DcaWRKY2 gene for regulating and controlling anthocyanin synthesis and starch accumulation of dendrobium officinale under microgravity and gravity conditions and application of DcaWRKY2 gene

Abstract

The invention relates to the technical field of gene engineering and molecular breeding, in particular to a DcaWRKY2 gene for regulating and controlling anthocyanin synthesis and starch accumulation of dendrobium officinale under microgravity and gravity conditions and application of the DcaWRKY2 gene. The DcaWRKY2 gene provided by the invention is a WRKY gene capable of inhibiting anthocyanin synthesis and starch accumulation in dendrobium officinale under the conditions of microgravity and gravity. In the specific embodiment of the invention, the function of the DcaWRKY2 gene is verified through a virus-induced gene silencing (VIGS) technology, and the result shows that the existence of the gene can inhibit starch synthesis and anthocyanin accumulation of dendrobium officinale leaves; in dendrobium officinale, the content of starch and anthocyanin in dendrobium officinale leaves can be obviously increased through targeted silencing of a target gene (DcaWRKY2 gene); meanwhile, a large amount of starch and anthocyanin are accumulated in the dendrobium officinale leaves, so that the starch content of the leaves can be obviously increased, and the leaves turn red.

Description

Technical Field

[0001] The present invention relates to the technical field of genetic engineering and molecular breeding, and in particular to a DcaWRKY2 gene for regulating anthocyanin synthesis and starch accumulation in Dendrobium officinale under microgravity and gravity conditions and an application thereof. Background Art

[0002] The leaf color and flower color of landscaping and bonsai materials in gravity environment are intertwined with each other. The two are equally important. To some extent, the ornamental value of leaf color is even higher. Nowadays, the cultivation of new varieties with leaf color is increasingly valued. Orchidaceae Dendrobium plants have extremely high ornamental value. Their leaf color and flower color are important ornamental traits and are deeply loved in domestic and foreign markets.

[0003] Dendrobium catenatum is a perennial herbaceous edible plant of the genus Dendrobium in the Orchidaceae family. It is known as the "gold of medicine". Starch is the main photosynthetic product of Dendrobium catenatum leaves. The regulation of its metabolic process plays an important role in the yield and quality of Dendrobium catenatum.

[0004] As the space industry enters the deep space exploration stage, astronauts will leave the earth for a long time and live in microgravity conditions. It is urgent to solve the scientific problem of establishing a space life support system. The growth and development of higher plants plays a pivotal role. Many experiments in space environments have shown that microgravity affects the yield of plants in space by affecting their growth and development. Plants are affected by the microgravity environment in space both at the individual level and at the cellular level. The "starch-balance stone" hypothesis of plant gravity perception believes that starch in plants can sense gravity under gravity conditions. This physical phenomenon has recently been explained at the molecular level. However, the molecular mechanism of how starch in plants senses gravity under microgravity conditions has not been reported. As we all know, starch is the foundation of plant growth and development. Dendrobium can provide astronauts with a source of food and medicine. The study of Dendrobium starch under microgravity is of great significance. In addition, Dendrobium is a facultative CAM plant. In the absence of light, it can fix carbon dioxide in the space station through malic acid metabolism. When there is light, it can produce oxygen for astronauts to use. It does not compete with astronauts for oxygen, which is economical and energy-saving. It is more compatible in the study of the unique environment of simulated microgravity. Moreover, the space for plant growth equipment in the space station is precious. The plants of Dendrobium are short, so it is more convenient to study them in the limited space station. It cannot be ignored that the flowers and leaves of Dendrobium also have ornamental value and can regulate the physical and mental health of astronauts. It can be seen that Dendrobium is the preferred material for studying scientific problems under microgravity conditions. Therefore, it is very important to study the molecular mechanism of the formation and regulation of starch and leaf color of Dendrobium under simulated microgravity conditions. The research results on starch and leaf color of Dendrobium officinale under simulated microgravity can also be applied to research under gravity conditions in the future, providing theoretical support and genetic resources for the breeding of new varieties of Dendrobium officinale with changeable leaf colors, high yield and high quality under simulated microgravity and gravity.

[0005] Anthocyanin, as the most important color-forming substance among flavonoids, is a stable compound formed by a series of modifications of anthocyanins such as hydroxylation, methoxylation, glycosylation and acylation. It can control the change of leaf color and make plants present colorful colors. At present, the synthesis pathway of anthocyanin has been studied relatively clearly and is highly conservative. Its regulatory mechanism has also been reported in many model and non-model plants. In addition, the synthesis of starch is achieved under the synergistic action of many plastid-localized related enzymes. The starch synthesis pathway has been reported in many model and non-model plants.

[0006] Under gravity, although anthocyanin and starch synthesis pathways have been shown to be involved in the accumulation of anthocyanins and the synthesis of starch in many plants, most studies have focused on model plants or crops, and research on ornamental medicinal and edible flowers is relatively scarce, especially in Dendrobium officinale.

[0007] For a long time, the breeding mode of Dendrobium officinale has been mainly based on hybridization among varieties. The breeding process is random and blind, and it usually takes a lot of time and energy to obtain the ideal variety after multiple generations of breeding. In recent years, with the rapid development of science and technology, targeted molecular breeding technology using transgenic technology has been widely used in crops and horticultural flowers. Molecular breeding uses transgenic technology to knock out genes that control related phenotypic traits in target plants, so that the plants lose the corresponding phenotypes and finally obtain ideal varieties. Therefore, screening key genes that control related phenotypic traits is the prerequisite and important resource for molecular breeding. At present, basic research on starch metabolism in Dendrobium officinale is relatively lagging behind. The genes related to starch metabolism in its genome have not been identified, and whether the expression of these starch metabolism genes is synergistic and the transcriptional regulation of these genes is still unknown. At the same time, research on the synthesis pathway of plant anthocyanins and starch synthesis pathways under microgravity conditions is still blank. Summary of the invention

[0008] The purpose of the present invention is to provide a DcaWRKY2 gene for regulating anthocyanin synthesis and starch accumulation in Dendrobium officinale under microgravity and gravity conditions and its application to solve the problems existing in the above-mentioned prior art. The present invention provides a DcaWRKY2 gene for regulating anthocyanin synthesis and starch accumulation in Dendrobium officinale under microgravity and gravity conditions, and inhibiting the expression of the gene can significantly increase the content of anthocyanin and starch in Dendrobium officinale.

[0009] To achieve the above object, the present invention provides the following solutions:

[0010]

[0011] The present invention can significantly promote the synthesis of anthocyanins and the accumulation of starch in Dendrobium officinale by targeting and silencing the DcaWRKY2 gene under gravity and microgravity conditions. The discovery of this gene enriches the gene material library for transgenic molecular breeding of Dendrobium officinale, and provides strong support for the future molecular breeding of high-quality Dendrobium officinale and red trait leaves of Dendrobium officinale under gravity and microgravity.

[0012] The present invention provides a biological material containing the DcaWRKY2 gene, wherein the biological material comprises a recombinant vector and a recombinant bacterium.

[0013] Further preferably, the base vector of the recombinant vector is pTRV2-GFP.

[0014] More preferably, the basic bacteria of the recombinant bacteria is Agrobacterium.

[0015] The present invention provides the use of the DcaWRKY2 gene or the biological material in regulating anthocyanin synthesis and / or starch accumulation in Dendrobium officinale, and promotes anthocyanin synthesis and / or starch accumulation in the Dendrobium officinale by inhibiting the expression of the DcaWRKY2 gene.

[0016] The present invention provides a method for promoting anthocyanin synthesis and / or starch accumulation in Dendrobium officinale, comprising the step of inhibiting the expression of DcaWRKY2 gene in Dendrobium officinale; the nucleotide sequence of the DcaWRKY2 gene is shown in SEQ ID NO.1, and the specific nucleotide sequence is shown above.

[0017] The present invention provides the use of the DcaWRKY2 gene or the biological material in culturing a transgenic Dendrobium officinale with high anthocyanin content and / or high starch content, and obtains the transgenic Dendrobium officinale with high anthocyanin content and / or high starch content by inhibiting the expression of the DcaWRKY2 gene.

[0018] The present invention provides a method for cultivating a transgenic Dendrobium officinale with a high anthocyanin content and / or a high starch content, comprising the step of inhibiting the expression of a DcaWRKY2 gene in the Dendrobium officinale to obtain the transgenic Dendrobium officinale; the nucleotide sequence of the DcaWRKY2 gene is shown in SEQ ID NO.1, and the specific nucleotide sequence is as shown above.

[0019] The present invention provides the use of the DcaWRKY2 gene or the biological material in regulating the color of Dendrobium officinale leaves, and obtains Dendrobium officinale with red leaves by controlling the expression of the DcaWRKY2 gene.

[0020] The present invention provides a method for changing the color of Dendrobium officinale leaves, comprising the step of inhibiting the expression of DcaWRKY2 gene in Dendrobium officinale; the nucleotide sequence of the DcaWRKY2 gene is shown in SEQ ID NO.1, and the specific nucleotide sequence is shown above.

[0021] The present invention provides the use of the DcaWRKY2 gene or the biological material in cultivating transgenic Dendrobium officinale with red leaves, and obtains transgenic Dendrobium officinale with red leaves by inhibiting the expression of the DcaWRKY2 gene.

[0022] The present invention also provides a method for cultivating transgenic Dendrobium officinale with red leaves, comprising the step of inhibiting the expression of DcaWRKY2 gene in Dendrobium officinale to obtain the transgenic Dendrobium officinale; the nucleotide sequence of the DcaWRKY2 gene is shown in SEQ ID NO.1, and the specific nucleotide sequence is as shown above.

[0023] The present invention discloses the following technical effects:

[0024] The present invention isolates and identifies a WRKY gene that inhibits anthocyanin synthesis and starch accumulation under gravity and microgravity from Dendrobium officinale, and names it as DcaWRKY2 (005780) gene, referred to as DcaWRKY2 gene, and its nucleotide sequence is shown in SEQ ID NO. 1. The DcaWRKY2 gene provided by the present invention is a WRKY gene that inhibits anthocyanin synthesis and starch accumulation in Dendrobium officinale under microgravity and gravity conditions, and the discovery of the gene improves the integrity of the pathway that controls leaf starch accumulation and anthocyanin synthesis in Dendrobium officinale. In a specific embodiment of the present invention, the function of the DcaWRKY2 gene was verified by virus-induced gene silencing (VIGS) technology, and the results showed that the presence of the gene inhibited starch synthesis and anthocyanin accumulation in the leaves of Dendrobium officinale; in Dendrobium officinale, by targeted silencing of the target gene (DcaWRKY2 gene), the content of starch and anthocyanin in the leaves of Dendrobium officinale can be significantly increased; at the same time, due to the large accumulation of starch and anthocyanin in the leaves of Dendrobium officinale, the starch content of the leaves can be significantly increased and the leaf color can be red. The DcaWRKY2 gene provided by the present invention can enrich and improve the transgenic material library of high starch content and red leaf traits of Dendrobium officinale leaves under gravity and microgravity, and provide strong support for the molecular breeding of high-quality Dendrobium officinale and red leaf traits of Dendrobium officinale under gravity and microgravity in the future. It can be seen that the present invention supplements the role of the DcaWRKY2 gene in regulating anthocyanin synthesis and starch accumulation in Dendrobium officinale under microgravity and gravity conditions, and is an important basis and prerequisite for future molecular improvement breeding of Dendrobium officinale leaf color, yield and quality. BRIEF DESCRIPTION OF THE DRAWINGS

[0025] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative work.

[0026] Figure 1 The phenotype of Dendrobium officinale leaves after silencing the DcaWRKY2 gene; wherein, the blank control is the Dendrobium officinale leaves without any treatment, the injection empty vector is the Dendrobium officinale leaves injected with pTRV2-GFP, and the DcaWRKY2 silenced is the Dendrobium officinale leaves injected with pTRV2-GFP-DcaWRKY2 (005780);

[0027] Figure 2 The content of anthocyanins in the leaves of Dendrobium officinale after silencing the DcaWRKY2 gene; wherein, the blank control is the leaves of Dendrobium officinale without any treatment, the injection empty vector is the leaves of Dendrobium officinale injected with pTRV2-GFP, and the silenced DcaWRKY2 is the leaves of Dendrobium officinale injected with pTRV2-GFP-DcaWRKY2 (005780);

[0028] Figure 3 The figure shows the starch content in the leaves of Dendrobium officinale after silencing the DcaWRKY2 gene; the blank control is the leaves of Dendrobium officinale without any treatment, the injection empty vector is the leaves of Dendrobium officinale injected with pTRV2-GFP, and the DcaWRKY2 silenced vector is the leaves of Dendrobium officinale injected with pTRV2-GFP-DcaWRKY2(005780). DETAILED DESCRIPTION

[0029] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as limiting the present invention, but should be understood as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0030] It should be understood that the terms described in the present invention are only for describing a particular embodiment and are not intended to limit the present invention. In addition, for the numerical range in the present invention, it should be understood that each intermediate value between the upper and lower limits of the scope is also specifically disclosed. The intermediate value in any stated value or stated range, and each smaller range between any other stated value or intermediate value in the described range is also included in the present invention. The upper and lower limits of these smaller ranges can be independently included or excluded in the scope.

[0031] Unless otherwise indicated, all technical and scientific terms used herein have the same meanings as those generally understood by those skilled in the art. Although the present invention describes only preferred methods and materials, any methods and materials similar or equivalent to those described herein may also be used in the implementation or testing of the present invention. All documents mentioned in this specification are incorporated by reference to disclose and describe the methods and / or materials associated with the documents. In the event of a conflict with any incorporated document, the content of this specification shall prevail.

[0032] It will be apparent to those skilled in the art that various modifications and variations may be made to the specific embodiments of the present invention description without departing from the scope or spirit of the present invention. Other embodiments derived from the present invention description will be apparent to those skilled in the art. The present invention description and examples are exemplary only.

[0033] The words “include,” “including,” “have,” “contain,” etc. used in this document are open-ended terms, meaning including but not limited to.

[0034] Example 1

[0035]

[0036] Example 2 Silencing the DcaWRKY2 (005780) gene in Dendrobium officinale leaves using virus-induced gene silencing (VIGS) technology

[0037] 1) Total RNA was extracted from the leaves of Dendrobium officinale, reverse transcribed into cDNA, and the 123 bp base sequence of the DcaWRKY2 (005780) gene was selected (in orchid plants, the 123 bp in the CDS sequence of the target gene was constructed into a vector to prove the function of the gene, reference: Hou T, Huang M, Liao Y, et al. Virus-induced gene silencing (vigs) for functional analysis of genes involved in the regulation of anthocyanin biosynthesis in the perianth of phalaenopsis-type dendrobium hybrids [J]. Scientia Horticulturae, 2023, 307: 111485.) Upstream and downstream specific primers were designed, the upstream specific primer is shown in SEQ ID NO.2, specifically: ATGGCCGGGATAGATGACAGT, and the downstream specific primer is shown in SEQ ID NO.3, specifically: TAGGTCAGGAAATGGTCTTGAGCAA; the target sequence was cloned and sequenced to ensure the accuracy of the sequence;

[0038] 2) The 123 bp base sequence of the DcaWRKY2 (005780) gene was constructed by seamless cloning between two restriction sites (BamHI and PSTI) of the plant expression vector pTRV2-GFP, and sequenced to obtain the correct pTRV2-GFP-DcaWRKY2 (005780);

[0039] 3) The constructed expression vector (pTRV2-GFP-DcaWRKY2 (005780) or pTRV2-GFP) was transferred into Agrobacterium GV3101 competent cells, spread on LB (kanamycin 50 μg / mL, rifampicin 25 μg / mL) plates, and inverted in a 28°C incubator for 2-3 days. Single colonies were randomly selected for colony PCR, and the correct Agrobacterium single clones were identified and marked for later use;

[0040] 4) Pick the correct Agrobacterium monoclone and inoculate it into 5 mL of LB liquid culture medium containing kanamycin, shake it at 28°C and 200 rpm for 16-20 hours until the bacterial liquid becomes turbid but not whitish, and obtain the Agrobacterium culture;

[0041] 5) The Agrobacterium culture obtained in step 4) was inoculated into 100 mL LB liquid medium (kanamycin 100 μg / mL, rifampicin 25 μg / mL, MES 10 mM, AS (acetosyringone) 200 μM) at a ratio of 1%, and shaken at 28°C and 200 rpm overnight. 600 =1.8, and centrifuge at 5000 rpm for 10 min to collect the bacteria;

[0042] 6) Suspend the bacteria with Agrobacterium infection buffer (MES 10 mM; AS 100 μM; MgC12 10 mM; sterile water as solvent) and adjust the OD 600 = about 1.0; pTRV1 was mixed with equal volumes of Agrobacterium infection buffer containing pTRV2-GFP (control) and pTRV2-GFP-DcaWRKY2 (005780), and allowed to stand at room temperature (24°C) for 4 h in the dark to obtain the bacterial solution to be injected for later use;

[0043] 7) The specific operation of infection is as follows: select one-year-old Dendrobium officinale leaves, use a syringe to inject the bacterial solution to be injected on the back of the leaves, the amount of the bacterial solution to be injected is about 1 mL / piece, and hang a sign to indicate the important information such as the treatment group in detail, and use the Dendrobium officinale leaves that have not been treated as blank controls;

[0044] 8) After the injection is completed, wrap it with a black plastic bag and shade it from the sun. After 24 hours, remove the shade bag and allow it to grow in a normal environment.

[0045] 9) After about 7 days, the phenotype will appear. Take pictures and check the anthocyanin content. The results are as follows: Figure 1 and Figure 2 As shown, the results showed that the DcaWRKY2(005780) gene affects the synthesis of anthocyanins. Silencing the DcaWRKY2(005780) gene promotes the synthesis of anthocyanins in Dendrobium officinale, thereby affecting the color of Dendrobium officinale and ultimately obtaining red Dendrobium officinale leaves.

[0046] 10) After 7 days, the starch content in the leaves was investigated. Figure 3 As shown, the results showed that the DcaWRKY2(005780) gene affects the accumulation of starch, and silencing the DcaWRKY2(005780) gene will promote the accumulation of starch in Dendrobium officinale.

[0047] It can be seen from the above implementation scheme that the present invention can enrich the transgenic material library for regulating anthocyanin synthesis and starch accumulation in Dendrobium officinale leaves under gravity and microgravity. The present invention can be used to target and regulate the starch content and red trait of Dendrobium officinale leaves through transgenic technology.

[0048] The embodiments described above are only descriptions of the preferred modes of the present invention, and are not intended to limit the scope of the present invention. Without departing from the design spirit of the present invention, various modifications and improvements made to the technical solutions of the present invention by ordinary technicians in this field should all fall within the protection scope determined by the claims of the present invention.

Claims

1. A DcaWRKY2 gene that regulates anthocyanin synthesis and starch accumulation in Dendrobium officinale under microgravity and gravity conditions, characterized in that: The nucleotide sequence of the DcaWRKY2 gene is shown in SEQ ID NO.

1.

2. A biological material containing the DcaWRKY2 gene according to claim 1, characterized in that: The biological material includes a recombinant vector and a recombinant bacterium.

3. Use of the DcaWRKY2 gene according to claim 1 or the biomaterial according to claim 2 in regulating anthocyanin synthesis and / or starch accumulation in Dendrobium officinale, characterized in that: By inhibiting the expression of the DcaWRKY2 gene, anthocyanin synthesis and / or starch accumulation in the Dendrobium officinale are promoted.

4. A method for promoting anthocyanin synthesis and / or starch accumulation in Dendrobium officinale, characterized in that: The method comprises the step of inhibiting the expression of the DcaWRKY2 gene in Dendrobium officinale; the nucleotide sequence of the DcaWRKY2 gene is shown in SEQ ID NO.

1.

5. Use of the DcaWRKY2 gene according to claim 1 or the biomaterial according to claim 2 in cultivating transgenic Dendrobium officinale with high anthocyanin content and / or high starch content, characterized in that: By inhibiting the expression of the DcaWRKY2 gene, the transgenic Dendrobium officinale with high anthocyanin content and / or high starch content is obtained.

6. A method for cultivating transgenic Dendrobium officinale with high anthocyanin content and / or high starch content, characterized in that: The method comprises the steps of inhibiting the expression of the DcaWRKY2 gene in Dendrobium officinale to obtain the transgenic Dendrobium officinale; the nucleotide sequence of the DcaWRKY2 gene is shown in SEQ ID NO.

1.

7. Use of the DcaWRKY2 gene according to claim 1 or the biomaterial according to claim 2 in regulating the color of Dendrobium officinale leaves, characterized in that: By controlling the expression of the DcaWRKY2 gene, Dendrobium officinale with red leaves is obtained.

8. A method for changing the color of Dendrobium officinale leaves, characterized in that: The method comprises the step of inhibiting the expression of the DcaWRKY2 gene in Dendrobium officinale; the nucleotide sequence of the DcaWRKY2 gene is shown in SEQ ID NO.

1.

9. Use of the DcaWRKY2 gene according to claim 1 or the biomaterial according to claim 2 in cultivating transgenic Dendrobium officinale with red leaves, characterized in that: By inhibiting the expression of the DcaWRKY2 gene, a transgenic Dendrobium officinale with red leaves is obtained.

10. A method for cultivating transgenic Dendrobium officinale with red leaves, characterized in that: The method comprises the steps of inhibiting the expression of the DcaWRKY2 gene in Dendrobium officinale to obtain the transgenic Dendrobium officinale; the nucleotide sequence of the DcaWRKY2 gene is shown in SEQ ID NO.1.

Images