IncRNA and application thereof in improving regeneration capacity of mesenchymal stem cells

Abstract

The invention provides IncRNA and application thereof in improving the regeneration capacity of mesenchymal stem cells, and belongs to the technical field of biological medicine. The lncRNA provided by the invention has the effect of improving the regeneration capacity of endometrial-derived mesenchymal stem cells of old people, and solves the problem of limited performance of cell materials in the prior art. The invention proves that the regeneration capacity can be improved by changing the expression of the lncRNA in the endometrium-derived mesenchymal stem cells of the old people, and a theoretical basis is provided for clinical application of the lncRNA in multiple aspects. CCK8 shows that the lncRNA has the effects of promoting the proliferation of Old-hEMSCs and resisting oxidative damage; scratch experiments show that the overexpressed lncRNA has the capability of promoting the migration of the Old-hEMSCs.

Description

Technical Field

[0001] The present invention relates to the field of biomedical technology, and in particular to an lncRNA and its application in improving the regeneration ability of mesenchymal stem cells. Background Art

[0002] Mesenchymal stem cells are a type of multipotent stem cells that have all the common properties of stem cells, namely, self-renewal and multidirectional differentiation capabilities. Mesenchymal stem cells have the function of promoting injury repair and improving the prognosis of various diseases. Mesenchymal stem cells exist from a variety of sources, among which mesenchymal stem cells derived from human endometrium have multidirectional differentiation potential and can promote the regeneration process of host tissues through paracrine signals, and have broad application prospects in the field of tissue repair.

[0003] In the existing technology, young endometrial stem cells (Young-hEMSC) are difficult to obtain, and the source of uterine materials is mainly postmenopausal women around 50 years old. At the same time, mesenchymal stem cells derived from the uterus of the elderly (Old-hEMSC) have the defect of poor regeneration ability. Therefore, improving the regeneration ability of mesenchymal stem cells derived from human endometrium is of great significance to the research of related diseases.

[0004] Currently, there is no effective means to enhance the regenerative capacity of human endometrial-derived mesenchymal stem cells. Summary of the invention

[0005] The purpose of the present invention is to provide an IncRNA and its application in enhancing the regenerative ability of mesenchymal stem cells, which has many clinical application prospects.

[0006] In order to achieve the above-mentioned object of the invention, the present invention provides the following technical solutions:

[0007] The present invention provides an lncRNA, and the nucleotide sequence of the lncRNA is shown as SEQ ID NO.1.

[0008] The present invention also provides the use of the above-mentioned IncRNA in improving the regeneration ability of mesenchymal stem cells.

[0009] Preferably, the regenerative ability of mesenchymal stem cells is enhanced by overexpressing the lncRNA.

[0010] The present invention also provides the use of the target gene of the above-mentioned lncRNA in improving the regenerative ability of mesenchymal stem cells, and overexpressing the target gene of the lncRNA in mesenchymal stem cells improves the regenerative ability of mesenchymal stem cells.

[0011] Preferably, the nucleotide sequence of the target gene of the lncRNA is shown as SEQ ID NO.2.

[0012] The present invention also provides an expression box, a recombinant vector or a recombinant virus containing the target gene of the IncRNA.

[0013] The present invention also provides an overexpression recombinant vector, comprising the target gene of the above-mentioned IncRNA and the overexpression vector.

[0014] The present invention also provides the use of the above-mentioned expression cassette, recombinant vector or recombinant virus or overexpression recombinant vector in improving the regeneration ability of mesenchymal stem cells.

[0015] Preferably, the mesenchymal stem cells are mesenchymal stem cells derived from the endometrium of the elderly.

[0016] The present invention also provides the use of the above-mentioned IncRNA in any of the following:

[0017] ① Improve the cell viability of mesenchymal stem cells;

[0018] ② Enhance the anti-oxidative damage function of mesenchymal stem cells;

[0019] ③ Improve the cell migration ability of mesenchymal stem cells.

[0020] Beneficial effects of the present invention:

[0021] The present invention provides a lncRNA, which has the effect of improving the regeneration ability of endometrial mesenchymal stem cells in the elderly. The present invention confirms that the regeneration ability of endometrial mesenchymal stem cells in the elderly can be improved by changing the expression of lncRNA, which provides a theoretical basis for the clinical application of lncRNA in many aspects. The present invention overexpresses lncRNA by transfecting lentivirus, and verifies its overexpression level by QPCR; CCK8 shows that lncRNA has the effect of promoting the proliferation and anti-oxidative damage of Old-hEMSCs; and overexpression by scratch test shows that lncRNA has the ability to promote the migration of Old-hEMSCs. BRIEF DESCRIPTION OF THE DRAWINGS

[0022] Figure 1 The results of the cell transfection experiment are shown in Figure 1, where A is a fluorescent photo of the cells after transfection, and B is a QPCR result diagram to verify the transfection effect;

[0023] Figure 2 This is the result of CCK8 detection of proliferation level after lncRNA 01117 overexpression;

[0024] Figure 3 This is a graph showing the results of CCK8 testing for its anti-oxidative damage function;

[0025] Figure 4 This is the result of the scratch test. DETAILED DESCRIPTION

[0026] The technical solutions provided by the present invention are described in detail below in conjunction with the embodiments, but they should not be construed as limiting the protection scope of the present invention.

[0027] Example

[0028] The present invention provides a lncRNA, the sequence of which is:, as shown in SEQ ID NO.1, and named as lncRNA 01117 in subsequent experiments.

[0029] The target gene sequence of the lncRNA 01117 is: micro615-5p: GGGGGUCCCCGGUGCUCGGAUC, as shown in SEQ ID NO.2.

[0030] Cell transfection experiment: GeneCare Genetic Synthesis lncRNA 01117 overexpression and its negative control NC. Old-hEMSCs (3*10 5 ) were inoculated into six-well plates, and cell transfection was performed when the cell confluence reached 40-60%.

[0031] Figure 1 (A) is the invention of transfecting lncRNA 01117 by lentivirus, and the figure is a fluorescent photograph of the cells after transfection. The transfection effect was verified by QPCR, and the total RNA was extracted using Trizol reagent (Invitrogen), and the purity and concentration were determined using BioSpectrometer (eppendorf). The target gene sequence was obtained from the NCBI database, and the corresponding primers were designed using primer5 software. The obtained RNA was reverse transcribed into cDNA using PrimeScriptTM RT kit (Takara). PCR amplification was performed in LightCycler 480 (Roche, Switzerland), and the reaction program was set to the first stage based on 40 cycles: 95 degrees for 30 seconds, the second stage: 95 degrees for 5 seconds, 60 degrees for 34 seconds, 40 cycles, and the third stage: 95 degrees for 15 seconds, 60 degrees for 1 minute, and 95 degrees for 15 seconds. GAPDH was used as an internal control, such as Figure 1 As shown in (B), the results showed that after transfection, the expression level of lncRNA01117 in Old-hEMSCs was significantly increased and higher than that in Young-hEMSCs and hBMSCs.

[0032] lncRNA01117 improves the regenerative function of aged hEMSC cells

[0033] Cells from different groups were inoculated in 96-well plates, with 8,000 cells per well. Three replicate wells were set up for all cells at each time point, and cell counts were performed every 24 hours for 3 consecutive days, and growth curves were established. The results are shown in Figure 2 As shown in the figure, at the proliferation level, the cell viability of Old-hEMSCs was significantly increased after overexpression of lncRNA01117.

[0034] Cells from different groups were inoculated in 96-well plates, with 8,000 cells per well. When the cell confluence reached about 80%, 3% H202 was used for intervention, and the cells were incubated at 37°C for 1 hour. Cell activity was observed, intervention was terminated, and CCK8 was added to detect cell survival rate. Results are shown in Figure 3 In terms of anti-oxidative damage function, after the cells were damaged by H2O2, the CCK8 detection results showed that Old-hEMSC overexpressing lncRNA01117 was significantly higher than Old-hEMSC.

[0035] Cells from different groups were cultured in their respective six-well plates. When the cell confluence was close to 100%, they were scratched with a pipette tip, washed twice with PBS, and incubated in serum-free medium at 37°C for 24 h. Pictures were taken with an inverted microscope (Nikon, Japan), and the migration rate was measured and analyzed using ImageJ software. The results are shown in Figure 4 : The results of the scratch experiment showed that the migration ability of Old-hEMSC cells overexpressing lncRNA01117 was significantly higher than that of Old-hEMSC cells.

[0036] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principle of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention.

Claims

1. An lncRNA, characterized in that The nucleotide sequence of the lncRNA is shown in SEQ ID NO.

1.

2. Use of the lncRNA according to claim 1 in enhancing the regenerative ability of mesenchymal stem cells.

3. The use according to claim 2, characterized in that: The regenerative ability of mesenchymal stem cells is enhanced by overexpressing the lncRNA.

4. Use of the target gene of IncRNA according to claim 1 in enhancing the regenerative ability of mesenchymal stem cells, characterized in that: The target gene of the lncRNA is overexpressed in mesenchymal stem cells to enhance the regenerative ability of the mesenchymal stem cells.

5. The use according to claim 4, characterized in that: The nucleotide sequence of the target gene of the lncRNA is shown in SEQ ID NO.

2.

6. An expression cassette, recombinant vector or recombinant virus containing the target gene of the lncRNA according to claim 1.

7. An overexpression recombinant vector, characterized in that: It comprises the target gene of the IncRNA according to claim 1 and an overexpression vector.

8. Use of the expression cassette, recombinant vector or recombinant virus according to claim 6 or the overexpression recombinant vector according to claim 7 in enhancing the regenerative ability of mesenchymal stem cells.

9. The use according to any one of claims 2 to 5, or the use according to claim 8, characterized in that: The mesenchymal stem cells are mesenchymal stem cells derived from the endometrium of the elderly.

10. Use of the lncRNA according to claim 1 in any of the following: ① Improve the cell viability of mesenchymal stem cells; ② Enhance the anti-oxidative damage function of mesenchymal stem cells; ③ Improve the cell migration ability of mesenchymal stem cells.

Images