solution to boiling, slowly add sodium citrate solution, keep boiling and stirring continuously, cool naturally after a certain period of time, and set aside; (2) Constructing a colorimetric sensing system: The nanogold solution prepared in step (1) is added to a microplate, and then a plurality of non-affinity aptamers are added to the microplate containing the nanogold solution, with each non-affinity aptamer being one unit, with each row or column being a unit, and incubated at room temperature to construct a colorimetric sensing system of non-affinity aptamers.

2. The colorimetric sensing system according to claim 1, characterized in that: The nano-gold particles prepared in step (1) have a particle size of 8-14 nm; the dripping speed of the sodium citrate solution is 0.1-100 μL / s; after the citric acid solution is dripped, the final concentration in the system is 0.1-200 μmol / L; and the boiling time is 5-45 min.

3. The colorimetric sensing system according to claim 1, characterized in that: The multiple non-affinity aptamers in step (2) include Apt-1, Apt-2, Apt-3, Apt-4, Apt-5, Apt-6 and Apt-7, and their sequences are as follows: Apt-1: TAGCCAATTCGTCGACGGATCCGGGGTCTGGTGTTCTGCTT TGTTCTGTCGGGTCGTCTGCAGGTCGACGCATGCGTTT, SEQ ID NO.1; Apt-2: GGGACTTGGTTTAGGTAATGAGTCCCGGTT, SEQ ID NO.2; Apt-3:TCGACATCCATGGCACGTTATGTCGATTGG, SEQ ID NO.3; Apt-4: GCGGGCGGTTGTATAGCGGTTGG, SEQ ID NO.4; Apt-5: GGTTCGTACGGAATTCGCTAGCCCGGCGGCAGGCCACGGCT TGGGTTGGTCCCACTGCGCGTGGATCCGAGCTCCACGTG, SEQ ID NO.5; Apt-6: GGGGGCACACATGTAGGTGCTGTCCAGGTGTGGTTGTGGTG GTT, SEQ ID NO.6; Apt-7: ACTTCAGTGAGTTGTGGCACGGTCGGCGAGTCGGTGGTAGG GTT, SEQ ID NO.7; The above-mentioned Apt-1, Apt-2, Apt-3, Apt-4, Apt-4, Apt-4, and Apt-7 non-affinity aptamers have different affinities for target molecules.

4. The colorimetric sensing system according to claim 1, characterized in that: In step (2), the concentration of the non-affinity aptamer is 0.1-5 μmol / L; the volume ratio of the nanogold solution to the non-affinity aptamer in each microwell is 14:1; and the room temperature incubation time is 10-60 min.

5. Use of the non-affinity aptamer-based colorimetric sensing system according to any one of claims 1 to 4 in antibiotic detection.

6. A method for detecting antibiotics using a non-affinity aptamer colorimetric sensing system, characterized in that: The method of detecting antibiotics using the colorimetric sensing system of the non-affinity aptamer according to any one of claims 1 to 4 comprises the following steps: (1) Adding the antibiotic solution to be detected into the microwells of the non-affinity aptamer colorimetric sensing system and incubating at room temperature; (2) The sensor system signal data of different micropores are measured in turn, and the detection data are analyzed and the results are determined using a data analysis pattern recognition algorithm.

7. The method for detecting antibiotics using a non-affinity aptamer colorimetric sensing system according to claim 6, characterized in that: The room temperature incubation time in step (1) is 5-40 min; the antibiotic to be detected is kanamycin, tobramycin and / or chloramphenicol.

8. The method for detecting antibiotics using a non-affinity aptamer colorimetric sensing system according to claim 6, characterized in that: The sensing system signal in step (2) can be a grayscale value, a fluorescence signal, an electrochemical signal or an ultraviolet absorption signal; the data analysis pattern recognition algorithm can be principal component analysis PCA, linear discriminant analysis LDA or independent component analysis ICA.

9. The method for detecting antibiotics using a non-affinity aptamer colorimetric sensing system according to claim 8, characterized in that: When principal component analysis (PCA) is used for data analysis, the result can be determined based on whether the ellipses of different sample points intersect.

10. The method for detecting antibiotics using a non-affinity aptamer colorimetric sensing system according to claim 9, characterized in that: The result is judged based on whether the ellipses of sample points of different types of antibiotics and different concentrations intersect, which can be used to analyze the recognition thresholds of different types of antibiotics by this method.

Images