Construction method and application of self-assembled enzyme for directionally synthesizing uniform low-molecular-weight dextran

Abstract

The invention discloses a self-assembly enzyme for directional synthesis of uniform low molecular weight dextran, the self-assembly enzyme is named as YG-SpyTag-SpyCatcher-padex, the YG is a dextran sucrase gene (Genbank No.DQ345760), the padex is a dextran enzyme gene (Genbank No.KF999646.1), the SpyTag and the SpyCatcher are two specific oligopeptides, and aspartic acid in the SpyTag and lysine in the SpyCatcher spontaneously form an isopeptide bond. The invention belongs to the technical field of biology, and relates to an enzyme engineering technology. According to the invention, dextran sucrase derived from an escherichia coli genetically engineered bacterium BL21 (DE3)-YG-SpyTag and dextran enzyme derived from a pichia pastoris genetically engineered bacterium X33-SpyCatcher-padex are combined through a SpyTag-SpyCatcher protein covalent coupling system, and the obtained self-assembled enzyme can be used for catalyzing the substrate sucrose to be directly converted into dextran with the molecular weight of 3000 to 4000 Da.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology, relates to enzyme engineering technology, and specifically relates to a method for constructing a self-assembling enzyme for directed synthesis of uniform low-molecular-weight dextran and its application. Background Art

[0002] Dextran is a water-soluble polysaccharide composed of glucose units connected by α(1,6) glycosidic bonds. It has a wide range of applications in food and medicine. In the food industry, dextran is often used as a thickener, stabilizer and sweetener to improve the taste and texture of food. In the pharmaceutical field, dextran can be used as a drug carrier, plasma expander or anticoagulant. Its functions are diverse, depending on its molecular weight. In pharmaceutical applications, dextran is an ideal plasma volume expander material, especially for emergency treatment after blood loss. Dextran with a molecular weight range of 40,000 to 100,000 Da can effectively increase blood volume. Common specifications include dextran 70 (molecular weight of 70,000 Da) and dextran 40 (molecular weight of 40,000 Da). This type of dextran is an ideal choice for plasma expanders because its α(1,6) bond ratio is as high as 95%, it has high water solubility, low viscosity and good water retention capacity. In comparison, dextran with a molecular weight between 10,000 and 20,000 Da is suitable for improving microcirculation and further promoting blood supply to local tissues, while dextran with a molecular weight between 1,000 and 7,000 Da can be used as a pharmaceutical precursor for hematinic agents or anticoagulants. It can be seen that the preparation of dextran with a specific molecular weight is crucial in practical applications, and the precise control and optimization of its molecular weight has become the focus of research.

[0003] Traditional dextran preparation methods usually rely on acid hydrolysis of high molecular weight dextran, and then chemical degradation to obtain products of target molecular weight. However, this method has obvious limitations, including wide and uneven molecular weight distribution of the product, and multiple purification steps are often required before obtaining dextran of the desired molecular weight. The whole process is complicated and time-consuming, and it also causes potential pollution to the environment. Therefore, the development of more environmentally friendly, efficient and precisely regulated molecular weight dextran preparation methods has become a hot topic of current research. It is worth noting that the dextran produced by Leuconostoc mesenteroides0326 has a high proportion of α(1,6) glycosidic bonds (about 95%) while reducing antigenicity. It has good water solubility, especially when compared with α(1,3)-bond and β-bond structures, showing significant solubility advantages. Using biotechnology or enzymatic methods, the molecular weight of the produced dextran can be precisely regulated, avoiding the problem of uneven molecular weight distribution caused by traditional acid hydrolysis. At the same time, this method is environmentally friendly, has the potential to be green and sustainable, and also shows good application prospects in the optimization of modern dextran production processes.

[0004] The bioenzymatic method has mild reaction conditions and high catalytic efficiency, and has shown significant advantages in the preparation of dextran. Compared with traditional chemical methods, enzymatic reactions can be carried out at lower temperatures and neutral or slightly acidic and alkaline conditions, greatly reducing pollution to the environment, and precisely controlling the molecular weight of the target product by regulating the type, concentration and reaction conditions of the enzyme. In addition, the catalytic activity and specificity of the enzyme make the production process more efficient, the product purity is higher, and the subsequent separation and purification steps are reduced. Therefore, the bioenzymatic method is gaining increasing attention in industrial applications.

[0005] In the preparation process of dextran, dextran sucrase (Dextransucrase, EC 2.4.1.5), which belongs to the glycoside hydrolase family 70, is the core catalytic enzyme that can catalyze the synthesis of dextran from sucrose. By performing site-directed mutagenesis on dextran sucrase, the structure of its active center pocket can be precisely regulated, thereby changing its molecular weight distribution when catalyzing the synthesis of dextran. Studies have shown that by adjusting the key sites of sucrase, the polymerization length of glucan can be affected, and dextran with different molecular weights can be produced. This directed mutagenesis technology greatly expands the flexibility of the bioenzymatic method in molecular weight regulation and provides an effective way to prepare dextran with a specific molecular weight.

[0006] The dextran sucrase used in the present invention is from Leuconostocmesenteroides 0326, which is widely used in the industrial production of dextran. The enzyme consists of 1250 to 1600 amino acids and has a protein size of about 170 KDa. Its unique structure makes it have a wide range of application prospects in the field of polysaccharide synthesis, especially in the synthesis of polysaccharide drugs, the development of pharmaceutical excipients, the preparation of health foods and degradable biomaterials.

[0007] Dextranase (α-1,6-D-glucan-6-glucanohydrolase; EC3.2.1.11) is a hydrolase that can specifically degrade the α-1,6 glycosidic bonds in dextran molecules. Usually, the enzyme is divided into endo-dextranase and exo-dextranase according to the different ways of hydrolyzing dextran. Endodextranase randomly hydrolyzes the α-(1,6) bonds inside the dextran chain to generate a series of medium and low molecular weight polysaccharides. Exodextranase mainly degrades the α-(1,6) bonds from the non-reducing end of the dextran chain to release glucose. The dextranase selected in this study is from Pichia pastoris, an endo-dextranase with a protein size of about 65KDa.

[0008] In addition, previous studies have been conducted on the strategy of synergistic catalysis of dextran sucrase and dextranase to further reduce the molecular weight of the product. Dextranase can hydrolyze the α(1,6) glycosidic bond in dextran and generate low molecular weight dextran by synergistic action with dextran sucrase. Our research group has successfully conducted synergistic catalysis experiments of dextran sucrase and dextranase and successfully obtained low molecular weight dextran with a molecular weight between 5 KDa and 20 KDa. Reference Gan W, Zhang H, Zhang Y, et al. Biosynthesis of oligodextrans with different Mw by synergistic catalysis of dextransucraseand dextranase[J]. Carbohydrate polymers, 2014, 112: 387-395. This study shows that the molecular weight of dextran can be controlled through dual enzyme synergy, but the catalytic efficiency of the dual enzyme system is still limited when the enzyme molecules are free, and it is difficult to obtain a large amount of dextran with uniform molecular weight, especially below 5000Da, through dual enzyme synergy.

[0009] In recent years, gene fusion technology has also been applied to the preparation of dextran. Publication No. CN113564092A reports a method for directional synthesis of dextran fusion enzyme, which can not only synthesize and degrade dextran at the same time, but also produce low molecular weight products, which is another method for preparing low molecular weight dextran. However, this enzyme engineering technology still faces problems such as enzyme stability and expression efficiency in practical applications, and further optimization is needed.

[0010] Although the above strategies have made some progress in the molecular weight regulation of dextran, there are no reports on the construction of self-assembling enzymes to produce uniform and concentrated dextran through in vitro self-assembly. The self-assembling enzyme system is an emerging enzyme engineering technology that can spontaneously assemble enzyme molecules with different functions into multi-enzyme complexes through covalent interactions. This complex structure can increase the local concentration of enzymes, enhance the synergistic effect of enzymes, and optimize catalytic efficiency through spatial proximity effects. The self-assembling enzyme system is expected to provide a new and efficient way for the production of dextran, especially in terms of molecular weight distribution uniformity. Summary of the invention

[0011] The purpose of the present invention is to provide a method for constructing a self-assembling enzyme for directional synthesis of low molecular weight dextran below 5000Da and its application. Compared with natural enzymes (single enzyme or a mixture of multiple enzymes such as double enzyme synergistic catalysis), the construction of self-assembling enzymes can bring many advantages in function and application, in order to obtain products with concentrated molecular weight, reduce costs, be suitable for industrial production, and expand practical application value, two enzymes involved in sequential catalytic reactions are efficiently expressed in their respective expression systems through protein engineering, and self-assembled by in vitro incubation. Low molecular weight, uniform molecular weight, and concentrated dextran can be directly obtained by one-step catalysis of this self-assembling enzyme.

[0012] To achieve the above object, the present invention provides the following technical solutions:

[0013] First, the present invention provides a self-assembling enzyme for directed synthesis of uniform low molecular weight dextran, named YG-SpyTag-SpyCatcher-padex, wherein YG is a dextran sucrase gene (Genbank No.DQ345760), padex is a dextran sucrase gene (GenBank No.KF999646.1), SpyTag and SpyCatcher are two specific short peptides, and the aspartic acid in SpyTag and the lysine in SpyCatcher spontaneously form an isopeptide bond. The present invention combines the dextran sucrase derived from the genetically engineered bacterium BL21 (DE3)-YG-SpyTag with the dextran sucrase derived from the genetically engineered bacterium X33-SpyCatcher-padex of Pichia pastoris through the SpyTag-SpyCatcher protein covalent coupling system, and the obtained self-assembling enzyme can catalyze the substrate sucrose to directly convert into dextran with a molecular weight of 3000-4000Da.

[0014] Secondly, the present invention provides a method for constructing the above-mentioned self-assembling enzyme, comprising the following steps:

[0015] (1) The recombinant expression plasmid pET-28a(+)-YG-SpyTag was transformed into the competent E. coli cell BL21(DE3). After kanamycin resistance screening, restriction digestion, bacterial liquid PCR and DNA sequencing verification, the E. coli genetically engineered bacteria BL21(DE3)-YG-SpyTag were obtained;

[0016] (2) The recombinant expression plasmid pPICZαA-SpyCatcher-padex was first linearized by enzyme digestion and then transformed into the genome of Pichia pastoris competent cell X33. After bleomycin resistance screening, bacterial liquid PCR and DNA sequencing verification, the Pichia pastoris genetically engineered bacteria X33-SpyCatcher-padex were obtained.

[0017] (3) The Escherichia coli genetically engineered bacteria BL21 (DE3)-YG-SpyTag was fermented to express dextran sucrase, and the Pichia pastoris genetically engineered bacteria X33- SpyCatcher-padex was fermented to express dextranase. The two enzymes were purified separately and then incubated together in 10mM, pH=5-8 phosphate buffer solution at 4-37°C for 10-15h to obtain a self-assembling enzyme capable of directing the synthesis of uniform low molecular weight dextran. Among them, incubation at 10-20°C for 10-12h with 10mM phosphate buffer solution (pH=6) was more optimal; and incubation at 15°C for 12h with 10mM phosphate buffer solution (pH=6) was the best.

[0018] The construction method is to use the dextran sucrase gene YG (Genbank No. DQ345760) and the dextran sucrase gene padex (GenBank No. KF999646.1) from Penicillium aculeatus as templates, the dextran sucrase gene YG is transformed into the competent cells of Escherichia coli BL21 (DE3) through homologous recombination, the dextran sucrase gene padex from Penicillium aculeatus is linearized into a plasmid after homologous recombination and transformed into the genome of Pichia pastoris X33, and then each is fermented and expressed, and the self-assembly enzyme YG-SpyTag-SpyCatcher-padex can be obtained by incubating at 15° C. for 12 hours. Among them, YG is dextran sucrase, padex is dextran sucrase, SpyTag and SpyCatcher are two specific short peptides, and aspartic acid in SpyTag will spontaneously form an isopeptide bond with lysine in SpyCatcher.

[0019] In the above-mentioned construction method, specifically, SpyTag and SpyCatcher protein short peptides are used as connecting bridges to carry out primer design, recombinant plasmid construction and host bacteria transformation. The design of SpyTag and SpyCatcher protein short peptides refers to ChenX, Chen X, Zhu L, et al. Efficient production of inulo-oligosaccharides frominulin by exo-and endo-inulinase co-immobilized onto a self-assemblingprotein scaffold[J]. International Journal of Biological Macromolecules,2022, 210: 588-599. SpyTag and SpyCatcher are used as connecting fragments. The schematic diagram of the SpyTag and SpyCatcher structure is shown in Figure 2 As shown, SpyCatcher is a 113-residue long peptide that includes Lys31. SpyTag is a 13-residue peptide that includes Asp117. The two parts recognize each other with high affinity, forming an isopeptide bond between SpyCatcher and SpyTag to form a covalently bound complex. This isopeptide bond is extremely stable and can withstand extreme conditions such as high temperature, denaturants, and mechanical forces.

[0020] Step (1) The recombinant expression plasmid pET-28a(+)-YG-SpyTag was obtained by designing primers based on the dextran sucrase gene YG and digesting the original template with DMT enzyme (Quanshijin Company) through PCR amplification technology. The details are as follows:

[0021] The dextran sucrase YG plasmid was extracted using a plasmid mini-extraction kit (purchased from Beijing Quanshijin Biotechnology Co., Ltd.), and then PCR was performed using the following primers. The PCR conditions were: 94°C pre-denaturation for 3 min; 94°C denaturation for 5 s, 60°C annealing for 15 s, 72°C extension for 2 min, 35 cycles; 72°C extension for 5 min. After the PCR reaction was completed, agarose gel electrophoresis was used for detection. After agarose nucleic acid electrophoresis was correct, DMT enzyme (Beijing Quanshijin Biotechnology Co., Ltd.) was used for digestion to remove the methylated template.

[0022] Upstream primer:

[0023] 5'----GGTGGCGGTGGCAGTGCGCACATCGTTATGGTCGATGCATATAAACCCACCAAATAACTCGAGCACCACCACCACCA----3'

[0024] Downstream primer:

[0025] 5'-----CGATGTGCGCACTGCCACCGCCACCGCTACCGCCACCGCCTGCTGACACAGCATTTCCATTATTATCAAATTGGTAAA----3'.

[0026] Step (2) The recombinant expression plasmid pPICZαA-SpyCatcher-padex is obtained by designing primers using the dextranase gene padex and the SpyCatcher gene (PDB ID: 4MLI) from Penicillium aculeatus as templates, and by PCR amplification technology, purifying the original template after DMT enzyme digestion, and then homologous recombination. The details are as follows:

[0027] The SpyCatcher gene was amplified by PCR using the following primers.

[0028] Upstream primer:

[0029] 5'-----TCGAGAAAAGAGAGGCTGAAGCTGAATTCTTCGAAACGATGGCGATGGTGGATACCCTGAGC-----3'

[0030] Downstream primer:

[0031] 5'------GAGCCAAAGTCAACAACTTCAACATAGTAGCGCCGCTGCCGCCCGCTGCCAATATGCGCATCG -----3'.

[0032] Then the dextranase padex gene PCR was linearized using the following primers.

[0033] Upstream primer:

[0034] 5'-----GAATTCAGCTTCAGCCTCTTTTCTCGA -----3'

[0035] Downstream primer:

[0036] 5'-----GCTACTATGTTGAAGTTGTTGACTTTGGCTCT-----3'

[0037] The gene fragment SpyCatcher and the linearized padex were then digested and purified with DMT enzyme, connected by homologous recombination technology, transformed into DH5α competent cells, and single colonies were picked and sequenced for verification.

[0038] Further, on the one hand, by transforming the recombinant expression plasmid pET-28a(+)-YG-SpyTag into the competent Escherichia coli cell BL21(DE3), after kanamycin resistance screening, enzyme digestion, bacterial liquid PCR and DNA sequencing verification, the self-assembling enzyme Escherichia coli BL21(DE3)-YG-SpyTag genetic engineering bacteria for the directional synthesis of dextran can be obtained. On the other hand, by firstly linearizing the recombinant expression plasmid pPICZαA-SpyCatcher-padex by enzyme digestion, and then transforming it into the genome of the competent Pichia pastoris cell X33, after bleomycin resistance screening, bacterial liquid PCR and DNA sequencing verification, the self-assembling enzyme Pichia pastoris X33-SpyCatcher-padex genetic engineering bacteria for the directional synthesis of dextran can be obtained.

[0039] In the above-mentioned construction method, preferably, in step (3), the genetically engineered Escherichia coli BL21 (DE3)-YG-SpyTag is fermented to express dextran sucrase, and the method comprises the following steps: the genetically engineered bacteria BL21 (DE3)-YG-SpyTag is inoculated at a volume fraction of 0.5% into LB medium containing 40-60 μg / mL kanamycin, the rotation speed is 250 r / min, and the culture is carried out at 37°C for 16 hours; 2 mL of the culture solution is taken out and added to 200 mL of A medium, and the medium is placed in a shaking table for culture at 37°C. When the enriched culture solution is diluted 10 times with distilled water, the OD600 At 0.20-0.24, 500 μL IPTG (inducer, isopropyl-β-D-thiogalactoside) can be added to start inducing enzyme production, and the fermentation is induced at 25°C for 3.5-4 hours. The bacterial suspension after induced fermentation is centrifuged at 8000r / min for 15 minutes at 0°C. One centrifuge tube corresponds to one bottle of bacterial suspension, and then distilled water is added for shaking and washing, and centrifuged again; 15-20mL of acetic acid-calcium acetate buffer with a pH value of 5.4 is added to each centrifuge tube for shaking and evenly shaking, an ice water bath is added, ultrasonically broken for 15 minutes, and centrifuged. The supernatant is dextran sucrase with an enzyme activity of 50-80U / mL. Among them, preferably, each liter of the A culture medium contains 5g glycerol, 5g glucose, 10g peptone, 10g potassium nitrate, 17.105g Na2HPO4·12H2O, 3g KH2PO4, 1g NH4Cl, and 0.1mMMgSO4·7H2O.

[0040] In addition, for the construction method described above, step (3) is preferably to ferment the Pichia pastoris genetically engineered bacteria X33-SpyCatcher-padex to express dextranase, using the following method steps: inoculate the genetically engineered bacteria X33-SpyCatcher-padex into liquid YPD culture medium at a rate of 0.5%, and culture at 30°C and 250 r / min for 24 hours. Then, inoculate into BMGY culture medium at a rate of 1%, and culture under the same conditions for 12-24 hours. Collect the bacteria by centrifugation, discard the culture supernatant, and then resuspend the bacteria in BMMY culture medium, and finally culture on a shaker at 25°C and 250 r / min for 5 days. Add 1% methanol every 24 hours for induction. Centrifuge the bacterial suspension after induced fermentation at 0°C and 10,000 r / min for 15 minutes, and collect the supernatant as dextranase with an enzyme activity of 150-200 U / mL.

[0041] Preferably, each liter of the BMGY medium contains: 1% yeast extract powder, 2% peptone, 100 mM sodium phosphate pH 6.0, 1.34% YNB, 4x10 -5 % biotin, 1% glycerol. Preparation method: weigh 20g peptone, 10g yeast extract powder, dissolve in water, add 100mL 1M sodium phosphate pH6.0 buffer, add water to 800mL, autoclave at 121℃ for 20min, add 100mL 10% glycerol, 100mL 10xYNB, 2mL 500xB, the preparation is complete, and package.

[0042] Preferably, each liter of the BMMY medium contains the following medium formula: 1% yeast extract, 2% peptone, 100 mM sodium phosphate pH 6.0, 1.34% YNB, 4x10-5 % biotin, 1% methanol. Preparation method: weigh 20g peptone, 10g yeast extract powder, dissolve in water, add 100mL 1M sodium phosphate pH 6.0 buffer, add water to 800mL, autoclave at 121℃ for 20min, add 100mL 10% methanol, 100mL 10xYNB, 2mL 500xB, the preparation is complete, and package.

[0043] Preferably, 100 mg / mL Zeocin (bleomycin) is prepared by weighing 100 mg bleomycin, adding 1 mL of sterile water, filtering with a 0.22 μm microporous filter membrane for sterilization, and storing at -20°C after aliquoting.

[0044] Preferably, 1M sodium phosphate pH 6.0. Solution A: Weigh 138 g NaH2PO4 and dissolve it in an appropriate amount of water. After fully dissolving, dilute to 1L to obtain 1mol / L NaH2PO4. Solution B: Weigh 142 g Na2HPO4 and dissolve it in an appropriate amount of water. After fully dissolving, dilute to 1L to obtain 1 mol / L Na2HPO4. Take 877 mL of solution A and mix with 133 mL of solution B to obtain a 1M pH 6.0 sodium phosphate buffer solution.

[0045] Preferably, 10xYNB: weigh 134 g YNB (yeast nitrogen base) and dissolve it in 1000 mL water, filter and sterilize it with a 022 μm sterile filter, and store it at 4° C. The validity period is 1 year.

[0046] Preferably, 500xB: weigh 20 mg of biotin and dissolve it in 100 mL of water, filter and sterilize it with a 022 um sterile filter, and store it at 4° C. for one year.

[0047] Preferably, 10% glycerol: 10 mL glycerol is mixed with 90 mL water, filtered and sterilized or autoclaved, and stored at room temperature. The validity period is more than one year.

[0048] Preferably, 10% methanol: 10 mL of anhydrous methanol is mixed with 90 mL of water, filtered and sterilized with a sterile 0.22 μm microporous filter, and can be stored at 4° C. for about two months.

[0049] The present invention provides a genetically engineered bacterium capable of synthesizing low molecular weight dextran in a directional manner, and obtains a self-assembly enzyme by fermentation expression in vitro, so as to realize the application in the preparation of uniform low molecular weight dextran, wherein the Escherichia coli engineered bacterium BL21 (DE3) -YG-SpyTag is fermented to express dextran sucrase, and the yeast engineered bacterium X33-SpyCatcher-padex is fermented to express dextran enzyme, and then the two are purified respectively, and then incubated at 15° C. for 12 hours under 10mM phosphate buffer solution (pH=6), to obtain a self-assembly enzyme for preparing uniform low molecular weight dextran. Then, sucrose is used as a substrate and the low molecular weight dextran can be directly obtained by bifunctional catalysis of the self-assembly enzyme. Preferably, a dextran with a concentrated weight average molecular weight of 3000-4000Da can be obtained.

[0050] Compared with the prior art, the present invention has the following beneficial effects:

[0051] (1) The dextran synthesized by the self-assembled enzyme obtained by in vitro self-assembly of the enzyme solution obtained by inducing expression of the genetically engineered bacteria constructed by the present invention has a concentrated molecular weight and a high conversion rate, and is simple to separate and purify. Under the same conditions, the yield calculation found that the dextran constructed by the present invention directly converts most of the sucrose into dextran with a molecular weight of 3000-4000Da.

[0052] (2) Under the same conditions and reaction time, the self-assembled enzyme obtained by self-assembly after expression by the engineered bacteria has a more concentrated molecular weight than the dual-enzyme free enzyme synergistic catalytic product (the dual-enzyme free enzyme synergistic catalytic product system contains heterogeneous sugar anhydrides with molecular weights of 30,000Da, 20,000Da and 10,000Da).

[0053] (3) The present invention can specifically produce dextran 3000-4000Da, simplifying the separation and purification steps, reducing production costs, and providing a certain basis for better application in production. BRIEF DESCRIPTION OF THE DRAWINGS

[0054] FIG1 is a diagram of the construction of dextran sucrase and dextranase plasmid of the present invention; (a) YG-SpyTag (b) SpyCatcher-padex;

[0055] Figure 2 Schematic diagram of the structure of SpyCatcher and SpyTag of the present invention; (a) SpyCatcher (b) SpyTag;

[0056] Figure 3 This is an SDS-PAGE diagram of the self-assembly enzyme protein after purification of the present invention;

[0057] FIG4 is a diagram of the catalytic mechanism of the present invention; (a) schematic diagram of self-assembly catalysis (b) schematic diagram of dual enzyme catalysis;

[0058] Figure 5 This is a HPLC chart of the molecular weight of the dextran product of the present invention; in the chart, the ordinate represents the peak height, that is, the content, and the abscissa represents the peak time and also represents the molecular weight;

[0059] Figure 6 It is a one-dimensional hydrogen spectrum of the product dextran of the present invention;

[0060] Figure 7 It is a two-dimensional spectrum of the product dextran of the present invention;

[0061] Figure 8 It is the Fourier transform infrared spectrum of the product dextran of the present invention. DETAILED DESCRIPTION

[0062] The following embodiments are further descriptions of the content of the present invention as an explanation of the technical content of the present invention, but the essential content of the present invention is not limited to the following embodiments. Ordinary technicians in this field can and should know that any simple changes or replacements based on the essential spirit of the present invention should fall within the scope of protection required by the present invention.

[0063] Example 1

[0064] Construction of a self-assembling enzyme genetically engineered bacteria BL21(DE3)-YG-SpyTag and X33-SpyCatcher-padex for the directional synthesis of uniform low molecular weight dextran.

[0065] Using the dextran sucrase gene YG as a template, PCR, digestion, and transformation into BL21 (DE3) Escherichia coli were used to obtain the self-assembling enzyme Escherichia coli BL21 (DE3)-YG-SpyTag genetic engineering bacteria that can synthesize uniform low molecular weight dextran. Using the SpyCatcher gene and the dextranase gene padex as templates, PCR, digestion, purification, homologous recombination, and plasmid linearization were used to transform into the Pichia pastoris X33 genome to obtain the Pichia pastoris X33-SpyCatcher-padex genetic engineering bacteria. Among them, the primer design is based on the dextran sucrase gene YG, SpyCatcher gene sequence and dextranase gene padex sequence, and the primers are designed with the help of SnapGene software.

[0066] For Dextransucrase:

[0067] The dextran sucrase YG plasmid was extracted using a plasmid extraction kit (purchased from Beijing Quanshijin Biotechnology Co., Ltd.), and then PCR was performed using the following primers. The PCR conditions were: 94°C pre-denaturation for 3 min; 94°C denaturation for 5 s, 60°C annealing for 15 s, 72°C extension for 2 min, 35 cycles; 72°C extension for 5 min. After the PCR reaction was completed, it was detected by agarose gel electrophoresis. After the agarose nucleic acid electrophoresis detection was correct, DMT enzyme (Beijing Quanshijin Biotechnology Co., Ltd.) was used for digestion to remove the methylated template. Plasmid construction is as follows Figure 1a shown.

[0068] Upstream primer:

[0069] 5'--GGTGGCGGTGGCAGTGCGCACATCGTTATGGTCGATGCATATAAACCCACCAAATAACTCGAGCACCACCACCACCA--3'

[0070] Downstream primer:

[0071] 5'--CGATGTGCGCACTGCCACCGCCACCGCTACCGCCACCGCCTGCTGACACAGCATTTCCATTATTATCAAATTGGTAAA--3'.

[0072] For Dextranase:

[0073] The SpyCatcher gene (PDB ID: 4MLI) was amplified by PCR using the following primers. The PCR conditions were: 94°C pre-denaturation for 3 min; 94°C denaturation for 5 s, 60°C annealing for 15 s, 72°C extension for 2 min, 35 cycles; 72°C extension for 5 min.

[0074] Upstream primer:

[0075] 5'-TCGAGAAAAGAGAGGCTGAAGCTGAATTCTTCGAAACGATGGCGATGGTGGATACCCTGAGC -3'

[0076] Downstream primer:

[0077] 5'--GAGCCAAAGTCAACAACTTCAACATAGTAGCGCCGCTGCCGCCCGCTGCCAATATGCGCATCG --3'.

[0078] Then, the dextranase padex gene was linearized by PCR using the following primers. The PCR conditions were: 94°C pre-denaturation for 3 min; 94°C denaturation for 5 s, 60°C annealing for 15 s, 72°C extension for 2 min, 35 cycles; 72°C extension for 5 min.

[0079] Upstream primer:

[0080] 5'-GAATTCAGCTTCAGCCTTCTTTCTCGA-3'

[0081] Downstream primer:

[0082] 5'-GCTACTATGTTGAAGTTGTTGACTTTGGCTCT-3'

[0083] The gene fragment SpyCatcher and the linearized padex were then digested and purified with DMT enzyme, and then connected by homologous recombination technology, transformed into E. coli DH5α competent cells, and single colonies were picked and sequenced for verification. Figure 1b As shown. The reaction system selected for connection is the homologous recombination system. Preferably: purified first PCR product: 2μL; purified second PCR product: 1μL; 2×Basic Assembly Premix Mix 5μL, the reaction system is filled up to 10μL with ultrapure water. Connection procedure: After gently mixing the above reaction system, place it at 50℃ for 30min, and then place it on ice to obtain the connection product. Transform the connection product into Escherichia coli DH5α competent cells, add 500μL LLB liquid culture medium, culture at 37℃, 220rpm for 1h, take 50μL of bacterial solution and spread it on a solid LLB plate containing 100μg / mL bleomycin antibiotics, culture at 37℃ overnight, pick positive colonies for PCR identification, and send the positive bacterial solution to a universal biological sequencing company for sequencing.

[0084] Host bacteria I transformation is to transform the recombinant expression plasmid pET-28a(+)-YG-SpyTag into Escherichia coli competent cells BL21(DE3), and obtain the self-assembling enzyme Escherichia coli engineering bacteria BL21(DE3)-YG-SpyTag genetic engineering bacteria suitable for directional synthesis of uniform low molecular weight dextran after kanamycin resistance screening, enzyme digestion, bacterial liquid PCR and DNA sequencing verification. Specifically, host bacteria I transformation includes the following steps:

[0085] (1) Take 100 μL of Escherichia coli BL21 (DE3) competent cell suspension (purchased from Beijing Quanshijin Biotechnology Co., Ltd.) from the -80°C refrigerator and thaw it on ice;

[0086] (2) Add the prepared recombinant expression plasmid, add about 5 μL of pET-28a(+)-YG-SpyTag plasmid to every 50 μL of competent cells, shake gently, and place on ice for 30 minutes;

[0087] (3) Heat shock in a 42°C water bath for 45 seconds, followed by rapid cooling on ice for 2 minutes;

[0088] (4) Add 500 μL of sterilized LB liquid medium (without antibiotics) to the tube, mix well, and culture at 37°C for 1 hour to allow the bacteria to return to normal growth;

[0089] (5) After the bacterial solution is shaken, 100 μL is spread on a screening plate containing kanamycin (100 μg / mL) and placed with the front side facing up for half an hour. When the bacterial solution is completely absorbed by the culture medium, the culture medium is inverted and cultured at 37° C. for 16 to 18 hours; positive colonies are selected and verified by PCR of the bacterial solution to obtain the self-assembling enzyme Escherichia coli engineered bacteria BL21(DE3)-YG-SpyTag genetically engineered bacteria that can direct the synthesis of uniform low molecular weight dextran.

[0090] Host bacteria II transformation is to transform the recombinant expression plasmid pPICZαA-SpyCatcher-padex into Pichia pastoris X33 competent cells, first linearize the recombinant plasmid with SacⅠ endonuclease, then screen for bleomycin resistance and verify with DNA sequencing to obtain the self-assembling enzyme Pichia pastoris X33-SpyCatcher-padex genetic engineering bacteria suitable for the directional synthesis of uniform low molecular weight dextran. Specifically, host bacteria II transformation includes the following steps:

[0091] (1) Thaw the cryopreserved X33 competent cells on ice and let them stand for 5-6 minutes until they are completely thawed. Immediately add 10 μL of the linearized recombinant plasmid pPICZαA-SpyCatcher-padex and let it stand on ice for about 2 minutes.

[0092] (2) Preheat the electroporation instrument for 30 min, add the competent cells into the electroporation cup, and perform electroporation transformation: voltage 2500 V, time 4.5 ms;

[0093] (3) Remove the electroporation cup and immediately add 1 mL of ice-cold 1 M sorbitol solution to rinse the yeast cells in the electroporation cup. Transfer the cells to a centrifuge tube and culture them in a shaking incubator at 30°C and 250 rpm for 1 h.

[0094] (4) Centrifuge the cultured cells at 4000 x g for 2 min, remove 900 μL of supernatant with a pipette, and resuspend the cells in the remaining culture medium;

[0095] (5) Spread all the bacteria on a YPD plate containing 100 μg / mL bleomycin resistance, culture inverted at 30°C for 3-5 days, and observe the growth of the bacteria on the culture medium.

[0096] Example 2

[0097] Expression of the self-assembling enzyme Escherichia coli genetically engineered bacteria BL21(DE3)-YG-SpyTag that can direct the synthesis of uniform low molecular weight dextran.

[0098] The genetically engineered bacteria BL21(DE3)-YG-SpyTag obtained in Example 1 was inoculated into LB medium containing 40-60 μg / mL kanamycin at a rate of 0.5%, and cultured at 37°C for 16 hours at a speed of 250 r / min. 2 mL of the culture solution was taken out and added to 200 mL of A medium, and cultured on a shaking table at 37°C. When the enriched culture solution was diluted 10 times with distilled water, the OD 600 At 0.20-0.24, 500 μL IPTG can be added to start inducing enzyme production. After 25°C induction fermentation for 3.5-4 hours, crushing and centrifugation are performed. Keep 25°C for 3.5-4 hours of induction fermentation. The bacterial suspension obtained after induced fermentation is centrifuged at 8000r / min for 15 minutes at 4°C. One centrifuge tube corresponds to one bottle of bacterial suspension, and then distilled water is added for shaking and washing, and centrifuged again; 15-20mL of acetic acid-calcium acetate buffer with a pH value of 5.4 is added to each centrifuge tube and shaken and shaken, and an ice water bath is added. Ultrasonic crushing for 15 minutes, centrifugation, and the supernatant is dextran sucrase with an enzyme activity of 50-80U / mL. Among them, each liter of the A culture medium contains 5g glycerol, 5g glucose, 10g peptone, 10g potassium nitrate, 17.105g Na2HPO4·12H2O, 3g KH2PO4, 1gNH4Cl, and 0.1mM MgSO4·7H2O.

[0099] Example 3

[0100] Expression of the self-assembling enzyme Pichia pastoris genetically engineered bacteria X33-SpyCatcher-padex that can direct the synthesis of uniform low molecular weight dextran.

[0101] The genetically engineered bacteria X33-SpyCatcher-padex obtained in Example 1 was inoculated into a YPD medium containing 100 μg / mL bleomycin at an inoculum size of 0.5%, and cultured at 30°C and 250 r / min for 24 hours. Then, it was inoculated into a BMGY medium at a ratio of 1% and cultured under the same conditions for 12-24 hours. The bacteria were collected by centrifugation, and after discarding the culture supernatant, the bacteria were resuspended in BMMY medium, and finally cultured on a shaker at 25°C and 250 r / min for 5 days. 1% methanol was added every 24 hours for induction. The bacterial suspension after induced fermentation was centrifuged at 0°C and 10000r / min for 15 minutes, and the supernatant was collected as dextranase with an enzyme activity of 150-200 U / mL.

[0102] Each liter of the BMGY medium contains: 1% yeast extract powder, 2% peptone, 100 mM sodium phosphate pH 6.0, 1.34% YNB, 4x10 -5 % biotin, 1% glycerol. Preparation method: weigh 20g peptone, 10g yeast extract powder, dissolve in water, add 100mL 1M sodium phosphate pH6.0 buffer, add water to 800mL, autoclave at 121℃ for 20min, add 100mL 10% glycerol, 100mL 10xYNB, 2mL 500xB, the preparation is complete, and package.

[0103] Each liter of the BMMY medium contains the following medium formula: 1% yeast extract, 2% peptone, 100 mM sodium phosphate pH 6.0, 1.34% YNB, 4x10 -5 % biotin, 1% methanol. Preparation method: Weigh 20g peptone, 10g yeast extract powder, dissolve in water, add 100mL 1M sodium phosphate pH6.0 buffer, add water to 800mL, autoclave at 121℃ for 20min, add 100mL 10% methanol, 100mL 10xYNB, 2mL 500xB, and the preparation is complete, and package.

[0104] Example 4

[0105] The applications of the self-assembling enzyme that can synthesize uniform dextran 3000-4000Da are as follows:

[0106] The dextran sucrase and the purified dextranase obtained by the methods of Example 2 and Example 3 were incubated at 15° C. for 12 h in 10 mM phosphate buffer solution (pH=6) at a molar ratio of 1:1 to obtain a self-assembling enzyme, which was verified by SDS-PAGE. Figure 3 As shown, Figure 3 In the figure, lanes 1-4 are all purified self-assembly enzymes with a protein size of 250 KDa.

[0107] Sucrose was used as a substrate for the catalytic reaction. The enzyme reaction system was prepared as follows: 300 mM sucrose, acetic acid-calcium acetate buffer (pH = 5.4), and a reaction system of a self-assembling enzyme with an enzyme activity of 5 U / mL. The catalytic schematic diagram is shown in Figure 4. The reaction was carried out on a shaker at 30°C and 150-180 r / min for 6-8 hours. The reaction solution was taken out and boiled at high temperature to inactivate the self-assembling enzyme in the system. The reaction was terminated and the supernatant was collected by centrifugation. Subsequently, the fructose and residual sucrose in the reaction solution were dialyzed out using a 500Da dialysis bag, and the product was dried. The dried product was detected by differential liquid chromatography. The detection conditions were: GPC column, differential detector, mobile phase pure water, flow rate 0.6 mL / min, and high performance liquid chromatography detection as follows. Figure 5 , the self-assembly enzyme catalysis product is dextran with a weight average molecular weight of 3500Da after fitting the GPC column standard curve. One-dimensional hydrogen spectrum analysis characterizes the product dextran, such as Figure 6 shown. 1 The proton peak at around 4.98ppm in the H NMR spectrum proves the existence of α-1,6 glycosidic bonds on the main chain of dextran, while the proton peak at 5.25ppm indicates that the branched glycosidic bonds of dextran are α-1,3 glycosidic bonds. References: Li MQ, Zhang HB, Li Y, Hu XQ, Yang JW: The thermoduric effects of site-directed mutagenesis of proline and lysine ondextransucrase from Leuconostoc mesenteroides0326[J]. International Journal of Biological Macromolecules 2018,107(Pt B):1641-1649. The connection order between protons in the molecule can be known through the 1H-1H COSY nuclear magnetic spectrum, and the two-dimensional nuclear magnetic spectrum is shown in Figure 1. Figure 7 shown.

[0108] After infrared characterization of the sugar anhydride product, the results are as follows Figure 8 As shown. The sharp peak at 1005 cm⁻¹ indicates the presence of α-1,6 glycosidic bonds in the sample; the stretching vibration peaks at 917 cm⁻¹ and 763 cm⁻¹ show that the sugar ring structure of the product is a pyranose ring configuration; the absorption peak at 843 cm⁻¹ indicates that the anomeric carbon configuration of the dextran product is α-type. Compared with commercial dextran, the obtained product has the same functional groups and anhydride bond type.

[0109] It should be noted that the above-mentioned technical contents of the present invention are only for explanation and clarification to enable those skilled in the art to understand the technical essence of the present invention, so the technical contents are not used to limit the substantial protection scope of the present invention. The substantial protection scope of the present invention shall be subject to the claims. Those skilled in the art should know that any modification, equivalent substitution and improvement based on the substantial spirit of the present invention shall be within the substantial protection scope of the present invention.

Claims

1. A self-assembling enzyme for directional synthesis of uniform low molecular weight dextran, named YG-SpyTag-SpyCatcher-padex, which is obtained by combining dextran sucrase expressed by fermentation of Escherichia coli genetically engineered bacteria BL21 (DE3)-YG-SpyTag with dextranase expressed by fermentation of Pichia pastoris genetically engineered bacteria X33-SpyCatcher-padex through the SpyTag-SpyCatcher protein covalent coupling system; wherein, YG is a dextran sucrase gene, padex is a dextran sucrase gene, SpyTag and SpyCatcher are two specific short peptides, and the aspartic acid in SpyTag and the lysine in SpyCatcher spontaneously form an isopeptide bond; the Escherichia coli genetically engineered bacteria BL21 (DE3)-YG-SpyTag is obtained by transforming the recombinant expression plasmid pET-28a (+) -YG-SpyTag into the Escherichia coli competent cell BL21 (DE3), and screening for kanamycin resistance; the Pichia pastoris genetically engineered bacteria X33-SpyCatcher-padex is obtained by firstly enzymatically linearizing the recombinant expression plasmid pPICZαA-SpyCatcher-padex, and then transforming it into the Pichia pastoris competent cell X33, and screening for bleomycin resistance.

2. The method for constructing the self-assembling enzyme according to claim 1, comprising the following steps: (1) The recombinant expression plasmid pET-28a(+)-YG-SpyTag was transformed into the competent E. coli cell BL21(DE3). After kanamycin resistance screening, restriction digestion, bacterial liquid PCR and DNA sequencing verification, the E. coli genetically engineered bacteria BL21(DE3)-YG-SpyTag were obtained; (2) The recombinant expression plasmid pPICZαA-SpyCatcher-padex was first linearized by enzyme digestion and then transformed into the genome of Pichia pastoris competent cell X33. After bleomycin resistance screening, bacterial liquid PCR and DNA sequencing verification, the Pichia pastoris genetically engineered strain X33-SpyCatcher-padex was obtained; (3) The genetically engineered Escherichia coli BL21(DE3)-YG-SpyTag was fermented to express dextran sucrase, and the genetically engineered Pichia pastoris X33-SpyCatcher-padex was fermented to express dextran. The two enzymes were purified separately and then incubated together in 10 mM, pH 5-8 phosphate buffer solution at 4-37°C for 10-15 h to obtain a self-assembling enzyme that can synthesize uniform low molecular weight dextran.

3. The construction method according to claim 2, characterized in that: Step (1) The recombinant expression plasmid pET-28a(+)-YG-SpyTag is obtained by designing primers based on the dextran sucrase gene YG and digesting the original template with DMT enzyme through PCR amplification technology.

4. The construction method according to claim 2, characterized in that: Step (2) The recombinant expression plasmid pPICZαA-SpyCatcher-padex is obtained by designing primers using the dextranase gene padex and the SpyCatcher gene (PDB ID: 4MLI) from Penicillium aculeatus as templates, and amplifying the plasmid by PCR, digesting the original template with DMT enzyme, purifying the original template, and then homologous recombination.

5. The construction method according to claim 2, characterized in that: Step (3) fermenting the genetically engineered Escherichia coli BL21 (DE3)-YG-SpyTag to express dextran sucrase, using the following method steps: The genetically engineered bacteria BL21 (DE3)-YG-SpyTag was inoculated into LB medium containing 40-60 μg / mL kanamycin at a volume fraction of 0.5%, and cultured at 37°C for 16 hours at a speed of 250 r / min; 2 mL of the culture solution was taken out and added to 200 mL of A medium, and placed in a shaking incubator at 37°C for culture. When the enriched culture solution was diluted 10 times with distilled water, the OD 600 When the pH value is 0.20 to 0.24, 500 μL IPTG can be added to start inducing enzyme production, and the fermentation is induced at 25°C for 3.5 to 4 hours. The bacterial suspension after induced fermentation is centrifuged at 8000 r / min for 15 min at 0°C. One centrifuge tube corresponds to one bottle of bacterial suspension, and then distilled water is added for shaking and washing, and centrifuged again; 15-20 mL of acetic acid-calcium acetate buffer with a pH value of 5.4 is added to each centrifuge tube for shaking and evenly mixing, and an ice water bath is added. Ultrasonic disruption is performed for 15 minutes, and centrifugation is performed. The supernatant is dextran sucrase with an enzyme activity of 50 to 80 U / mL.

6. The construction method according to claim 5, characterized in that: Each liter of the A culture medium contains 5g glycerol, 5g glucose, 10g peptone, 10g potassium nitrate, 17.105g Na2HPO4·12H2O, 3g KH2PO4, 1g NH4Cl, and 0.1mMMgSO4·7H2O.

7. The construction method according to claim 2, characterized in that: Step (3) fermenting the genetically engineered Pichia pastoris X33-SpyCatcher-padex to express dextranase, using the following method steps: The genetically engineered bacteria X33-SpyCatcher-padex was inoculated into YPD medium containing bleomycin at a rate of 0.5%, and cultured at 30°C and 250 r / min for 24 hours; then, it was inoculated into BMGY medium at a rate of 1%, and cultured under the same conditions for 12-24 hours; the bacteria were collected by centrifugation, the culture supernatant was discarded, and the bacteria were resuspended in BMMY medium, and finally cultured on a shaker at 25°C and 250 r / min for 5 days; 1% methanol was added every 24 hours for induction; the bacterial suspension after induced fermentation was centrifuged at 0°C and 10000 r / min for 15 minutes, and the supernatant was collected as dextranase with an enzyme activity of 150-200 U / mL.

8. Use of the self-assembling enzyme according to claim 1 or obtained by the construction method according to any one of claims 2 to 7 in catalyzing the conversion of sucrose into low molecular weight dextran.

9. The use according to claim 8, characterized in that The low molecular weight dextran has a molecular weight of 3000-4000 Da.

Images