Anti-clubroot mustard type rape gene BjuA03.CAPE3 and application thereof

Abstract

The invention discloses a clubroot-resistant brassica juncea gene BjuA03.CAPE3 and application thereof, relates to the technical field of gene engineering, and has the technical key point that the nucleotide sequence of the clubroot-resistant brassica juncea gene BjuA03.CAPE3 is SEQ ID No.1. The invention also discloses a preparation method of the clubroot-resistant brassica juncea gene BjuA03.CAPE3. The invention also provides a recombinant expression vector for expressing the clubroot-resistant mustard type rape gene BjuA03.CAPE3. The invention also provides a recombinant expression vector for expressing the clubroot-resistant mustard type rape gene BjuA03.CAPE3 The invention also provides an engineering strain for expressing the clubroot-resistant mustard type rape gene BjuA03. CAPE3. The invention also provides an engineering strain for expressing the clubroot-resistant mustard type rape gene BjuA03. According to the invention, brassica juncea and brassica juncea are hybridized through distant hybridization to artificially synthesize the clubroot-resistant brassica juncea, and the disease-resistant gene of the artificially synthesized clubroot-resistant brassica juncea is further positioned through simplified genome sequencing, so that important theoretical basis and gene resources are provided for cultivating a new variety of brassica juncea with lasting resistance.

Description

Technical Field

[0001] The invention relates to the technical field of genetic engineering, and in particular to a clubroot-resistant mustard-type rapeseed gene BjuA03.CAPE3 and an application thereof. Background Art

[0002] Clubroot fungi mainly harm the roots of plants. After the plants are infected, tumors of varying sizes gradually grow on the main roots, lateral roots and fibrous roots. In the later stages of infection, the tumors become cracked and rough, and are easily invaded by other bacteria and cause rot, which seriously affects the normal absorption of water and nutrients by the plants. Clubroot is a devastating soil-borne plant disease worldwide due to its strong infectiousness, rapid spread, multiple transmission pathways, poor biological and chemical control effects, and lack of plants with broad-spectrum antigens. At present, some genes / sites that are resistant to clubroot have been found mainly in vegetables, such as European turnip / cabbage, cabbage, black mustard, radish, etc., while fewer sources of resistance have been found in Brassica napus. At present, at least 28 QTLs related to clubroot resistance have been located on five chromosomes of cabbage, namely A01, A02, A03, A06 and A08. Among them, 12 resistance QTLs (Crr3, Rcr1, Rcr2, Rcr4, Rcr5, ​​PbBa3.1, CRk, CRd, CRb, CRa, CRaki, PbBp3.3) are located on chromosome A03, and these loci are linked to each other, indicating that the clubroot resistance loci from cabbage are relatively single. The clubroot resistance in Brassica napus mainly comes from cabbage.

[0003] Planting a single disease-resistant variety or a variety with only a single resistance in a certain area may cause the disease-resistant gene to become ineffective as the root-knot fungus mutates. The disease-resistant varieties bred in Canada early on have lost their disease resistance due to the single disease-resistant site and planting variety, and the evolved root-knot fungus is more toxic. The resistance source of the currently created clubroot-resistant Brassica napus germplasm or varieties is relatively single, resulting in a relatively single disease resistance. Therefore, in order to broaden the clubroot-resistant gene pool, it is necessary to cultivate new excellent Brassica napus varieties with broad-spectrum resistance. Summary of the invention

[0004] The purpose of the present invention is to solve the above problems and provide a clubroot-resistant Brassica juncea gene BjuA03.CAPE3 and its application.

[0005] In order to achieve the above object, the technical solution of the present invention is as follows: a clubroot-resistant Brassica juncea gene BjuA03.CAPE3, whose nucleotide sequence is SEQ ID No.1.

[0006] Furthermore, the clubroot-resistant Brassica juncea gene BjuA03.CAPE3 comes from the clubroot-resistant Brassica juncea R13, and the clubroot-resistant Brassica juncea R13 is obtained by distant hybridization of clubroot-resistant Brassica rapa and Brassica nigra.

[0007] A recombinant expression vector of a clubroot-resistant Brassica juncea gene BjuA03.CAPE3 is obtained by connecting the gene BjuA03.CAPE3 and a linear vector P1300-dsRed.

[0008] Furthermore, the recombinant expression vector connects the gene BjuA03.CAPE3 and the linear vector via restriction endonucleases KpnI and BamHI.

[0009] Further, the primers of the gene BjuA03.CAPE3 include

[0010] BjuA03.CAPE3-F:ATGAAAATCTTTAACCCATC;

[0011] BjuA03.CAPE3-R:TCAGTAAGGCCACTGGCCGA.

[0012] An engineered bacterium obtained by transforming Escherichia coli cells with a recombinant expression vector to obtain a plasmid, and then transforming Agrobacterium cells with the plasmid.

[0013] Application of the clubroot-resistant Brassica juncea gene BjuA03.CAPE3, recombinant expression vector or engineered bacterial strain in improving plant resistance to clubroot.

[0014] Compared with the prior art, the beneficial effects of the present scheme are as follows: the present invention artificially synthesizes Brassica juncea-type rapeseed resistant to clubroot by hybridizing Chinese cabbage and Brassica juncea through distant hybridization, and further locates the disease-resistant gene of the artificially synthesized Brassica juncea-type rapeseed resistant to clubroot by simplified genome sequencing, providing an important theoretical basis and genetic resources for breeding new rapeseed varieties with durable resistance. BRIEF DESCRIPTION OF THE DRAWINGS

[0015] Figure 1 is the distribution of clubroot resistance genes on each chromosome in the embodiment of the present invention;

[0016] Figure 2 It is the sequence analysis of the homologous genes of BjuA03.CAPE3 in the resistant and susceptible materials in the embodiment of the present invention, wherein 74R2 is the sequence of R13, the resistant parent of BjuA03.CAPE3; 74S6 is the sequence of BjuA03.CAPE3 in the resistant and susceptible materials;

[0017] Figure 3is the clubroot resistance of Arabidopsis thaliana overexpressing BjuA03.CAPE3 in the embodiment of the present invention, E is the relative expression level of the gene in the overexpression material, and F is the clubroot disease index of the overexpression material. DETAILED DESCRIPTION

[0018] In order to enable those skilled in the art to better understand the solution of the present invention, the technical solution of the present invention will be further described in detail below in conjunction with the embodiments of the present invention and the accompanying drawings. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work should fall within the scope of protection of the present invention.

[0019] It should be noted that, in the absence of conflict, the embodiments and features in the embodiments of the present invention can be combined with each other. The present invention will be described in detail below in conjunction with the embodiments.

[0020] Example:

[0021] Plasmodium inoculation test

[0022] First, place the seeds to be tested on moist filter paper for germination. After three or four days, select seedlings with similar growth and plant them in nutrient soil (nutrient soil, perlite, vermiculite ratio 3:1:1). When the seedlings grow to the three-leaf stage, use a syringe to inject 5 ml of 1×10 7 To prepare the bacterial solution, soak the diseased root spores in water overnight, chop and grind them, filter them with gauze to remove plant tissue, centrifuge and take the precipitated dormant spores, resuspend them in water and adjust the concentration to 1×10 7 Spores / ml. All test materials (resistant and susceptible parents, F1 and F2 generations) were inoculated in the same way, and the resistance was judged by observing whether there were root swellings on the roots after 40 days.

[0023] Simplifying genome sequencing and data analysis

[0024] Simplified genome sequencing mainly includes four steps: DNA sample detection, library construction, library quality control and on-machine sequencing.

[0025] (1) Sample testing: DNA extracted using a DNA extraction kit is tested. The method is as follows: agarose gel electrophoresis is used to detect that the DNA bands are intact, non-degraded, and free of RNA contamination; the OD260 / 280 value is between 1.8 and 2.0; the DNA concentration is greater than 50 ng / μl, and the total amount is not less than 2 μg;

[0026] (2) Library construction: A total of 200 ng of qualified genomic DNA was digested with restriction endonucleases MseⅠ and SacⅠ to cut it into fragments. The fragments were then connected with specific adapters and purified. The purified products were amplified under the action of DNA polymerase. All products were subjected to low-pressure overnight electrophoresis using Bio-Rad Certified Megabase Agarose, and the 300-400 bp fragments were recovered and purified to obtain the resulting library.

[0027] (3) Library quality control: Use Agilent 2100 to detect the insert size to ensure that there is no adapter contamination; use real-time fluorescence quantitative PCR to ensure that the effective concentration is >2nM;

[0028] (4) Sequencing: Paired-end 150bp (PE150) sequencing was performed using the Illumina HiSeq platform.

[0029] The simplified genome sequencing data obtained in the previous step is analyzed by bioinformatics as follows:

[0030] (1) Sequencing data quality control and statistics: Fastp software was used to perform quality control on the raw data obtained from the machine, removing adapters, low-quality bases, and reads less than 50 bp in the reads. The base mass number distribution and GC content of the sequencing data were then counted to ensure that the quality of the sequencing data could be used for subsequent analysis;

[0031] (2) Bioinformatics analysis of sequencing data: First, the reference genome was aligned. The quality-controlled data was aligned to the Brassica napus reference genome (Braju_tum_V2.0, http: / / brassicadb.cn / # / Download / ) using the MEM algorithm of the BWA (Burrow-WheelerAligner, version 0.7.15-r1140) software. Then, the sam file obtained in the previous step was converted into a bam file and sorted using samtools (version 1.3.1). The sorted bam file was used for sequencing coverage, coverage depth, and variation statistics. Genome coverage (Coverage): The proportion of bases covered by the sequenced data on the reference genome to the entire reference genome. The higher the coverage, the more variations can be detected. Coverage depth (Depth): The number of times each base on the reference genome is covered, generally measured by the number of reads. The higher the depth, the higher the accuracy of the variation site. The variants were detected using the HaplotypeCaller module and GenotypeGVCFs module of the GETK software (GenomeAnalysis ToolKit, version 3.7), and the results included SNPs and InDels. The detected variants were then annotated and their effects on gene function were predicted using the ANNOVAR software (version 2016Feb1);

[0032] (3) Construction of genetic linkage map: First, the genotypes of the parents were inferred based on the linkage relationship between the progeny markers. Based on this, the genotypes of the progeny were named A (R13) and B (S11). The authenticity of the parents was then verified based on the actual genotypes of the susceptible parents. Subsequently, some genotypes were corrected and supplemented using the hidden Markov model (HMM). Finally, the recombination rate between markers was evaluated using MSTMap software, and the genetic map distance between markers was calculated using Kosambi.

[0033] Extraction of genomic DNA

[0034] 1) Take a thumb-sized piece of fresh young plant leaves and grind them into powder in liquid nitrogen.

[0035] 2) Transfer the powder into a 2 ml centrifuge tube, add 500 μl of CTAB solution preheated at 65°C, mix thoroughly, and place in a 65°C water bath for 1 hour, shaking and mixing once every ten minutes or so.

[0036] 3) After the water bath, add 500 μl of chloroform / isoamyl alcohol solution (24:1), mix gently, let stand at room temperature for 10 min, and centrifuge at 10,000 rpm for 10 min.

[0037] 4) Take the supernatant and add an equal volume of isopropanol and let it stand until a precipitate is formed. Centrifuge at 10000r / min for 10min.

[0038] 5) After discarding the supernatant, rinse the precipitate with 70% ethanol two to three times, then invert the centrifuge tube to air dry naturally, add an appropriate amount of ddH2O to dissolve it, and store it in a -20℃ refrigerator.

[0039] Gene cloning

[0040] The candidate gene sequences were analyzed, and forward and reverse primers with high scores that could cover the full length of the gene were designed using PrimerPremier 5.0. High-fidelity enzyme (Novozyme, P505) was used to amplify the gene DNA as a template. The reaction system was: 2×Phanta Max Buffer (containing Mg 2+, final concentration 2mM): 25μl, dNTP Mix (10mM each): 1μL, forward and reverse primers 2μl each, Phanta Max Super-Fidelity DNA Polymerase: 1μl, template DNA (concentration 50-100ng / μl): 1μl, ddH2O: 18μl. Reaction procedure: pre-denaturation 95℃ 3min, denaturation 95℃ 15s, annealing 15s, extension 72℃ 30-60sec / kb, complete extension 72℃ 5min, 35 cycles from denaturation to extension. The target band of the product after the reaction was determined by agarose gel electrophoresis, and then the target band was cut out and purified and recovered using a gel recovery kit (Omega, D2500-01). The general process is as follows: add Binding Buffer (1g / ml) to the gel block, place it in a 60°C water bath, transfer the liquid to the HiBindTM DNA column after the gel block is completely dissolved, and centrifuge at 10,000×g at room temperature for 1 min; discard the waste liquid in the collection tube, add 300μl Binding BufferHiBind, and centrifuge at 10,000×g at room temperature for 1 min; discard the waste liquid and add 700μl SPW WashbufferHiBind DNA column, centrifuge at 10,000×g at room temperature for 1 min, repeat twice; discard the waste liquid and centrifuge at 10,000×g at room temperature for 1 min; put the column into a new 1.5ml centrifuge tube, add 50μl elution buffer, let it stand for 2 min, and centrifuge at 10,000×g for 1 min. The purified product was cloned by TA and transformed into competent E. coli cells by heat shock method: the TA cloned product was added to competent E. coli cells on ice, allowed to stand for 30 minutes, then placed in a 42°C water bath for 60 seconds, and then placed on ice for 2 minutes. 500 μl of antibiotic-free LB liquid culture medium was added and revived at 37°C on a shaker for 40 minutes. Subsequently, 200 μl of bacteria were pipetted and evenly spread on LB solid culture medium with kanamycin, and cultured at 37°C overnight. The grown monoclonal clone was picked and placed in liquid culture medium with kanamycin and cultured at 37°C on a shaker for 4-5 hours. The positive monoclonal clone was identified by PCR on the bacterial solution, and the positive monoclonal clone was sent to Xi'an Qingke Company for first-generation sequencing to obtain the sequence of the target gene.

[0041]

[0042] Vector construction

[0043] In order to achieve the purpose of transforming the cloned gene into tobacco and Arabidopsis or achieving overexpression, knockout, subcellular localization and GUS staining, the vector construction steps are generally universal. First, the homology arm sequence is designed according to the vector sequence, and the homology arm is added to the primer of the gene cloning to perform PCR on the target gene. At the same time, the target vector is cut with restriction endonuclease to linearize the vector. After the vector and the target gene with homology arm are completely cut by agarose gel electrophoresis, the target gene sequence and the linearized vector are homologously recombined with the one-step cloning homologous recombination kit to obtain the vector with the target gene. Homologous recombination (Nanjing Novozyme, C112-01 / 02) reaction system (a total of 10μl): 5XCEⅡ2μl, ExnaseⅡ1μl, the molar ratio of linearized vector and inserted target gene is 1:2. The product after the reaction is completed is transformed by heat shock method of Escherichia coli, and the steps are the same as above.

[0044] Plasmid extraction and Agrobacterium transformation

[0045] The obtained positive recombinant vector was subjected to plasmid extraction for long-term storage. Plasmid extraction was performed using a plasmid extraction kit (Tiangen, DP103). First, the bacterial solution cultured overnight at 37°C was enriched, and then Buffer P1, Buffer P2, and Buffer P3 were added to resuspend, lyse, and precipitate the bacteria. The first step required thorough resuspension, and the following two steps required slight mixing. The obtained liquid was transferred to an adsorption column, centrifuged at 10,000 r / min for 1 min, the supernatant was discarded, 500 μl of deproteinized solution PD was added, and centrifuged at 10,000 r / min for 1 min, the supernatant was discarded, 700 μl of rinsing solution was added, and centrifuged at 10,000 r / min for 1 min, the rinsing was repeated twice, the supernatant was discarded, and the centrifugation was performed at 10,000 r / min for 2 min. After 50 μl of ddH20 was added to the adsorption column and allowed to stand for two minutes, the collection tube was replaced with a new 1.5 ml centrifuge tube and centrifuged at 10,000 r / min for 1 min. The centrifuge tube contained the extracted plasmid.

[0046] Agrobacterium transformation uses the freeze-thaw method. The basic steps are: add no more than 1 μg of plasmid to the Agrobacterium competent cell GV3101 strain, let it stand on ice for 5 minutes, freeze it in liquid nitrogen for 5 minutes, bath it in 37℃ water for 5 minutes, let it stand on ice for 2 minutes, add 500 μl of non-antibiotic YEP liquid medium to revive it at 28℃ for 2-3 hours, and evenly apply 200 μl to the YEP solid medium with rifampicin, gentamicin and kanamycin resistance. Two days later, pick a single clone and perform bacterial liquid PCR identification on it. Add 50% glycerol (v:v, 2:1) to the positive Agrobacterium, mix it well and store it in a -80℃ refrigerator for later use.

[0047] Agrobacterium-mediated transformation of Arabidopsis

[0048] Agrobacterium was cultured overnight in a shaking incubator at 28°C until the OD value of the bacterial solution was between 0.8-1.2. The bacterial solution was enriched by centrifugation at 5000×g for 5 minutes, and then resuspended in 5% sucrose solution. A surfactant (selwet-77) was added at 2 / 10,000 to 5 / 10,000. The bacterial solution was sucked up with a pipette tip and applied to the unopened flowers of Arabidopsis. After standing for a few minutes, the bacterial solution was wiped dry and cultured in the dark for 16-24 hours. Positive seeds were obtained after 20-30 days.

[0049] Root-knot bacteria inoculation test

[0050] The inoculation test was 2 ml of 1×107 spores / ml of root knot fungi. The disease index was calculated using a 0-4 scoring system: 0: no symptoms; 1: small nodules mainly on lateral roots; 2: small nodules on the main root and lateral roots; 3, medium-sized nodules that may have a negative impact on plant growth; 4, severe nodules on both the main root and lateral roots, root deformation, and impaired growth. DI = 100×(1N1+2N2+3N3+4N4) / 4Nt. Each treatment or line contained at least 40 plants, and the data were analyzed using t-test in Excel 2019 (*p<0.05; **p<0.01).

[0051] Summarize

[0052] The clubroot-resistant Brassica juncea R13 was synthesized by hybridizing Brassica juncea resistant to clubroot with Brassica rapa nigra through distant hybridization. To explore the clubroot-resistant gene in R13, the F2 population constructed by R13 and susceptible S11 was analyzed by simplified genome sequencing. Combined with the phenotype, a major QTL (qCRa3-1) for clubroot resistance was identified in the 25.09Mb-25.54Mb segment of chromosome A03, and the explained phenotypic contribution rate was 74.30% ( Figure 1 ). According to genome functional annotation, there are 66 candidate genes in the qCRa3-1 interval. Combined with transcriptome analysis, it was found that the expression level of one of them, BjuA03.CAPE3 (encoding Pathogenesis-related (PR) protein), was significantly higher in the disease-resistant material R13 than in S11. And this gene has a base difference between R13 and S11, resulting in a difference in the encoded amino acid ( Figure 2 ).

[0053] The CDS sequences of BjuA03.CAPE3 in the resistant and susceptible parents were constructed into 2*35S overexpression vectors and infected wild-type Arabidopsis. It was found that the Arabidopsis strains overexpressing BjuA03.CAPE3-R in the resistant parent were significantly more resistant to clubroot than the wild type ( Figure 3), while the resistance of Arabidopsis lines overexpressing BjuA03.CAPE3-S in the susceptible parent to clubroot was not much different from that of the wild type. This indicates that BjuA03.CAPE3 positively regulates resistance to clubroot.

[0054] The above specific embodiments are merely explanations of the present invention and are not limitations of the present invention. After reading this specification, those skilled in the art may make modifications to the embodiments without any creative contribution as needed. However, such modifications are protected by the patent law as long as they are within the scope of the claims of the present invention.

Claims

1. A clubroot-resistant Brassica juncea gene BjuA03.CAPE3, characterized by: The nucleotide sequence of the clubroot-resistant Brassica juncea gene BjuA03.CAPE3 is SEQ ID No.

1.

2. The clubroot-resistant Brassica juncea gene BjuA03.CAPE3 according to claim 1, characterized in that: The clubroot-resistant Brassica juncea gene BjuA03.CAPE3 is derived from the clubroot-resistant Brassica juncea R13, which is obtained by distant hybridization of clubroot-resistant Brassica juncea and Brassica nigra.

3. A recombinant expression vector expressing the clubroot-resistant Brassica juncea gene BjuA03.CAPE3 according to claim 1, characterized in that: The recombinant expression vector was obtained by connecting the gene BjuA03.CAPE3 and the linear vector P1300-deRed.

4. The recombinant expression vector according to claim 3, characterized in that: The recombinant expression vector is connected to the gene BjuA03.CAPE3 and the linear vector through restriction endonucleases KpnI and BamHI.

5. The recombinant expression vector according to claim 3, characterized in that: The primers for the gene BjuA03.CAPE3 include BjuA03.CAPE3-F:ATGAAAATCTTTAACCCATC; BjuA03.CAPE3-R:TCAGTAAGGCCACTGGCCGA.

6. An engineered bacterium, characterized in that: The recombinant expression vector as claimed in claim 3 is used to transform Escherichia coli cells to obtain a plasmid, and the plasmid is used to transform Agrobacterium cells to obtain the engineered bacteria.

7. Use of the clubroot-resistant Brassica juncea gene BjuA03.CAPE3 according to claim 1, the recombinant expression vector according to claim 3 or the engineered bacteria according to claim 6 in improving the disease resistance of plants against clubroot.

Images