VIGS method for agastache rugosus gene function research and application

Abstract

The invention relates to the technical field of plant genetic engineering, and particularly discloses a construction method of a VIGS silencing system for agastache rugosus gene function research, which comprises the following steps: constructing a TRV2-PDS or TRV2-CHLH visual vector by taking indicator genes PDS and CHLH for chlorophyll synthesis as reporter genes; the method comprises the following steps: transforming a TRV2-PDS or TRV2-CHLH visual vector into agrobacterium, and performing injection infection on cotyledons of a target plant to construct a VIGS silencing system. According to the invention, cloning, amplification and vector construction are carried out on the isopuleone isomerase gene (ArIPI gene) in the agastache rugosus, and the function of the ArIPI gene is verified in a plant body, so that a scientific basis is provided for improving and cultivating the agastache rugosus and constructing genetic engineering.

Description

Technical Field

[0001] The invention relates to the technical field of genetic engineering, and in particular to a VIGS silencing system for studying the gene function of Patchouli sinensis, a construction method and an application thereof. Background Art

[0002] Virus-induced gene silencing (VIGS) is a rapid and simple forward and reverse genetics method for identifying gene function by inhibiting the expression of endogenous plant genes through virus infection, thereby causing corresponding changes in the phenotype or physiological shape of the plant. VIGS gene silencing technology has the advantages of low cost, short experimental cycle, high-efficiency expression, simple operation steps, fast phenotype appearance and high throughput. It is a commonly used technology to study the function of plant genes. The efficiency of VIGS is affected by environmental factors, viral vectors, inserted gene fragments and other factors. It is necessary to further optimize the VIGS conditions to improve the VIGS silencing efficiency and expand the application of VIGS.

[0003] Tobacco Rattle Virus (TRV) has the advantages of high viral infection rate, long silencing time, no typical viral traits, and easy transformation. It is currently the most widely used and effective VIGS viral vector in plants. Phytoene dehydrogenase (PDS) is involved in catalyzing the conversion of colorless phytoene into colored carotenoids. When this gene is silenced, photobleaching will occur. Magnesium ion chelate (CHLH) is involved in the synthesis of plant chlorophyll. When this gene is silenced, yellowing will occur. Therefore, these two genes are widely used as reporter genes and are widely used in VIGS silencing systems.

[0004] Patchouli is derived from the dried aerial parts of Agastache rugosa (Fisch. et Mey.) O.Ktze., a plant of the genus Patchouli in the family Lamiaceae. It is pungent in taste and slightly warm in nature, and enters the spleen, lung, and stomach meridians. It has the effects of dispelling heat and relieving exterior symptoms, removing dampness and harmonizing the stomach, and is mainly used to treat summer-heat colds, heatstroke, chest tightness, abdominal pain, vomiting, and diarrhea. Other names include native Patchouli, Douloupoxiang, and Su Patchouli. Patchouli is a traditional Chinese medicine with a long history of use. Volatile oil is the basis of the active substances of Patchouli and has a wide range of pharmacological activities. The research on the change law and molecular regulation mechanism of the main active substances of Patchouli is relatively weak. In order to ensure the quality of Patchouli medicinal materials, it is necessary to clarify the biosynthetic pathway of the main active ingredients of Patchouli from the perspective of molecular biology. Therefore, it is urgent to develop a system construction method for studying the function of genes in Patchouli. Summary of the invention

[0005] Purpose of the invention: The purpose of the present invention is to obtain a low-cost, short-experimental cycle, high-efficiency expression VIGS silencing system for the study of gene function in Agastache rugosa, as well as a construction method and application. The present invention first forms a TRV2-ArPDS or TRV2-ArCHLH visualization vector, and constructs a VIGS silencing system by injecting and infecting the cotyledons of the target plant. A TRV2-target gene interference vector is constructed, and the function of the target gene is identified by injecting and infecting the cotyledons of the target plant.

[0006] Technical solution: The present invention provides a method for constructing a VIGS silencing system, comprising the following steps:

[0007] Construction of visualization TRV2-ArPDS or TRV2-ArCHLH vector:

[0008] Using the cDNA of Patchouli as a template, using the nucleotide sequences such as ArPDS-F and ArPDS-R shown in SEQ ID NO.1-2 or the nucleotide sequences such as ArCHLH-F and ArCHLH-R shown in SEQ ID NO.4-5 as primers to perform PCR amplification to obtain the ArPDS or ArCHLH fragment;

[0009] Insert the amplified gene ArPDS or ArchLH fragment into the EcoRI and BamHI sites of the TRV2 plasmid to form a TRV2-PDS or TRV2-CHLH visualization vector;

[0010] After the TRV2-PDS or TRV2-CHLH visualization vector was transformed into Agrobacterium, the cotyledons of the target plants were injected and infected to construct a VIGS silencing system;

[0011] The target plant is a Patchouli plant;

[0012] The target gene is any gene that needs to be traced in the target Patchouli plant.

[0013] Furthermore, target genes include but are not limited to ArIPI.

[0014] Furthermore, the injection site is the back side of the cotyledon of the plant seedling.

[0015] The target gene of the present invention is selected from any gene of Patchouli.

[0016] Furthermore, the target gene is the ArIPI gene, and the interference vector is TRV2-ArIPI.

[0017] The present invention also provides a method for constructing the TRV2-ArIPI interference vector, and the construction steps are as follows:

[0018] Using the cDNA of Agastache rugosa as a template, PCR amplification was performed using primers ArIPI-F and ArIPI-R with nucleotide sequences as shown in SEQ ID NO.7-8 to obtain the target fragment ArIPI;

[0019] The amplified ArIPI gene fragment was inserted into the EcoRI and BamHI sites of the TRV2 plasmid to form the TRV2-ArIPI vector, i.e., the interference vector.

[0020] The present invention also provides application of the interference vector in the construction of the Patchouli VIGS silencing system, and the Patchouli VIGS silencing system is used for the identification of gene functions of Patchouli plants.

[0021] Beneficial effects:

[0022] The present invention obtains a VIGS silencing system and construction method for studying the gene function of Patchouli with low cost, short test cycle and high expression efficiency. The present invention first forms a TRV2-ArPDS or TRV2-ArCHLH visualization vector, and constructs a VIGS silencing system by injecting and infecting the cotyledons of the target plant. In addition, the present invention also constructs a TRV2-target gene interference vector, and identifies the function of the target gene by injecting and infecting the cotyledons of the target plant. The system of the present invention can identify the function of the target gene and screen out the target gene, which can provide a scientific basis for improving the quality of medicinal materials such as Patchouli and the content of effective ingredients. BRIEF DESCRIPTION OF THE DRAWINGS

[0023] Figure 1 Agarose gel electrophoresis diagrams of the silencing fragments. A is ArPDS, B is ArCHLH, and C is ArIPI.

[0024] Figure 2 A is a picture of plants infected with VIGS of Agastache rugosa. A is the wild type group, B is the negative control (pTRV2-pTRV1), C is the positive control (pTRV2-ArPDS), and D is the positive control (pTRV2-ArCHLH).

[0025] Figure 3 To detect the expression levels of ArPDS and ArchLH genes.

[0026] Figure 4 The phenotypic changes of leaves after ArIPI gene silencing and the expression level detection of genes related to the metabolism of menthane-type monoterpene pathway. 1 is the negative control (pTRV2), 2 is the experimental group (pTRV2-ArIPI), 3 is the positive control (pTRV2-ArPDS), and 4 is the positive control (pTRV2-ArCHLH).

[0027] Figure 5The metabolic level of menthane-type monoterpenes after ArIPI gene silencing. A is limonene, B is isopulegone, and C is pulegone. DETAILED DESCRIPTION

[0028] The specific embodiments of the present invention are described in detail below, but it should be understood that the protection scope of the present invention is not limited by the specific embodiments. Based on the embodiments in the present invention, all other embodiments obtained by ordinary technicians in this field without creative work belong to the scope of protection of the present invention. The experimental methods described in the embodiments of the present invention are conventional methods unless otherwise specified, and the materials, reagents, etc. used in the following embodiments can be obtained from commercial channels unless otherwise specified.

[0029] Example 1

[0030] The target gene used in the embodiment of the present invention is: isopulegone isomerase gene (ArIPI gene) in Patchouli.

[0031] 1. The construction of the Patchouli VIGS system includes the following steps:

[0032] 1.1 Cloning and recombinant plasmid construction of ArPDS and ArCHLH

[0033] Primers ArPDS-F and ArPDS-R were designed based on the ArPDS gene of Patchouli (as shown in SEQ ID NO.1, the ArPDS fragment is SEQ ID NO.1):

[0034] The primers for ArPDS-F are:

[0035] 5'-cgtgagctcggtaccggatccCCGGATGAGCTTTCGATGC-3;

[0036] The primers for ArPDS-R are:

[0037] 5'-gtgagtaaggttaccgaattcATCATACGTGTTTTTCAGTTTTCTGTC-3';

[0038] The PCR reaction was carried out using the cDNA of Patchouli as a template, and the 10μ reaction system was: ddH2O (3.2μL), ArPDS-F, ArPDS-R (0.4μL), 2×Rapid Taq Master Mix (5μL), cDNA (1μL). The reaction procedure was: 95℃ pre-denaturation for 3min, 95℃ denaturation for 15s, 60℃ annealing for 15s, 72℃ extension for 1min, 72℃ extension for 5min after 35 cycles, and stored at 4℃. The obtained ArPDS fragment (nucleotide sequence such as SEQ ID NO.3) was inserted into the EcoRI and BamHI sites of the TRV2 plasmid by homologous recombination to form a TRV2-ArPDS visualization vector, which was used as an indicator gene.

[0039] Primers ArchLH-F and ArchLH-R were designed based on the Agastache rugosa ArchLH gene (shown in SEQ ID NO.2, the ArchLH fragment is SEQ ID NO.2):

[0040] The primers for ArCHLH-F are:

[0041] 5'-cgtgagctcggtaccggatccGGATGATTGGAGTTACACCGGT-3';

[0042] The primers for ArCHLH-R are:

[0043] 5'-gtgagtaaggttaccgaattcTCGAACGCAAACGACTTTCTG-3';

[0044] The cDNA of Patchouli was used as a template for PCR reaction. The 10μ reaction system included ddH2O (3.2μL), ArchLH-F, ArchLH-R (0.4μL), 2×Rapid Taq Master Mix (5μL), and cDNA (1μL). The reaction procedure was as follows: pre-denaturation at 95℃ for 3min, denaturation at 95℃ for 15s, annealing at 60℃ for 15s, extension at 72℃ for 1min, extension at 72℃ for 5min after 35 cycles, and storage at 4℃. The obtained ArchLH fragment (nucleotide sequence as SEQ ID NO.6) was inserted into the EcoRI and BamHI sites of the TRV2 plasmid by homologous recombination to form a TRV2-ArCHLH visualization vector, which was used as an indicator gene.

[0045] 1.2 Infected plants

[0046] Streak the Agrobacterium culture containing TRV1, TRV2, TRV2-ArPDS visualization vector, and TRV2-ArCHLH visualization vector on LB solid medium (containing 50ug / mL kan, 20ug / mL Rif), pick a single colony for colony PCR, take the corresponding positive colony in LB liquid medium (50ug / mL kan, 20ug / mL rif), and culture it in a shaker at 28°C and 200rpm / min until OD600 is about 1.0; take the corresponding bacterial solution and centrifuge it at 5000rpm for 10min, discard the supernatant, and collect each bacteria; resuspend the bacteria with the freshly prepared infection resuspension solution to make each OD value about 1.0.

[0047] The TRV1 bacterial solution was mixed with the TRV2 bacterial solution, TRV2-ArPDS bacterial solution, and TRV2-ArCHLH bacterial solution in equal volumes, and then the activated mixed resuspension was slowly injected into the lower epidermis of the leaves using a 1 mL sterile syringe without a needle until the entire leaf was infiltrated. The inoculated Agastache rugosa seedlings were then cultured in a dark environment at 25°C for about 24 hours, and then placed in a light incubator with a day / night temperature of 25°C / 20°C, a light / dark cycle of 16h / 8h, a light intensity of 10,000lx, and watered once every 3-4 days for continuous culture, and observed whether yellowing or albino phenotypes appeared after 1-2 weeks of silence.

[0048] The RNA of the leaves of Agastache rugosa plants after virus-induced silencing was extracted, and the relative expression levels of ArPDS and ArCHLH genes in the leaves of the negative control group and the positive control group were detected by qRT-PCR. The upstream primers of ArPDS qPCR were: CATGGGTCACAAGTTGGGGA and the downstream primers of ArPDS qPCR were: GGCTTGTTTGGACGGGGATA, and the upstream primers of ArCHLH qPCR were:

[0049] GCCGAGTGCATACATTGCAG

[0050] The downstream primers for qPCR of ArCHLH are: ATTGTCGACCTGCCCTGAAG

[0051] , ArIPI qPCR upstream primer: CCAACGAGTGTGTCACCAGA

[0052] and ArIPI qPCR downstream primers: ACGTAGAGGGGCATAGACGA

[0053] ArACTIN was used as the internal reference gene. The upstream primer of ArACTIN qPCR was GTACGACAGGTATCGTTATGGA and the downstream primer of ArACTIN qPCR was ACCAGCAAGATCCAACCTCAA. The above operation was repeated once for each of the three positive clones of each gene to form three biological replicates. The PCR reaction system was 2×ChamQ Universal STBR qPCR MasterMix 5μL, 0.2μL of upstream and downstream primers, 1μL of cDNA, and 3.6μL of RNase-free ddH2O. The reaction procedure is: pre-denaturation: 50℃ for 2min, 95℃ for 3min; cycle reaction: 95℃ for 10s, 60℃ for 30s, 95℃ for 15s, 40 cycles, 3 technical replicates for all samples. In order to determine whether the fluorescence quantitative amplification is specific, a melting curve analysis is performed after amplification. The procedure is as follows: gradually increase the temperature from 60℃ to 95℃, read once every 0.5℃, each time for 5s, and continuously record the changes in the fluorescence signal. The experimental data are recorded as 2 -ΔΔCT The relative expression of genes was analyzed by the calculation method. Figure 2 As shown in the figure, 14 days after infection with Patchouli, the control groups A and B showed no phenotypic changes, while the positive groups C and D showed phenotypic changes of albinism and yellowing, respectively. The silencing efficiency of both ArPDS and ArCHLH was 75%. The expression results were shown in the figure. Figure 3 As shown, the inhibition effect of ArPDS and ArchLH genes was obvious, and the inhibition efficiency was as high as over 70%, indicating that the VIGS system of Patchouli sinensis was successfully constructed.

[0054] 2. VIGS Function Verification of ArIPI Gene

[0055] 2.1 Cloning of the target gene ArIPI fragment:

[0056] Primers ArIPI-F and ArIPI-R were designed based on the Agastache rugosa ArIPI gene (shown in SEQ ID NO.3): the primer of ArIPI-F is:

[0057] 5'-gtgagtaaggttaccgaattcTTCACTCCTCCTCCGCTCA-3

[0058] The primers for ArIPI-R are:

[0059] 5'-cgtgagctcggtaccggatccATGTTGGGAAGAGTCTCAGAGGAA-3';

[0060] According to the TRV2-ArPDS visualization vector PCR and recombination method described in "1.1", the Agastache rugosa TRV2-ArIPI interference vector was formed.

[0061] 2.2 Infection of plants

[0062] The TRV1 bacterial solution and the TRV2-ArIPI expression bacterial solution were mixed in equal volumes, and then the leaves of Agastache rugosa were infiltrated according to the method of "1.2". The relative expression levels of the genes related to the metabolism of the menthane-type monoterpene pathway, limonene synthase gene (ArLS), limonene hydroxylase (ArL3OH), isomenthenol dehydrogenase gene (ArISPD), isomenthenone reductase gene (ArIPR), isopulegone isomerase (ArIPI) and pulegone reductase (ArPR) were detected by qRT-PCR (the method is the same as "1.2"). The upstream primers of ArLS qPCR are: CGACTCTCTGTACGAATACCAC and the downstream primers of ArLS qPCR are: TCATCTTCTTCCACATCTCTCT, and the upstream primers of ArL3OH qPCR are: TCTGGTCCATGGGAAGGGAT and

[0063] ArL3OH qPCR downstream primers are: GAGCCATCGGAACCTCAACA,

[0064] The upstream primers for ArISPD qPCR were: CGCTTCCAACTTGACGGACT and

[0065] The downstream primers for ArISPD qPCR are: GCGACACGCAGTTAACCCTA,

[0066] The upstream primers for ArIPR qPCR were: GGATGGGACACACGGGATTT and

[0067] The downstream primers of ArIPR qPCR are: TGCAGCGATTTTGGAGGGAT,

[0068] ArPR qPCR upstream primer: ACGAAGGCGACCTAGTTTGG

[0069] and ArPR qPCR downstream primers were: AGCATATGCCGTCATCCCAG.

[0070] The volatile oil of the first pair of leaves 14 days after infection with Patchouli was extracted by tissue grinding, and the metabolic level of menthane-type monoterpenes in Patchouli leaves after ArIPI gene silencing was detected by gas chromatography. Take 0.4g of Patchouli leaves from the same part, add 0.8mL of camphor internal standard solution, add 4 steel balls and grind in a tissue grinder (60HZ, 60s), then centrifuge at 12,000r / min for 5 minutes, add an appropriate amount of anhydrous sodium sulfate and centrifuge again at 12,000r / min for 1 minute, take the supernatant and filter through a 0.22μm organic filter membrane to obtain the sample. Each sample was repeated three times. The gas phase program is as follows: Gas chromatography conditions are as follows: Agilent 19091S-433HP-5ms capillary column (250μm×30m×0.25μm), programmed temperature conditions: start at 50°C, hold for 3min, increase to 90°C at a rate of 3°C / min, increase to 150°C at a rate of 5°C / min, increase to 220°C at a rate of 10°C / min, hold for 5min; the injection port temperature is 250°C; the carrier gas is nitrogen; the volume flow rate is 1.0mL / min; the injection volume is 1μL; no splitting.

[0071] The expression results are as follows Figure 4 As shown, in the Patchouli plants with ArIPI gene silencing, the expression level of the target gene ArIPI was reduced, and the genes related to the metabolism of the menthane-type monoterpene pathway, ArLS, ArIPI, and ArPR, decreased by about 50%, 51%, and 24%, respectively, compared with the negative control group, while ArL3OH, ArISPD, and ArIPR increased by nearly 64%, 133%, and 51%, respectively, indicating that in the ArIPI gene-silenced plants, the transcription process of these genes was more or less affected to a certain extent, resulting in changes in mRNA abundance.

[0072] Metabolic level changes Figure 5 As shown, the peak areas of limonene and pulegone in the experimental group (pTRV2-ArIPI) decreased by about 39% and 37% respectively compared with the negative control group (pTRV2), while the peak area of ​​isopulegone increased by nearly 43%. Since the leaves taken were in the early stage of growth and development of Patchouli, the total products menthone and isomenthone were not detected. This shows that silencing the ArIPI gene in Patchouli will cause a certain accumulation of its expected substrate isopulegone, but it also causes a decrease in the product pulegone, and a corresponding decrease in limonene in the Patchouli-menthane type monoterpene pathway. The above results show that this system can be used to study the verification of the gene function of Patchouli. It can be convenient for the subsequent establishment of genetic engineering to increase the content of related active ingredients.

[0073] The above description is only a preferred embodiment of the present invention, which is only illustrative and not restrictive of the present invention. Those skilled in the art understand that many changes, modifications, and even equivalences may be made to the present invention within the spirit and scope defined by the claims of the present invention, but all of them will fall within the scope of protection of the present invention.

Claims

1. A method for constructing a VIGS silencing system for studying the gene function of Patchouli, characterized in that: The steps include: Construction of visualization vector TRV2-PDS or TRV2-CHLH: Using cDNA of Patchouli as a template and using nucleotide sequences such as ArPDS-F and ArPDS-R or nucleotide sequences such as ArCHLH-F and ArCHLH-R as primers, PCR amplification is performed to obtain ArPDS or ArCHLH fragments; Insert the amplified gene ArPDS or ArchLH fragment into the EcoRI and BamHI sites of the TRV2 plasmid to form a TRV2-PDS or TRV2-CHLH visualization vector; After the TRV2-PDS or TRV2-CHLH visualization vector was transformed into Agrobacterium, the cotyledons of the target plants were injected and infected to construct a VIGS silencing system.

2. The method for constructing the VIGS silencing system according to claim 1, characterized in that: The nucleotide sequences of the ArPDS and ArchLH genes are shown in SEQ ID NO.1 and SEQ ID NO.2, respectively.

3. The method for constructing the VIGS silencing system according to claim 1, characterized in that: The injection infection site is the back of the cotyledons of the plant seedlings.

4. An interference vector, characterized in that: The interference vector is TRV2-ArIPI, and the target gene is the isopulegone isomerase gene (ArIPI gene), and its nucleotide sequence is shown in SEQ ID NO.

3.

5. The method for constructing the interference vector according to claim 4, characterized in that: The construction steps are as follows: Using cDNA of Agastache rugosa as template, PCR amplification was performed with primers of nucleotide sequences such as ArIPI-F and ArIPI-R to obtain the target fragment ArIPI; The amplified ArIPI gene fragment was inserted into the EcoRI and BamHI sites of the TRV2 plasmid to form the TRV2-ArIPI vector, i.e., the interference vector.

6. Use of the interference vector described in claim 4 in screening and verifying target genes in the construction of the Patchouli VIGS silencing system.

7. Application of the VIGS silencing system constructed by the method of any one of claims 1 to 3 in screening and identifying the gene functions of Patchouli sinensis.

Images