Micro-fluidic chip for finger-pressing type nucleic acid detection and use method of micro-fluidic chip

Abstract

The invention relates to a finger-pressing type nucleic acid detection micro-fluidic chip, which comprises a bottom layer, a flow channel layer, a finger-pressing layer and a thin film layer, the flow channel layer comprises an LAMP reaction chamber, a CRISPR reaction chamber, a water storage chamber, a Tesla valve, a finger-pressing chamber and a test paper reaction chamber, the LAMP reaction chamber comprises a nucleic acid extraction-free reaction system based on LAMP, the CRISPR reaction chamber comprises a CRISPR-based cas12b reaction system, and the test paper reaction chamber comprises a Tesla valve, a finger-pressing chamber and a test paper reaction system. The water storage chamber is mainly used for diluting a mixed system, and the Tesla valve is used for preventing crosstalk of the two reaction systems; the finger pressing layer comprises an LAMP reaction chamber button and a CRISPR reaction chamber button, when the LAMP reaction chamber button is pressed, liquid in the LAMP reaction chamber is pumped into the CRISPR reaction chamber, when the two buttons are pressed at the same time, a reaction mixing system is pumped into the water storage chamber to be mixed, and then the reaction mixing system is further pumped into the test paper reaction chamber. The chip can be widely applied to the field of rapid diagnosis of nucleic acid molecules, the detection cost is reduced, manual operation is simplified, and the detection efficiency is improved.

Description

Technical Field

[0001] The present disclosure relates to the technical field of microfluidic chips, and in particular to a microfluidic chip for integrating nucleic acid amplification and detection, and also includes a preparation method, a use method and application thereof. Background Art

[0002] Rapid and reliable pathogen detection is of vital importance to clinical diagnosis and treatment. It can quickly provide the test results required for clinical decision-making, shorten the waiting time for patients, and improve the efficiency of diagnosis and treatment. At the same time, it is easy to operate and highly flexible, suitable for rapid diagnosis and disease monitoring in various scenarios, which helps to achieve early detection, early diagnosis, and early treatment of diseases, and effectively improves the convenience of medical services.

[0003] The qPCR method currently widely used in clinical practice has strong applicability and low cost, but it has problems such as long detection time, high equipment requirements, and low sensitivity. The qPCR method is heavily dependent on temperature control and analytical equipment. The above process is relatively complicated and time-consuming, and professionals are required to perform complex operations during the nucleic acid detection process. For some remote areas and grassroots hospitals with limited environmental equipment, it is difficult to use traditional nucleic acid detection methods, and the detection efficiency needs to be improved urgently.

[0004] The loop-mediated isothermal amplification (LAMP) technique uses DNA polymerase with high displacement strand activity to efficiently and specifically amplify target DNA under constant temperature conditions, and has the advantages of being fast and low-cost. However, the LAMP technique is prone to false positive results caused by primer cross-reactions and has low specificity. The CRISPR (Clustered regularly interspaced short palindromic repeats) detection technique uses the trans-cleavage activity of Cas protein to guide the binding to the target and cutting the probe to emit fluorescence through guide RNA (gRNA), thereby achieving rapid and sensitive detection. In recent years, CRISPR / Cas-based biosensor technology has been used for nucleic acid detection. CRISPR / Cas12b is more thermally stable than other family members in the CRISPR system and can be activated by LAMP amplification products, thereby generating fluorescent signals by non-specifically cutting the reporter gene DNA. Therefore, it can make up for the shortcomings of false positive signals in LAMP.

[0005] Lateral flow immunochromatography (LFIA) test strips have multiple advantages, such as simple and fast operation, intuitive and readable results, low cost, strong portability and wide application range. With only sample droplet addition, the CRISPR single system test strip (FAM / FITC) can automatically complete the test. The lateral flow immunochromatography method is combined with the LAMP-CRISPR / Cas12b method to present the results in the form of visual strips. The tester does not need complex equipment or professional skills, and is suitable for on-site timely testing. Summary of the invention

[0006] In response to the above problems, the present disclosure provides a microfluidic chip for finger-pressure nucleic acid detection, which integrates nucleic acid extraction, amplification, and detection, and is used to solve technical problems such as the difficulty of traditional nucleic acid detection to achieve portable, instrument-free on-site rapid detection. The present invention combines LAMP-CRISPR / Cas12b detection technology with a microfluidic chip to simplify the nucleic acid extraction process. The designed push-type microfluidic sensor chip can accurately control the phased flow of internal liquid with a simple finger press, without relying on any external drive device. This design makes it easy for non-professional technicians to get started, and the chip is small in size and has extremely low reagent consumption, which effectively reduces the cost of detection.

[0007] The present invention provides a push-type microfluidic chip, a microfluidic device and a bacteria detection method, which are used to solve at least one of the above technical problems.

[0008] The first aspect of the present invention provides a push-type microfluidic chip, comprising: a bottom layer, a flow channel layer, a finger pressure layer and a film layer, the flow channel layer comprising a LAMP reaction chamber (1), a CRISPR reaction chamber (2), a water storage chamber (3), a test paper reaction chamber (4), a LAMP reaction chamber button (6) and a CRISPR reaction chamber button (8), the LAMP reaction chamber (1), the CRISPR reaction chamber (2) and the water storage chamber (3) are arranged in parallel, and the LAMP reaction chamber (1), the CRISPR reaction chamber (2), the water storage chamber (3), the test paper reaction chamber (4), the LAMP reaction chamber button (6) and the CRISPR reaction chamber button (8) are connected by a microchannel. The LAMP reaction chamber (1), the CRISPR reaction chamber (2) and the water storage chamber (3) respectively have sample injection ports (16), (15) and (14), and the LAMP reaction chamber button (6) and the CRISPR reaction chamber button (8) respectively have exhaust holes (7) and (9);

[0009] The bottom layer (13) is a sticky plastic bottom film, the flow channel layer (12) is PMMA, the finger pressure layer (11) is an elastic PDMS film with a thickness of 0.5 mm, and the film layer (10) is a PE high-viscosity transparent film with a thickness of 0.05 mm.

[0010] A backflow-preventing Tesla valve (5) structure is provided between the LAMP reaction chamber (1) and the CRISPR reaction chamber (2).

[0011] The test paper reaction chamber (4) is connected to the water storage chamber (3) through a microchannel and is used to place a CRISPR single system detection test strip (FAM / FITC).

[0012] The second aspect of the present invention provides a constant temperature amplification device for nucleic acid detection, including: a heating warming patch (the average heating temperature is 60°C).

[0013] The third aspect of the present invention provides a method for preparing a microfluidic chip for nucleic acid amplification detection, comprising: the microfluidic chip for finger pressure type nucleic acid detection, the flow channel layer (12) is not limited to polydimethylsiloxane (PDMS) and polymethyl methacrylate (PMMA), and the flow channel layer is injection molded. The material of the finger pressure layer (11) is not limited to polydimethylsiloxane (PDMS) soft film, silicone film, etc., and can be bonded to the flow channel layer after plasma treatment. The material of the film layer (10) is not limited to silicone film, polyethylene (PE) soft film, etc. The material of the bottom layer (13) is a sticky plastic bottom film. The film layer (10) is punched with holes: sample ports (16), (15) and (14); the film layer (10) and the finger pressure layer (11) are punched with holes: exhaust holes (7) and (9).

[0014] A LAMP reaction chamber (1), a CRISPR reaction chamber (2), a water storage chamber (3), a test paper reaction chamber (4), a Tesla valve (5), a LAMP reaction chamber button (6), a CRISPR reaction chamber button (7), and a microchannel are etched on the chip flow channel layer (12). The LAMP reaction chamber, the CRISPR reaction chamber, the water storage chamber (1), (2), and (3) are juxtaposed in parallel; the LAMP reaction chamber (1), the CRISPR reaction chamber (2), the water storage chamber (3), the test paper reaction chamber (4), the LAMP reaction chamber button (6), and the CRISPR reaction chamber button (8) are connected through a microchannel. The flow channel layer is not limited to using polydimethylsiloxane (PDMS) and polymethyl methacrylate (PMMA), and the flow channel layer is injection molded.

[0015] The bottom layer (13) is pasted under the chip flow channel layer (12), the finger pressure layer (11) is bonded to the flow channel layer (12), and covers the LAMP reaction chamber button (6) and the CRISPR reaction chamber button (7), and the film layer (10) is pasted on the top of the chip, covering the flow channel layer (12) and the finger pressure layer (11).

[0016] A fourth aspect of the present invention provides a nucleic acid detection method, using the above-mentioned push-type microfluidic chip or the above-mentioned microfluidic device to perform bacterial detection on a sample, comprising: adding a LAMP reaction system and a sample, a CRISPR / Cas12b reaction system, DEPC water and a CRISPR single system detection test strip (FAM / FITC) to a LAMP reaction chamber (1), a CRISPR reaction chamber (2), a water storage chamber (3), and a test paper reaction chamber (4);

[0017] The LAMP reaction system includes 1×WarmStart® LAMP premix, 1×LAMP fluorescent dye SYTO82, 1×LAMP primer (1.0 μM FIP, 1.0 μM BIP, 0.2 μM F3, 0.2 μM B3) and DEPC water.

[0018] The CRISPR / Cas12b reaction system includes 250 nM Cas12b, 250 nM gRNA, 3 μM ssDNA reporter gene, 1 000 U / mL RNase inhibitor, 4 mM Mg 2+ and DEPC water.

[0019] Nucleic acid testing specifically includes the following steps:

[0020] S1: Use a syringe to pre-inject the LAMP reaction system, CRISPR / Cas12b reaction system and DEPC water into the corresponding injection ports (16), (15) and (14) in the LAMP reaction chamber (1), the CRISPR reaction chamber (2) and the water storage chamber (3); Use a syringe to inject the collected pyrolysis sample into the LAMP reaction chamber (1); Place the microfluidic chip under a warming patch at a constant temperature of 60°C for reaction, and the reaction time is 15 minutes;

[0021] S2: Press the LAMP reaction chamber button (6) to drive the LAMP reaction chamber liquid into the CRISPR reaction chamber (2). The reaction time is 2 minutes.

[0022] S3: Press the LAMP reaction chamber button (6) and the CRISPR reaction chamber button (8) simultaneously to drive the CRISPR reaction chamber liquid into the water storage chamber (3) and then into the test paper reaction chamber (4);

[0023] S4: After the reaction is completed, observe the CRISPR single system detection test strip (FAM / FITC) to obtain the detection results.

[0024] Beneficial effects:

[0025] Microfluidic chip technology can integrate all the links in the experiment on a chip. Microfluidic chips have high integration, small size, and easy operation. They can integrate nucleic acid purification and amplification on a chip, providing a new technical option for on-site instant detection. Compared with traditional laboratory detection methods, the sample size used for detection based on microfluidic chips is small, and less manual operation is required, which greatly reduces the detection time and sample consumption in the process. The present invention combines LAMP-CRISPR / Cas12b detection technology with microfluidic chips to simplify the nucleic acid extraction process. The designed push-type microfluidic sensor chip can accurately control the phased flow of internal liquid with a simple finger press, without relying on any external drive device. This design makes it easy for non-professional technicians to get started, and the chip is small in size and the reagent consumption is extremely low, which effectively reduces the detection cost.

[0026] The present invention realizes the sequential release of fluids through the Tesla valve. The main feature of the structure is that there are no moving parts, no pistons, valve discs or rotating devices are required, which reduces the possibility of parts being corroded or worn and damaging their functions, and prolongs the service life of the system. It is composed of a series of annular or spiral channels, which cause the fluid to generate vortices, thereby producing an effect of hindering reverse flow; the Tesla valve has a small resistance from the LAMP reaction chamber (1) to the CRISPR reaction chamber (2), but has a high resistance in the opposite direction.

[0027] The present invention realizes the automation of sequential fluid release through finger-pressing drive. It only takes two presses of the corresponding buttons to mix the reagents and react them respectively, and pump the reaction system into the test paper cavity to predict the results. The second step of pressing the two buttons at the same time can prevent the system in the CRISPR chamber from flowing back into the LAMP chamber, avoiding the loss of the system. On the other hand, the system can be pumped into the water storage chamber and further into the test paper chamber. Liquid crosstalk is prevented while pumping reagents, optimizing the reaction operation process. Finger-driven is portable and does not require external equipment. The detection process has great flexibility and freedom. Users can carry out detection anytime and anywhere, opening up a new way for fast and accurate on-site detection.

[0028] This method has comparable performance to qPCR detection and is expected to be widely used in clinical testing in the future. In 72 pharyngeal swab samples suspected of clinical Klebsiella pneumoniae infection, the sensitivity and specificity were both 100% using the qPCR method as the standard. Compared with the qPCR method, this method has the following advantages: 1) Fast, the average detection time of qPCR on the market is about 90 minutes, while this method only takes 20 minutes, which is more advantageous in detecting a large number of samples and emergency samples. 2) Simple, qPCR relies on a standard curve, which complicates the diagnostic process. In contrast, this method is combined with finger drive, and only the mixed sample needs to be injected into the chip, and the result can be obtained after two presses. 3) Low instrument requirements, qPCR requires sophisticated thermal cycling equipment, while this method only requires microfluidic chips, syringes, and warming patches, which are cheap and easy to obtain. 4) Visual detection results, the present invention is combined with lateral flow chromatography test strips to achieve visual detection of sample in-result out. With its advantages of being fast, simple, and requiring few instruments, this method can provide patients with more timely and accurate treatment options, thereby improving prognosis, reducing the occurrence of complications, and lowering overall medical costs. BRIEF DESCRIPTION OF THE DRAWINGS

[0029] Figure 1 A schematic diagram of the structure of a microfluidic chip according to an embodiment of the present invention;

[0030] Figure 2 for Figure 1 Schematic diagram of the overall flow channel;

[0031] Figure 3 This is a chip flow channel test diagram of an embodiment of the present invention, wherein a simulates adding reagents to the chip; bc represents pressing the LAMP reaction chamber button to pump the system in the LAMP reaction chamber to the CRISPR reaction chamber; df represents pressing the LAMP reaction chamber button and the CRISPR reaction chamber button at the same time to pump the system in the CRISPR reaction chamber into the water storage chamber and then further pump it to the test paper reaction chamber.

[0032] Figure 4 The clinical test results of the embodiment of the present invention are DETAILED DESCRIPTION

[0033] The present invention will be further described below in conjunction with the accompanying drawings.

[0034] Example 1

[0035] The push-type microfluidic chip of the present invention comprises: a bottom layer (13), a flow channel layer (12), a finger pressure layer (11) and a thin film layer (10), wherein the flow channel layer comprises a LAMP reaction chamber (1), a CRISPR reaction chamber (2), a water storage chamber (3), a test paper reaction chamber (4), a LAMP reaction chamber button (6) and a CRISPR reaction chamber button (8), wherein the LAMP reaction chamber (1), the CRISPR reaction chamber (2) and the water storage chamber (3) The LAMP reaction chamber (1), the CRISPR reaction chamber (2), the water storage chamber (3), the test paper reaction chamber (4), the LAMP reaction chamber button (6) and the CRISPR reaction chamber button (8) are arranged in parallel and connected via a microchannel; the LAMP reaction chamber (1), the CRISPR reaction chamber (2) and the water storage chamber (3) respectively have a first sample injection port (16), a second sample injection port (15) and a third sample injection port (14); the LAMP reaction chamber button (6) and the CRISPR reaction chamber button (8) respectively have a first exhaust hole (7) and a second exhaust hole (9);

[0036] The chip flow channel layer (12) can be made of polymethyl methacrylate (PMMA). The upper surface of the LAMP reaction chamber button (6) and the CRISPR reaction chamber button (8) is covered with a finger pressure layer (11), and the finger pressure layer material is a polydimethylsiloxane (PDMS) soft film, which can be bonded to the flow channel layer (12) after plasma treatment. The material of the film layer (10) is a polyethylene (PE) soft film. The material of the bottom layer (13) is a sticky plastic bottom film.

[0037] An anti-backflow structure (5) is provided between the LAMP reaction chamber (1) and the CRISPR reaction chamber (2), and the anti-backflow structure (5) has a Tesla valve structure, the main feature of which is that there are no movable parts, and no piston, valve disc or rotating device is required. It is composed of a series of annular channels, which cause the fluid to generate vortices, thereby producing an effect of hindering reverse flow. Therefore, the Tesla valve has a smaller resistance from the LAMP reaction chamber (1) to the CRISPR reaction chamber (2), but has a higher resistance in the opposite direction. Therefore, this structure can effectively prevent the backflow of the fluid. Of course, it can also be a microvalves made of other shapes or materials, as long as it can be achieved that when the channel receives reverse pressure, the liquid cannot pass through the microvalve.

[0038] According to the method for using the aforementioned microfluidic chip for nucleic acid amplification detection, the method comprises: adding a LAMP reaction system and a sample, a CRISPR / Cas12b reaction system, DEPC water and a CRISPR single system detection test strip (FAM / FITC) to the LAMP reaction chamber (1), the CRISPR reaction chamber (2), the water storage chamber (3) and the test paper reaction chamber (4);

[0039] The LAMP reaction system includes 1×WarmStart® LAMP premix, 1×LAMP fluorescent dye SYTO82, 1×LAMP primer (1.0 μM FIP, 1.0 μM BIP, 0.2 μM F3, 0.2 μM B3) and DEPC water.

[0040] The CRISPR / Cas12b reaction system includes 250 nM Cas12b, 250 nM gRNA, 3 μM ssDNA reporter gene, 1 000 U / mL RNase inhibitor, 4 mM Mg 2+ and DEPC water.

[0041] The specific steps of nucleic acid testing are:

[0042] S1: Use a syringe to pre-inject the LAMP reaction system, CRISPR / Cas12b reaction system and DEPC water into the corresponding injection ports (16), (15) and (14) of the LAMP reaction chamber (1), the CRISPR reaction chamber (2) and the water storage chamber (3); Use a syringe to inject the collected pyrolysis sample into the LAMP reaction chamber (1); Place the microfluidic chip under a warming patch at a constant temperature of 60°C for reaction, and the reaction time is 15 minutes;

[0043] S2: Press the LAMP reaction chamber button (6) to drive the LAMP reaction chamber liquid into the CRISPR reaction chamber (2). The reaction time is 2 minutes.

[0044] S3: Press the LAMP reaction chamber button (6) and the CRISPR reaction chamber button (8) simultaneously to drive the CRISPR reaction chamber liquid into the water storage chamber (3) and then into the test paper reaction chamber (4);

[0045] S4: After the reaction is completed, observe the CRISPR single system detection test strip (FAM / FITC) to obtain the detection results.

[0046] We used AutoCAD 2020 to design the structure of the finger-driven microfluidic chip. The chip includes: a bottom layer (13), a flow channel layer (12), a finger pressure layer (11) and a thin film layer (10). Figure 1 The design principle diagram of the finger-driven microfluidic chip is shown. The chip is designed to be 80 mm long, 35 mm wide and 3.5 mm thick. The bottom layer (13) of the chip is a sticky plastic bottom film, the flow channel layer (12) is PMMA, the finger pressure layer (11) is an elastic PDMS film with a thickness of 0.5 mm, and the film layer (10) is a PE high-viscosity transparent film with a thickness of 0.05 mm.

[0047] The three cylindrical chambers are used to store the LAMP reaction system, the CRISPR reaction system and DEPC water respectively. The diameter of the LAMP reaction chamber (1) is 2.4 mm and the height is 3 mm, the diameter of the CRISPR reaction chamber (2) is 3 mm and the height is 3 mm, and the diameter of the water storage chamber (3) is 5.2 mm and the height is 3 mm. The three cylindrical chambers have a first sample injection port (16), a second sample injection port (15) and a third sample injection port (14) with a diameter of 1 mm. The two finger-pressing button chambers are used to pump reagents in stages. The diameter of the LAMP reaction chamber button (6) is 12 mm and the height is 3 mm, and the diameter of the CRISPR reaction chamber button (8) is 15 mm and the height is 3 mm. Above the LAMP reaction chamber button (6) and the CRISPR reaction chamber button (8), there are first exhaust holes 7 and second exhaust holes 9 with a diameter of 1 mm. The test strip reaction chamber (4) is used to place the CRISPR single system detection test strip (FAM / FITC), with a length of 65 mm, a width of 4 mm, and a height of 3 mm. The other microchannel dimensions are all 0.1 mm×0.1 mm. In order to prevent liquid backflow, a Tesla valve structure is designed between the LAMP reaction chamber (1) and the CRISPR reaction chamber (2), which consists of 6 Tesla valves.

[0048] The LAMP reaction system, CRISPR reaction system and DEPC water are pre-packaged in the LAMP reaction chamber (1), CRISPR reaction chamber (2) and water storage chamber (3). The volume of the LAMP reaction system is 10 μL, and its components are 1×WarmStart® LAMP premix, 1×LAMP fluorescent dye SYTO82, 1×LAMP primer (1.0 μM FIP, 1.0 μM BIP, 0.2 μM F3, 0.2 μM B3) and DEPC water. The volume of the CRISPR reaction system is 10 μL, and its components are 250 nM Cas12b, 250 nM gRNA, 3 μM ssDNA reporter gene, 1 000 U / mL RNase inhibitor, 4 mM Mg 2+ and DEPC water. The volume of DEPC water is 30 μL.

[0049] The following formula and Figure 3 Liquid flow testing of specific embodiments

[0050] When the flow channel layer is stationary, Figure 3 (a) The liquid shown has no flow.

[0051] The compression and decompression of the flow channel layer (12) are controlled by the deflection of the finger pressure layer (11). The dispensed volume is determined by the compressed volume of the drive chamber. The volume change of the pressure chamber caused by finger actuation determines the compressed volume of the drive chamber. Therefore, if the compressed volume of the pressure chamber is equal to or greater than the volume of the drive chamber, a constant volume of the dispensed fluid can be obtained by pushing and releasing the pressure chamber.

[0052] In order to analyze whether the pressure generated by the fingertip is sufficient to completely compress the actuation chamber, and how much the pressure generated by the fingertip can completely compress the actuation chamber. Generally speaking, the force that can be applied by the human fingertip is between 21N and 60N. The compression of the actuation chamber has an upper limit, so the design of the finger-driven microfluidic device should enable the actuation chamber to be completely compressed with minimal force.

[0053] The driving chamber is a LAMP reaction chamber (1), a CRISPR reaction chamber (2), a water storage chamber (3), a test paper reaction chamber (4) and microchannels connected thereto; the pressure chamber is a LAMP reaction chamber button (6) and a CRISPR reaction chamber button (8).

[0054] Taking the LAMP reaction chamber button (6) as an example, its diameter is 12 mm and its height is 3 mm. Its area is 113.04 mm 2 When the minimum pressure is 21N, the pressure applied to the pressure chamber is 1834.64 Pa. Assuming that the pressure caused by the finger action is evenly loaded on the pressure chamber, the maximum deflection w of the pressure chamber is max It can be calculated by the following formula:

[0055]

[0056] Where h is the thickness of the cover plate over the pressure chamber, r is the radius of the pressure chamber, ν is Poisson's ratio, E is the Young's modulus of the cover plate material, and p is the applied pressure. This equation is only valid for thick circular plates (h / r > 0.1). h = 3 mm, r = 6 mm, v = 0.5, E = 1.63 MPa, the maximum deflection of the pressure chamber is calculated to be 1.11 mm. The volume change of the finger-actuated pressure chamber (ΔV) is then calculated using the spherical cap formula:

[0057]

[0058] The results show that the minimum volume change of the pressure chamber driven by a human finger is about 63.48 μL. represents the driving chamber with an operable volume of 63.48 μL. Similarly, when the pressure chamber is pushed, the pressure change of the pneumatic channel (ΔP) can be expressed by the ideal gas law as follows:

[0059]

[0060] In the formula, Vp is the volume of the pressure chamber, Vc is the volume of the pneumatic channel, Vact is the volume of the drive chamber, which should not exceed ΔV, and Pi is the initial pressure. Considering that Vp is 1.36 μL, ΔV is 63.48 μL, Vact is the volume of the drive chamber minus the volume occupied by the original system, which is 3.57 μL, and Vc is 0.45 μL, the ΔP result calculated by substituting it into formula (3) is greater than 0, which indicates that the system in the LAMP reaction chamber (1) can be driven into the CRISPR reaction chamber (2) by pressing the finger. Figure 3 As shown in (b) and 3 (c), the system in the LAMP reaction chamber (1) enters the CRISPR reaction chamber (2).

[0061] The pressure chamber is a LAMP reaction chamber button (6), the drive chamber is a LAMP reaction chamber (1), and the pneumatic channel is a microchannel connecting the LAMP reaction chamber (1) and the CRISPR reaction chamber (2).

[0062] Similarly, by calculating the volume change of the CRISPR reaction chamber button (8), the CRISPR reaction chamber button (8) has r = 7.5 mm, h = 3 mm, ν = 0.5, E = 1.63 MPa, and w is obtained from formula (1): max is 0.87 mm, and when it is substituted into formula (2), we get ΔV = 77.22 μL. Figure 3 As shown in (d), the system in the CRISPR reaction chamber (2) can enter the water storage chamber (3).

[0063] When the LAMP reaction chamber button (6) and the CRISPR reaction chamber button (8) are pressed simultaneously, ΔV is the sum of the volume changes of the two, which is 140.7 μL. Where Vp is the sum of the volumes of the two pressure chambers, which is 238.41 μL, Vc is the sum of the volumes of the pneumatic channels, which is 0.48 μL, the volume of the LAMP reaction chamber (1) is approximately 13.57 μL, the volume of the CRISPR reaction chamber (2) is approximately 21.20 μL, and the volume of the water storage chamber (3) is approximately 64.30 μL; the volume of the LAMP reaction system is 10 μL, the volume of the CRISPR reaction system is 10 μL, the volume of DEPC water is 30 μL, and the sample is 1 μL; Vact is the total volume of the drive chamber, which is 49.07 μL. Substituting into formula (3), the calculated ΔP result is greater than 0, which indicates that pressing simultaneously can drive the system in the water storage chamber (3) into the test paper reaction chamber (4). As Figure 3 As shown in (d), 3(e) and 3(f), the system in the water storage chamber (3) enters the test paper reaction chamber (4).

[0064] The pressure chamber is a LAMP reaction chamber button (6) and a CRISPR reaction chamber button (8), the drive chamber is a LAMP reaction chamber (1), a CRISPR reaction chamber (2) and a water storage chamber (3), and the pneumatic channel is a microchannel connecting the LAMP reaction chamber (1) to the test paper reaction chamber (4).

[0065] Example 2

[0066] Next, the chip described in Example 1 was tested for performance by taking Klebsiella pneumoniae as the target.

[0067] For the khe gene of Klebsiella pneumoniae in GenBank, the primer design software Primer Explorer V4software was used to design LAMP primers. Four specific primers were designed for the six regions of the target gene: two outer primers (F3 and B3) and two inner primers (FIP and BIP). Among them, FIP is composed of a complementary sequence of F1 and a forward sequence F2. BIP is composed of a complementary sequence of Bl and a forward sequence B2. The khe gene-specific gRNA was designed near the PAM site (5'-TTN-3') of the LAMP amplification product. The above nucleotide sequence is as follows (5'-3'):

[0068] Upstream external primer Khe-F3 (SEQ ID NO. 1):

[0069] ATGCACAGCACAGACGG

[0070] Downstream external primer Khe-B3 (SEQ ID NO. 2):

[0071] CAGGGAAAGTAGTGCCAGTG

[0072] Upstream internal primer Khe-FIP (SEQ ID NO. 3):

[0073] GCACGCAATAGCCACACGCTT-CGCTACGCATACCGGACA

[0074] Downstream internal primer Khe-BIP (SEQ ID NO. 4):

[0075] GTCCCGGGGGCTCCTTTTCGC-ACCGGGCGAGAAACCG

[0076] gRNA (SEQ ID NO. 5):

[0077] GTCTAGAGGACAGAATTTTTCAACGGGTGTGCCAATGGCCACTTTCCAGGTGGCAAAGCCCGTTGAGCTTCTCAAATCTGAGAAGTGGCACGCGCTGGCGCTGTTCGTCGC

[0078] ssDNA (SEQ ID NO. 6):

[0079] FAM-TTATTATTAT-BHQ1

[0080] The volume of the LAMP reaction system is 10 μL, and its components include 1×WarmStart® LAMP premix, 1×LAMP fluorescent dye SYTO82, 1×LAMP primer (1.0 μM FIP, 1.0 μM BIP, 0.2 μM F3, 0.2 μM B3) and DEPC water.

[0081] The volume of the CRISPR reaction system is 10 μL, and its components are 250 nM Cas12b, 250 nM gRNA, 3 μM ssDNA reporter gene, 1 000 U / mL RNase inhibitor, 4 mM Mg 2+ and DEPC water. The volume of DEPC water is 30 μL.

[0082] The specific steps of nucleic acid testing are as follows:

[0083] S1: Use a syringe to pre-inject 10 μL of LAMP reaction system, 10 μL of CRISPR / Cas12b reaction system and 30 μL of DEPC water into the corresponding injection ports (16), (15) and (14) of the LAMP reaction chamber (1), CRISPR reaction chamber (2) and water storage chamber (3) respectively; Use a syringe to inject 1 μL of sample into the LAMP reaction chamber (1); Place the microfluidic chip under a warming patch at a constant temperature of 60°C for reaction for 15 min;

[0084] S2: Press the LAMP reaction chamber button (6) to drive the LAMP reaction chamber liquid into the CRISPR reaction chamber (2). The reaction time is 2 minutes.

[0085] S3: Press the LAMP reaction chamber button (6) and the CRISPR reaction chamber button (8) simultaneously to drive the CRISPR reaction chamber liquid into the water storage chamber (3) and then into the test paper reaction chamber (4);

[0086] S4: After the reaction is completed, observe the CRISPR single system detection test strip (FAM / FITC) to obtain the detection results.

[0087] The sensitivity of the optimized system was evaluated using a DNA template of the Klebsiella pneumoniae khe gene. Target DNA of different concentrations (5×10³~ 0.5 copies / μL) was loaded into the chip for detection. The results of the lateral flow chromatography test strip showed that the T line was visible to the naked eye in samples as low as 2.5 copies / μL. The results showed that the LoD of this method was 2.5 copies / μL ( Figure 4 a).

[0088] The results of this method are visualized using lateral flow chromatography test strips, which is user-friendly and can be performed by non-professionals. Using this method, we detected Klebsiella pneumoniae infection in 72 throat swab samples obtained from patients with suspected Klebsiella pneumoniae infection. In addition, we used qPCR, which is widely used in clinical practice, as a standard to test the precise qualitative ability of the method. Figure 4 As shown in Figures 4a and 4b, this method detected all sputum samples of Klebsiella pneumoniae that were positive by qPCR, with a sensitivity of 100% and a specificity of 100%. These results indicate that this method has good performance in detecting clinical samples.

Claims

1. A microfluidic chip for finger-pressure nucleic acid detection, characterized in that: include: The invention relates to a bottom layer (13), a flow channel layer (12), a finger pressure layer (11) and a film layer (10), wherein the flow channel layer (11) comprises a LAMP reaction chamber (1), a CRISPR reaction chamber (2), a water storage chamber (3), a test paper reaction chamber (4), a LAMP reaction chamber button (6) and a CRISPR reaction chamber button (8), wherein the LAMP reaction chamber (1), the CRISPR reaction chamber (2) and the water storage chamber (3) are arranged in parallel, and the LAMP reaction chamber (1), the CRISPR reaction chamber (2) and the water storage chamber (3) respectively have a first sample injection port (1 6), a second sample injection port (15) and a third sample injection port (14), the LAMP reaction chamber button (6) and the CRISPR reaction chamber button (8) respectively have a first exhaust hole (7) and a second exhaust hole (9); an anti-backflow structure (5) is provided between the LAMP reaction chamber (1) and the CRISPR reaction chamber (2); the LAMP reaction chamber (1), the CRISPR reaction chamber (2), the water storage chamber (3), the test paper reaction chamber (4), the LAMP reaction chamber button (6) and the CRISPR reaction chamber button (8) are connected via a microchannel; A sample adding hole is punched in the film layer (10), which is connected to the first sample adding hole (16), the second sample adding hole (15) and the third sample adding hole (14); an exhaust hole is punched in the film layer (10) and the finger pressure layer (11), which is connected to the first exhaust hole (7) and the second exhaust hole (9); The bottom layer (13) is adhered to the bottom of the chip flow channel layer (12), the finger pressure layer (11) is bonded to the flow channel layer (12), and covers the LAMP reaction chamber button (6) and the CRISPR reaction chamber button (8), and the film layer (10) is adhered to the top of the chip flow channel layer (12), covering the flow channel layer (12) and the finger pressure layer (11).

2. The microfluidic chip for finger-pressure nucleic acid detection according to claim 1, characterized in that: The chip flow channel layer (12) can be made of polymethyl methacrylate (PMMA) or polydimethylsiloxane (PDMS); the LAMP reaction chamber button (6) and the CRISPR reaction chamber button (8) are covered with a finger pressure layer (11), and the material of the finger pressure layer (11) is a polydimethylsiloxane (PDMS) soft film; the material of the film layer (10) is a polyethylene (PE) soft film; and the material of the bottom layer (13) is a sticky plastic bottom film.

3. The microfluidic chip for finger pressure nucleic acid detection according to claim 1, characterized in that: The anti-backflow structure (5) is a Tesla valve structure, the main feature of which is that it has no movable parts and does not require pistons, valve discs or rotating devices; it is composed of a series of annular or spiral channels, which cause the fluid to generate vortices, thereby producing an effect of hindering reverse flow; the Tesla valve has a small resistance from the LAMP reaction chamber (1) to the CRISPR reaction chamber (2), but has a high resistance in the opposite direction.

4. The microfluidic chip for finger-pressure nucleic acid detection according to claim 1, characterized in that: The test paper reaction chamber (4) is connected to the water storage chamber (3) through a microchannel and is used to place the CRISPR single system detection test paper strip FAM / FITC.

5. The microfluidic chip for finger pressure nucleic acid detection according to claim 1, characterized in that: The LAMP reaction chamber (1) stores a LAMP reaction system; The LAMP reaction system includes 1×WarmStart® LAMP premix, 1×LAMP fluorescent dye SYTO82, 1×LAMP primer (1.0 μM FIP, 1.0 μM BIP, 0.2 μM F3, 0.2 μM B3) and DEPC water.

6. The microfluidic chip for finger-pressure nucleic acid detection according to claim 1, characterized in that: The CRISPR reaction chamber (2) stores a CRISPR / Cas12b reaction system; The CRISPR / Cas12b reaction system includes 250 nM Cas12b, 250 nM gRNA, 3 μM ssDNA reporter gene, 1 000 U / mL RNase inhibitor, 4 mM Mg 2+ and DEPC water.

7. The microfluidic chip for finger pressure nucleic acid detection according to claim 1, characterized in that: Use a common heating patch on the market, the average heating temperature is 60℃, and stick it to the bottom of the chip when the temperature of the heating patch is constant.

8. The microfluidic chip for finger pressure nucleic acid detection according to claim 1, characterized in that: include: The flow channel layer (12) is formed by injection molding; the finger pressing layer (11) is bonded to the flow channel layer (12) after plasma treatment; A LAMP reaction chamber (1), a CRISPR reaction chamber (2), a water storage chamber (3), a test paper reaction chamber (4), a Tesla valve (5), a LAMP reaction chamber button (6), a CRISPR reaction chamber button (8), and a microchannel are etched on the chip flow channel layer (12). The LAMP reaction chamber (1), the CRISPR reaction chamber (2), and the water storage chamber (3) are juxtaposed in parallel.

9. A method for using the microfluidic chip for finger-pressure nucleic acid detection according to any one of claims 1 to 8, characterized in that: The following steps are involved: S1: using a syringe, pre-injecting the LAMP reaction system, CRISPR / Cas12b reaction system and DEPC water into the first injection port (16), the second injection port (15) and the third injection port (14) corresponding to the LAMP reaction chamber (1), the CRISPR reaction chamber (2) and the water storage chamber (3), respectively; using a syringe, injecting the collected pyrolysis sample into the LAMP reaction chamber (1); placing the microfluidic chip under a warming patch at a constant temperature of 60° C. for reaction, and the reaction time is 15 minutes; S2: Press the LAMP reaction chamber button (6) to drive the LAMP reaction chamber liquid into the CRISPR reaction chamber (2). The reaction time is 2 minutes. S3: Press the LAMP reaction chamber button (6) and the CRISPR reaction chamber button (8) simultaneously to drive the CRISPR reaction chamber liquid into the water storage chamber (3) and then into the test paper reaction chamber (4); S4: After the reaction is completed, observe the CRISPR single system detection test strip FAM / FITC to obtain the detection results.

Images