Rapid detection method, kit and system for group B streptococcus

Abstract

The invention discloses a rapid detection method, kit and system for group B streptococcus. The group streptococcus rapid detection kit comprises an LAMP mixed solution and a CRISPR / Cas12b mixed solution for detecting the group B streptococcus cfb gene. The method has the advantages of extraction-free detection, high sensitivity and rapidness.

Description

Technical Field

[0001] The present invention relates to the field of medical devices, and more specifically, to a POCT detection device for in vitro diagnosis of pathogens. Background Art

[0002] Group B Streptococcus (GBS) is the main pathogen causing neonatal infection. GBS colonization in the digestive tract and urogenital tract of pregnant women is the main risk factor for early-onset GBS disease (GBS-EOD) in newborns. About 50% of pregnant women colonized with GBS will transmit the bacteria to their newborns. If prophylactic intravenous antibiotics are not used during delivery, 1% to 2% of newborns will develop GBS-EOD. The current "Expert Consensus on Prevention of Perinatal Group B Streptococcal Disease (China)" recommends GBS screening for all pregnant women between 35 and 37 weeks of gestation.

[0003] Single-line NAAT is short (1-2 hours) and can be used for immediate testing during labor for pregnant women who have not undergone GBS screening. However, the sensitivity of conventional NAAT methods represented by quantitative polymerase chain reaction (qPCR) is still insufficient. In the absence of bacterial culture, the detection failure rate is 7% to 10%. More importantly, qPCR usually requires 1 hour of nucleic acid extraction and 1.5-2 hours of thermal cycling nucleic acid amplification. In clinical practice, especially in the case of premature labor, the detection time still cannot guarantee the results before the fetus is delivered.

[0004] When using LAMP detection technology alone for GBS screening, since dyes are used as the color development method for the final test results, the results of LAMP can only be interpreted as amplification or non-amplification. Once non-specific amplification occurs, it is difficult to distinguish. And due to the particularity of its primer design, it has low applicability and strong sensitivity, and is particularly prone to forming aerosols, causing false positives that affect the test results. When using a single CRISPR detection technology for GBS screening, since the samples to be tested are not amplified by nucleic acid, the detection sensitivity is reduced, there may be off-target effects, resulting in false detection and missed detection, and the detection time will also be prolonged. Only by combining the two reasonably can the best detection effect be achieved. In addition, studies have shown that many infants with severe GBS infection are premature before the recommended screening time, and there are higher requirements for rapid bedside determination. Therefore, a more efficient and rapid GBS detection kit is needed to better deal with GBS results that have not been returned at the time of delivery, clarify the GBS colonization situation in a very short time (1h), help clinically prevent neonatal GBS infection, and avoid toxic and side effects caused by the abuse of antibiotics, the emergence of drug-resistant pathogens, superinfection or cross-infection, and low immunity. Summary of the invention

[0005] The purpose of the present invention is to address the deficiencies in the prior art and to propose a rapid group B streptococcus (GBS) detection method, kit and detection device based on loop-mediated isothermal amplification (LAMP) technology, CRISPR / Cas12b (Clustered Regularly Interspaced Short Palindromic Repeats-Cas12b) technology and nucleic acid extraction-free technology.

[0006] A rapid detection kit for group B streptococcus, comprising:

[0007] I: LAMP mixture for detecting the cfb gene of group B streptococci, wherein the LAMP primer targets the conserved sequence on the cfb gene of group B streptococci encoding the specific hemolytic pathogen cAMP factor; II: CRISPR / Cas12b mixture, which contains the crRNA shown in SEQ ID NO.7, and the ssDNA fluorescent reporter molecule: 5′-FAM-TTATT-BHQ1-3′. The crRNA is designed based on the sequence of the LAMP amplification product, and is near the PAM site (TTN), and avoids complementary pairing with LAMP, resulting in false positive results. The ssDNA reporter molecule is specifically designed based on the trans-cleavage base preference of Cas12b, and the fluorescent group FAM is added to the 5′ end, and the fluorescent quenching group BHQ1 is added to the 3′ end.

[0008] As a preferred embodiment of the present invention, the kit further comprises a DNA rapid release liquid system; the DNA rapid release liquid system is composed of 0.8% to 1.2% (g / ml) of sodium hydroxide, 1% to 1.2% (W / V) of SDS, 1% to 1.2% (V / V) of Tween 20 and enzyme-free sterile water.

[0009] As a preferred embodiment of the present invention, the LAMP mixture contains the following six specific primers:

[0010] LF 5′-ATCATATGTGTAACGTTCAT-3′ (SEQ ID NO. 1),

[0011] LB 5′-TGTATTAGAAGTACATGCTG-3′ (SEQ ID NO. 2),

[0012] F35′-GCCCTGTAAATTAAAAATACTGC-3′ (SEQ ID NO.3),

[0013] B35′-GCTTTTGAGCCATTTGCT-3′ (SEQ ID NO.4),

[0014] FIP 5′-AGCCACTAGAGTTCCAGATAGATAC-AGAAGTGATTTTAGTTTAA AGGAGG-3′(SEQ IDNO.5)

[0015] BIP 5′-GGTGCATTGTTATTTTCACCAGC-CTATTTACATGATTTACCACTT GTG-3′(SEQ IDNO.6)

[0016] As a preferred embodiment of the present invention, the LAMP mixed solution is composed of: 1× isothermal amplification buffer, 7-10 mM MgSO 4 , 1-1.5 mM of each dNTP, 4-5 U of Bst DNA polymerase, wherein the molar concentration of each primer is as follows: the molar concentration of F3 and B3 is 0.1-0.3 μM, the molar concentration of FIP and BIP is 1.5-1.8 μM, and the molar concentration of LF and LB is 0.3-0.5 μM.

[0017] As a preferred embodiment of the present invention, the CRISPR / Cas12b mixed solution consists of 180-200nM ApCas12b, 350-420nM crRNA, 900-1100nM ssDNA fluorescent reporter molecule and 1×NEB r3.1 buffer.

[0018] The present invention also discloses a system for rapid detection of group B streptococci, comprising the group B streptococcus rapid detection kit and group B streptococcus detection device described in the present invention, wherein the detection device comprises a housing, a constant temperature incubation module, a power module, and a fluorescence analysis module, and the housing comprises a main body and a top cover. The top cover is detachable and is used to detect the addition of samples, which are placed in an internal test tube rack. The power module is composed of batteries to power the constant temperature incubation module and the fluorescence analysis module. The constant temperature incubation module is composed of a PTC heating film to meet the detection requirements of molecular diagnostics. The fluorescence analysis module is composed of a filter module and an optical module, and the lens focuses the light and evenly distributes it in the inner cavity of the entire device, excites fluorescence, and reads the fluorescence information through the filter module.

[0019] Furthermore, the shell is in a rectangular box shape, including a main body and a top cover, and the shell dimensions are specifically 80mm*68mm*70mm in length, width and height.

[0020] Furthermore, the size of the top cover is 13mm*33mm*80mm, and the connection between the top cover and the main body is completed by multiple groups of evenly distributed neodymium magnets.

[0021] Furthermore, the heating module is covered with an internal test tube rack, which is evenly distributed on a rectangular plate with a length of 80 mm and a width of 33 mm, and has a total of 7 test tube holes with a diameter of 6.8 mm.

[0022] Furthermore, the constant temperature incubation module is composed of a PTC heating plate with a rated power of 0.5 to 1.5 W, a maintainable temperature of 60±2° C., and a length of 61 mm*25 mm*3 mm.

[0023] Furthermore, the power module is composed of three 1.5V batteries.

[0024] Furthermore, the fluorescence analysis module is composed of a filter module and an optical module.

[0025] Furthermore, the filter module is composed of an amber filter, the filtering wavelength is 460-480nm, and the filtering wavelength is more preferably 470nm, and its size is 57mm in length, 14mm in width, and 5mm in height.

[0026] Furthermore, the optical module includes an optical lamp group and a lens module. The optical lamp group is composed of an LED lamp with a wavelength of 460-470nm, and the lens module is composed of a lens with a diameter of 16 mm, a focal length of 3 mm, a working distance of 3 mm and a numerical aperture of 0.7 mm.

[0027] The beneficial effects of the present invention are:

[0028] Extraction-free detection, rapid release of Group B Streptococcus DNA can achieve the same detection effect as DNA extraction. And because the components of the stock solution are discarded by repeated centrifugation, it can show advantages in detecting low-copy samples.

[0029] High sensitivity: After LAMP amplification, CRISPR / Cas12b trans-cleavage assay is performed to amplify the signal a second time to reach the single copy level, meeting the clinical sensitive detection needs.

[0030] Fast, from sampling to observing results, the entire operation process can be controlled within 45 minutes, especially to meet the emergency testing needs of obstetrics and gynecology. BRIEF DESCRIPTION OF THE DRAWINGS

[0031] Figure 1 This is a schematic diagram of the structure of the detection device in the present invention.

[0032] 101 main body, 102 top cover, 103 rubidium magnet, 104 test tube rack, 105 constant temperature incubation switch, 106 fluorescence analysis switch, 201 filter, 203 lens, 204 LED light source, 301 constant temperature incubation heating film, 401 power supply.

[0033] Figure 2 This is the buffer test diagram of the present invention

[0034] Figure 3 This is the system optimization test diagram in the present invention

[0035] Figure 4 This is the sensitivity test diagram of the present invention

[0036] Figure 5 It is the detection time diagram of the present invention

[0037] Figure 6 This is the test diagram of the extraction-free method in the present invention DETAILED DESCRIPTION

[0038] The specific implementation of the detection device of the present invention is described below in conjunction with the accompanying drawings:

[0039] Example 1: Rapid Group B Streptococcus (GBS) Detection Method, Kit and Detection Device for Obstetrics

[0040] The kit includes: a rapid group B streptococcus (GBS) detection kit for obstetrics, characterized by comprising:

[0041] LAMP amplification primers:

[0042] LF: 5′-ATCATATGTGTAACGTTCAT-3′

[0043] LB: 5′-TGTATTAGAAGTACATGCTG-3′

[0044] F3: 5′-GCCCTGTAAATTAAAAATACTGC-3′

[0045] B3: 5′-GCTTTTGAGCCATTTGCT-3′

[0046] FIP: 5′-AGCCACTAGAGTTCCAGATAGATAC-AGAAGTGATTTTAGTTTA AAGGAGG-3′

[0047] BIP: 5′-GGTGCATTGTTATTTTCACCAGC-CTATTTACATGATTTACCACT TGTG-3′

[0048] CRISPR-specific detection of crRNA:

[0049] crRNA: 5′-GUCUAGAGGACAGAAUUUUUCAACGGGUGUGCCAAUGG CCACUUUCCAG GUGGCAAAGCCCGUUGAGCUUCUCAAAUCUGAGAAG UGGCACCCACAAGTGGTAAA TCATGT-3′

[0050] ssDNA reporter: 5′-FAM-TTATT-BHQ1-3′

[0051] The rapid group B streptococcus (GBS) detection device for obstetrics is as follows

[0052] Schematic diagram of the structure of the rapid group B streptococcus (GBS) detection device for obstetrics ( Figure 1 ), including a housing 1, a fluorescence analysis module 2, and a filter module 3. The housing 1 is a rectangular box, and includes a main body 101; 102-top cover; neodymium magnet 103; 104-test tube rack; 105 constant temperature incubation switch; fluorescence analysis switch 106, and the fluorescence analysis module 2 and the constant temperature incubation module 3 are arranged under the top cover.

[0053] The housing is made of The device was drawn using 2016 software and printed using FDM (Fused Deposition Modeling) technology. The material is black PLA (Polylactic Acid). The length, width and height of the entire device are 80mm*68mm*70mm, and it is divided into a main body and a top cover. Multiple sets of evenly distributed neodymium magnets are used between the two to make the separated parts of the device fit more tightly and more integrated.

[0054] The constant temperature incubation module 3 is composed of a constant temperature incubation heating film 301, which is made of a high molecular PTC composite material of graphene and carbon nanotubes, and can maintain a relatively stable temperature under an external stable voltage. The heating film is under the test tube rack so that it can fit with the test tube rack 104. The heating film is powered by a power supply 401 and controlled by a constant temperature incubation switch 105, thereby meeting the temperature requirements of molecular detection.

[0055] The fluorescence analysis module 2 is composed of a filter 201, a lens 203, and an LED light source 204. The filter 201 filters a wavelength of 470 nm, is 57 mm long, and is 14 mm wide. It is embedded in the 3D printed body 101. The lens 203 is a lens with a diameter of 16 mm, a focal length of 3 mm, a working distance of 3 mm, and a numerical aperture of 0.7 mm. It focuses the light and evenly distributes it in the inner cavity of the entire device. The LED light source 204 is an optical lamp group with a light wavelength of 462 nm, a rated voltage of 4.5 V, and a rated power of 1 W.

[0056] The power module 4 is provided with a power source 401 which is three 1.5V batteries.

[0057] Example 2

[0058] A rapid detection kit for group B streptococcus, comprising:

[0059] I: DNA rapid release liquid system, specifically, a 500 μL system including sodium hydroxide (1% g / ml), SDS (1% W / V), Tween 20 (1% V / V) and enzyme-free sterile water.

[0060] II: LAMP mixture for detecting the cfb gene of group B streptococci, the LAMP mixture specifically comprises 1× isothermal amplification buffer, 8mM MgSO4, 1.4mM of each dNTP, and 4U Bst 2.0WarmStart DNA polymerase. The molar concentration of each primer is as follows: the molar concentration of F3 and B3 is 0.2μM, the molar concentration of FIP and BIP is 1.6μM, and the molar concentration of LF and LB is 0.4μM. The sequences of LAMP primers are: LF: SEQ ID NO.1, LB: SEQ ID NO.2, F3: SEQ ID NO.3, B3: SEQ ID NO.4, FIP: SEQ ID NO.5, BIP: SEQ ID NO.6.

[0061] III: 2×CRISPR / Cas12b mixture, which contains crRNA shown in SEQ ID NO.7 and ssDNA fluorescent reporter molecule: 5′-FAM-TTATT-BHQ1-3′. The 2×CRISPR / Cas12b mixture specifically includes 200nM ApCas12b, 400nM crRNA, 1000nM ssDNA reporter and 1×NEB r3.1 buffer.

[0062] Example 3

[0063] The method for rapid detection of Group B Streptococcus (GBS) using the detection device of Example 1 in combination with the kit of Example 2 is as follows:

[0064] (1) Sample collection and nucleic acid release

[0065] Fold the collected standard vaginal and rectal swabs from the parturient into 500 μL B group cocci DNA rapid release solution, and shake them manually or on a vortex shaker for 2 minutes. In the alkaline environment provided by sodium hydroxide, SDS and Tween 20 are used as surfactants to lyse the bacteria and release the internal DNA, completely lysing and releasing the DNA.

[0066] (2) LAMP nucleic acid amplification reaction

[0067] Take 1 μL of the sample DNA released from the previous step, add 5 μL of 1×LAMP mixture and 4 μL of enzyme-free sterile water, put into the centrifuge to mix the system, open the top cover 102 of the detection device, put the system mixed ep tube into the test tube hole of the test tube rack 104, put the top cover 102 back and connect it to the main body 101 through the neodymium magnet 103, turn on the constant temperature incubation switch 105, the PTC resistance value in the heating film increases with the increase of temperature, and the current is controlled by the signal fed back by the temperature sensor, thereby adjusting the heat generated by the internal resistance of the heating film to keep the heating film at a constant temperature of 60°C. Incubate at 60°C for 30 minutes, and under the action of the chain displacement DNA polymerase (Bst DNA polymerase), the gene template, primer, dNTPS, etc. complete the LAMP reaction to achieve nucleic acid amplification.

[0068] (4) CRISPR detection reaction

[0069] Prepare 2×CRISPR / Cas12b mixed solution, add 10μL2×CRISPR / Cas12b mixed solution to the LAMP reaction product, put it into the centrifuge to mix the system, open the top cover 102 of the detection device, put the system mixing ep tube into the hole of the test tube rack 104, put the top cover 102 back and connect it to the main body 101 through the neodymium magnet 103, turn on the constant temperature incubation switch 105, the PTC resistance value in the heating film increases with the increase of temperature, and the current is controlled by the signal feedback from the temperature sensor, thereby adjusting the heat generated by the internal resistance of the heating film to keep the heating film at a constant temperature of 60°C. Incubate at 60°C for 10 minutes, crRNA and Cas12b protein form a complex, crRNA binds to the target sequence, stimulates Cas12b enzyme activity, and cuts the target sequence and ssDNA reporter molecules.

[0070] (5) Interpretation of test results

[0071] When Cas12b recognizes the target DNA sequence by combining with crRNA, the trans-cleavage activity is activated, cutting the ssDNA reporter molecule, causing the fluorescent group to separate from the quenching group and emit fluorescence. After the CRISPR reaction ends, turn on the fluorescence analysis switch 106, the LED light source 204 emits a blue light source, and the 203- lens focuses the light and evenly distributes it in the inner cavity of the whole device, stimulating the CRISPR reaction system to emit green fluorescence, and the filter 201 filters the blue light excitation light of 470nm. If it is green, it is detected by group B streptococcus (GBS) through the filter 201, and if there is no fluorescence, group B streptococcus (GBS) is not detected.

[0072] Example 4

[0073] The method for rapid detection of Group B Streptococcus (GBS) using the kit of Example 2 alone is as follows

[0074] (1) Sample collection and nucleic acid release

[0075] Fold the collected standard vaginal and rectal swabs from the parturient into 500 μL B group cocci DNA rapid release solution, and shake them manually or on a vortex shaker for 2 minutes. In the alkaline environment provided by sodium hydroxide, SDS and Tween 20 are used as surfactants to lyse the bacteria and release the internal DNA, completely lysing and releasing the DNA.

[0076] (2) LAMP nucleic acid amplification reaction

[0077] Take 1 μL of the sample DNA released from the previous step, add 5 μL of 1×LAMP mixture and 4 μL of enzyme-free sterile water, put it into a centrifuge to mix the system, and put the mixed system into a heating device such as a constant temperature water bath to maintain a constant temperature of 60°C. Incubate at 60°C for 30 minutes. Under the action of strand displacement DNA polymerase (Bst DNA polymerase), the gene template, primer, dNTPS, etc. complete the LAMP reaction to achieve nucleic acid amplification.

[0078] (4) CRISPR detection reaction

[0079] Prepare 2×CRISPR / Cas12b mixed solution, add 10μL 2×CRISPR / Cas12b mixed solution to the LAMP reaction product, put it into the centrifuge mixing system, add the mixed system to a heating device such as a constant temperature water bath and keep it at a constant temperature of 60°C. Incubate at 60°C for 10 minutes, crRNA and Cas12b protein form a complex, crRNA binds to the target sequence, stimulates Cas12b enzyme activity, and cuts the target sequence and ssDNA reporter molecules.

[0080] (5) Interpretation of test results

[0081] When Cas12b recognizes the target DNA sequence by binding to crRNA, the trans-cleavage activity is activated, cutting the ssDNA reporter molecule, causing the fluorescent group to separate from the quenching group and emit fluorescence. After the CRISPR reaction is completed, the reaction system is illuminated with an LED light with a wavelength of 460-470nm in a dark environment to stimulate the CRISPR reaction system to emit green fluorescence, and the reaction system is observed through a filter. If it is green, Group B Streptococcus (GBS) is detected, and if there is no fluorescence, Group B Streptococcus (GBS) is not detected.

[0082] Embodiment 5:

[0083] The obstetric-specific rapid group B streptococcus (GBS) detection method, kit and detection device of the present invention were compared with the traditional one-step LAMP-CRISPR detection method.

[0084] Methods / test indicators Detection time Sensitivity Portability The present invention 40min 1copy / μL high One-step 60min 100-1000copy / μL Low

[0085] Example 6 Buffer Test

[0086] The feasibility of different buffers was tested. The synthetic GBS cfb sequence was tested. After 40 minutes of LAMP amplification, the CRISPR / Cas12b trans-cleavage assay was performed. In the system using NEB r3.1 buffer, the samples containing the cfb sequence showed a clear positive signal, and the 1× NEB r3.1 buffer performed best.

[0087] Example 7 System Optimization

[0088] L-proline, as a chemical additive, has been reported to protect the activity of Cas12a. As expected, the addition of L-proline (P>0.01) enhanced the measured signal (P>0.05). BSA has been reported as a signal enhancer for CRISPR / Cas detection buffer, but the BSA in NEB buffer is currently replaced by human serum albumin. We found that, still, the addition of BSA significantly enhanced the trans-cleavage signal of CRISPR / Cas12b (P>0.001).

[0089] Example 8 Sensitivity Test

[0090] Use from 10 5 to 10 -1 copis / μL of continuously diluted samples, we tested the Lod of the system (device in Example 1 + kit in Example 2). The detection limit of the system can reach 1copy / μL, which can meet the clinical demand for sensitive detection of group B streptococci.

[0091] Example 9 Detection time

[0092] The minimum LAMP amplification time was tested. After 20 minutes of LAMP amplification of a DNA sample with 100 copies / μL, signal saturation was observed. For DNA samples with a concentration of 10 copies / μL, the LAMP amplification time needs to be extended to 30 minutes. Therefore, the entire detection time can be controlled within 40 minutes.

[0093] Example 9 Testing of the Extraction-Free Method

[0094] The feasibility of the extraction-free method was tested using 5 clinically confirmed samples and 3 healthy samples. All GBS confirmed samples produced positive signals under this method, while healthy samples showed negative signals, indicating the feasibility of the extraction-free method.

[0095] In the past, when the gold standard was used for analysis, it often took a long time to determine the species and mutations. However, when the present invention was used for analysis, it only took less than 1 hour to complete the automatic sample analysis reading, which not only greatly improved the detection efficiency, but also greatly reduced the cost of use. Moreover, the present invention is small in size and easy to carry, making it an ideal tool for point-of-care settings such as hospital admission screening.

[0096] The parts not involved in the present invention are the same as the prior art or can be implemented by using the prior art.

Claims

1. A rapid detection kit for Group B Streptococcus, characterized in that: include: I: LAMP mixture for detecting the cfb gene of group B streptococci, wherein the LAMP primers target the conserved sequence on the cfb gene of group B streptococci encoding the cAMP factor, a specific hemolytic pathogen; II: 2×CRISPR / Cas12b mixture, which contains the crRNA shown in SEQ ID NO.7 and the ssDNA fluorescent reporter molecule: 5′-FAM-TTATT-BHQ1-3′.

2. The group B streptococcus rapid detection kit according to claim 1, characterized in that: The kit also contains a DNA rapid release liquid system; the DNA rapid release liquid system consists of 0.8% to 1.2% (g / ml) of sodium hydroxide, 1% to 1.2% (W / V) of SDS, 1% to 1.2% (V / V) of Tween 20 and enzyme-free sterile water.

3. The group B streptococcus rapid detection kit according to claim 1, characterized in that: The LAMP mixture contains the following six specific primers: LF: SEQ ID NO.1, LB: SEQ ID NO.2, F3: SEQ ID NO.3, B3: SEQ ID NO.4, FIP: SEQ ID NO.5, BIP: SEQ ID NO.

6.

4. The group B streptococcus rapid detection kit according to claim 3, characterized in that: The LAMP mixed solution is composed of: 1× isothermal amplification buffer, 7-10mM MgSO4, 1-1.5mM of each dNTP, 4-5U BstDNApolymerase, wherein the molar concentration of each primer is as follows: the molar concentration of F3 and B3 is 0.1-0.3μM, the molar concentration of FIP and BIP is 1.5-1.8μM, and the molar concentration of LF and LB is 0.3-0.5μM.

5. The group B streptococcus rapid detection kit according to claim 3, characterized in that: The 2×CRISPR / Cas12b mixed solution consists of 180-200nM AapCas12b, 350-420nM crRNA, 900-1100nM ssDNA fluorescent reporter molecules and 1×NEBr3.1 buffer.

6. A system for rapid detection of Group B Streptococcus, characterized in that: A group B streptococcus rapid detection kit and a group B streptococcus detection device according to any one of claims 1 to 5, wherein the detection device comprises a shell, a constant temperature incubation module, a power module, and a fluorescence analysis module, wherein the shell comprises a main body and a top cover, wherein the top cover is detachable and is used for adding a detection sample, wherein the power module is composed of a battery, the constant temperature incubation module is composed of a PTC heating plate, and the fluorescence analysis module is composed of a filter module and an optical module.

7. The system according to claim 6, characterized in that The constant temperature incubation module is composed of a PTC heating plate with a rated power of 0.5 to 1.5 W and can maintain a temperature of 60±2°C; the power module is composed of three 1.5V batteries; the filter module is composed of an amber filter with a filtering wavelength of 460 to 480nm; the optical module includes an optical lamp group and a lens module, the optical lamp group is composed of an LED lamp with a light wavelength of 460-470nm, and the lens module is composed of a lens with a diameter of 16 mm, a focal length of 3 mm, a working distance of 3 mm and a numerical aperture of 0.7 mm; the constant temperature incubation module is covered with an internal test tube rack, which is evenly distributed on a rectangular plate and is provided with a plurality of test tube holes with a diameter of 6.8 mm.

8. Use of the rapid detection kit for Group B Streptococcus according to any one of claims 1 to 5 or the system according to claim 6 or 7 in detecting Group B Streptococcus.

9. A method for rapid detection of Group B Streptococcus using the Group B Streptococcus rapid detection kit according to any one of claims 1 to 5, characterized in that: The following steps are involved: (1) Nucleic acid release: Add the sample to be tested into the Group B Streptococcus DNA Rapid Release Solution and shake it manually or on a vortex shaker for 1 to 3 minutes to completely lyse the Group B Streptococcus and release the DNA; (2) LAMP nucleic acid amplification: Prepare the LAMP system, take 1 μL of sample to release DNA, add 5 μL of 1× LAMP mixture and 4 μL of enzyme-free sterile water, and incubate at 60°C for 30 minutes; under the action of Bst DNA polymerase, the gene template, primer, and strand displacement DNA synthase complete the LAMP reaction to achieve nucleic acid amplification; (3) CRISPR detection reaction: Add 10 μL of LAMP reaction product to the LAMP reaction product. The 2×CRISPR / Cas12b mixture is incubated at 60°C for 5-10 minutes. The crRNA forms a complex with the Cas12b protein. The crRNA binds to the target sequence, stimulating the Cas12b enzyme activity and cutting the target sequence and the ssDNA fluorescent reporter molecule. (4) Interpretation of the test results: The 5′ end of the ssDNA fluorescent reporter molecule is labeled with a fluorescent group FAM, and the 3′ end is connected to a quencher group BHQ1. When the group B streptococcal target DNA sequence is not present in the sample, Cas12b is not activated, and the spatial proximity of the fluorescent group and the quencher group causes the fluorescence to be quenched, and the ssDNA fluorescent reporter molecule does not emit a signal. When the group B streptococcal target DNA sequence is present in the sample, Cas12b recognizes the target DNA sequence by binding to the crRNA, and the trans-cleavage activity is activated, cutting the ssDNA fluorescent reporter molecule, resulting in the separation of the fluorescent group and the quencher group. Under the excitation of blue light, it is observed as green fluorescence through an amber filter.

10. The use according to claim 9, characterized in that The method is used in conjunction with the group B streptococcus detection device according to claim 6 or 7.

Images