Morchella sextelata Qian DL02 and application thereof

Abstract

The invention belongs to the field of edible mushrooms, and particularly discloses a Morchella sextelata strain Qian DL02 which is preserved in the China Center for Type Culture Collection (CCTCC), and the preservation number of the Morchella sextelata strain is CCTCC NO: M2022899. The invention further discloses application of the Qian DL02 in the fields of food, beverages and the like. The ascotums of the strain Qian DL02 are light brown, the mushroom shape is good, and the commodity value is high; in addition, the strain also has the advantages of short cultivation period, high yield, strong heavy metal chromium stress resistance and the like.

Description

Technical Field

[0001] The invention belongs to the field of edible fungi, and in particular relates to a Morchella liumei strain and also relates to the use of the strain. Background Art

[0002] Morchella belongs to the Morchaceae family. It is named because its cap resembles a tripe. It is a precious medicinal and edible mushroom. Morchella grows mostly on the humus layer of broad-leaved forests or mixed coniferous and broad-leaved forests. It is distributed all over the world and in 28 provinces, municipalities and autonomous regions in my country. Morchella is not only delicious and unique in taste, but also rich in nutritional value, high in protein, rich in essential amino acids and vitamins, trace elements and carbohydrates, and rich in fatty acid types. Morchella fruiting bodies can also be used as medicine. According to the "Chinese Materia Medica", Morchella is flat in nature, sweet and cold in taste, non-toxic; it is beneficial to the stomach and intestines, aids digestion, eliminates phlegm and regulates qi, nourishes the kidneys, nourishes the brain and refreshes the mind; Morchella contains polysaccharides that inhibit tumors, antibacterial and antiviral active ingredients, and has the effects of enhancing the body's immunity, anti-fatigue, anti-virus, and inhibiting tumors. It has always been used as a high-end supplement for human nutrition in Europe and the United States.

[0003] Morchella sextelata is a species of the genus Morchella and is one of the main cultivated morels in my country. At present, the main problems in the cultivation of Morchella sextelata are: (1) The cultivation cycle is long, which is generally about 120 days. Morchella is a seasonally cultivated edible fungus. Fresh mushrooms are often put on the market in large quantities from February to March each year. Usually, the price of fresh mushrooms put on the market before the Spring Festival is generally higher than that after the Spring Festival, which can bring higher commercial value. Mushrooms before the Spring Festival often require a shorter cultivation cycle. (2) In some areas in southwest my country, the content of heavy metal chromium in the soil exceeds the standard, which has an adverse effect on the growth of morels and directly affects the yield of morels. Therefore, it is crucial to cultivate Morchella strains that are resistant to heavy metal chromium stress, have a short cultivation cycle and high yield for the stable development of the morel industry in southwest my country.

[0004] my country's vast primeval forests from south to north are rich in wild edible mushroom resources, including wild Morchella. The development and domestication of wild Morchella can not only enrich people's dining tables and meet people's needs for a high level of life, but also use its medicinal and edible properties to develop higher value-added foods, beverages and health products, which can improve people's health and well-being while increasing mushroom farmers' income and export earnings. Summary of the invention

[0005] The invention aims to provide a Morchella liumei strain which has a short fruiting period, strong resistance to heavy metal chromium stress and high yield.

[0006] Another object of the present invention is to provide the use of the above-mentioned Morchella lilii strain.

[0007] The purpose of the present invention is achieved through the following technical solutions:

[0008] The invention provides a Morchella sextelata strain Guizhou DL02, which is preserved in China Center for Type Culture Collection, with a preservation number of CCTCC NO: M2022899 and a preservation date of June 15, 2022.

[0009] The present invention also provides the use of the strain Qian DL02 in food or health products.

[0010] The present invention also provides a food or a health product, wherein the food or the health product contains the strain Qian DL02 or an extract of Qian DL02.

[0011] The present invention also provides application of the strain Guizhou DL02 in beverages.

[0012] The present invention also provides a beverage, wherein the beverage contains the strain Guizhou DL02 or an extract of Guizhou DL02.

[0013] The present invention also provides the use of the strain Qian DL02 in preparing medicines for improving human immunity.

[0014] The present invention also provides a genetically engineered Morchella liliiu, wherein the starting strain of the genetically engineered Morchella liliiu is the strain Guizhou DL02.

[0015] The present invention has the following advantages and beneficial technical effects:

[0016] (1) The ascocarps of the strain Qian DL02 of the present invention are light brown, with good mushroom shape and high commercial value. (2) The strain Qian DL02 of the present invention has a short cultivation cycle. Under traditional field cultivation, the cycle from sowing to mushroom harvesting of Qian DL02 is 80 to 85 days. The cultivation cycle of other existing six-sister morel strains is generally around 100 to 130 days. A short cultivation cycle means less labor costs and is also conducive to mushroom production before the Spring Festival. The price of fresh morel mushrooms before the Spring Festival is higher than that after the Spring Festival, and the corresponding economic benefits are higher. (3) The strain Qian DL02 of the present invention has a high yield. The average yield of Qian DL02 agricultural cultivation is 529.08kg / 667m 2 , while the yield of other existing Morchella liumei strains is only 350-450kg / 667m 2About, that is, the yield of the strain Qian DL02 of the present invention is significantly higher than that of other existing cultivated Morchella lilii strains. (4) The strain Qian DL02 of the present invention has a strong resistance to heavy metal chromium stress. Under different chromium concentration stresses, the solid seed mycelium growth rate or liquid seed mycelium biomass of Qian DL02 is significantly higher than that of other Morchella lilii strains, and its resistance to heavy metal chromium stress is higher than that of other main cultivated strains. (5) The breeding process of the strain Qian DL02 of the present invention is multi-spore self-pollination. After mating type detection, the strain has a double mating type. Compared with the strain separated by traditional tissues, its genetic material is more complete and the traits are more stable.

[0017] Biological preservation: The present invention's Morchella sextelata strain Guizhou DL02 was obtained by the inventors from wild Morchella collected in Bijie City, Guizhou Province, and then cultivated by multi-spore self-pollination screening. The strain is deposited in the China Center for Type Culture Collection; the address is Wuhan University, Wuhan, China; the deposit number is CCTCC NO: M2022899, and the deposit date is June 15, 2022. BRIEF DESCRIPTION OF THE DRAWINGS

[0018] Figure 1 .Photo of the fruiting body of the strain Guizhou DL02 of the present invention.

[0019] Figure 2 . Phylogenetic tree diagram of the strain Guizhou DL02 of the present invention.

[0020] Figure 3 .Comparative ISSR fingerprints of the strain Guizhou DL02 of the present invention and other Morchella liliumei strains; wherein M is the molecular weight standard; 1 is "Guizhou DL02"; 2 is "Guizhou Morchella No. 1"; 3 is "Lefeng No. 2"; 4 is "Faxing No. 1". DETAILED DESCRIPTION

[0021] The present invention is further described below by way of examples, but the present invention is not limited thereto. Unless otherwise specified, the biochemical reagents used in the following examples are all conventional commercial biochemical reagents.

[0022] Example 1 Breeding process of the strain Guizhou DL02 of the present invention

[0023] (1) Collection and isolation of wild Morchella strains

[0024] In April 2017, the inventors found a wild Morchella fruiting body in Qixingguan area, Bijie City, Guizhou Province. The mycelium (strain) was obtained by separating the fruiting body tissue, and then it was identified as Morchella sextelata by morphological characteristics, ITS-PCR detection, phylogenetic tree construction and ISSR fingerprint map comparison, as well as gene fragment size and sequence. The strains after tissue separation were cultivated and fruited, and then the fruiting bodies with good flower shapes were separated and inoculated on PDA medium for cultivation. The fruiting test was carried out at the experimental base of Guizhou Academy of Agricultural Sciences. After fruiting, the ascospores were collected and the subsequent strain selection was carried out by multi-spore self-pollination.

[0025] (2) Strain selection

[0026] Genomic DNA was extracted according to the instructions of the DNA extraction kit (Beijing Kangwei Century Company). Two sets of primer combinations P8-FF / P8-5R and P10-2F / P10-2R were used for PCR amplification to detect the mating type genes MAT1-1 and MAT1-2 of the monosporic strain. The primer sequences are as follows:

[0027] P8-5F: 5'-TTACCTTACTGGACTGGTTCGTGAG-3';

[0028] P8-5R: 5'-TGGAATGTCTGTGATTGAGGCTGTG-3'.

[0029] P10-2F: 5'-GGCCAGAACAGATGCTCGAAGAAGC-3';

[0030] P10-2R: 5'-GTGGCAACTCCCAAAGCATGATCAA-3'.

[0031] The PCR reaction system is as follows: total volume 20 μL: 1 μL of 20-50 ng / μL DNA template, 2 μL of 10× Buffer (with Mg2+), 0.5 μL of 2.5 mM dNTP, 0.2 μL of 5 U / μL DNA polymerase, 0.5 μL of each 0.2 μM primer, and double distilled water to 20 μL. Amplification reaction conditions: pre-denaturation at 94°C for 5 min; 94°C for 30 s, 63°C for 30 s, 72°C for 3 min, 30 cycles; 72°C for 10 min.

[0032] The PCR amplification products were detected by electrophoresis. The mating type of the monospore strain with MAT1-1 but no MAT1-2 gene band was MAT1-1. On the contrary, the mating type of the monospore strain with MAT1-2 but no MAT1-1 gene band was MAT1-2. Double mating type strains were selected, and after several generations of cultivation, and comparative tests were conducted on the growth rate, yield, and resistance to heavy metal chromium stress, the strains with stable genetic traits, fast mycelial growth rate, high yield, and high growth rate under heavy metal chromium stress were screened out. The strain was named: Guizhou DL02.

[0033] Example 2 Classification and Identification of Morchella Strain Guizhou DL02 of the Present Invention

[0034] (1) Morphological identification of Guizhou DL02:

[0035] The ascocarp of Morchella qian DL02 is light brown, the fruiting body is 6-13cm high, the ascocarp is 4-9cm long, 2-4cm thick, conical, blunt at the top, and connected to the stipe at the lower edge. The ascocarp has well-developed longitudinal ridges, shallow transverse ridges, and short villi all over the ridges. The transverse and longitudinal ridges intersect to form pits. The ridges are relatively flat when young and tender, and become sharp when mature; the stipe is 2-6cm long and 2.5-4cm thick, white or milky white, cylindrical or swollen at the base, and there are white villi at the root of the stipe. The ascus is columnar, and each ascus contains eight spores, arranged in a single longitudinal arrangement. According to the description and photos of the corresponding morphological characteristics of the six-sister morel on page 64 of "Morchella Biology and Cultivation Technology" (Liu Wei, Zhang Ya, et al., Jilin Science and Technology Press, 2017), the morphological characteristics of Qian DL02 and the six-sister morel are consistent, so it is shown that Qian DL02 belongs to the six-sister morel species (Morchella sextelata) of the genus Morchella.

[0036] (2) Molecular biological classification and identification of Guizhou DL02

[0037] The genomic DNA of Guizhou DL02 was extracted using the plant genomic DNA extraction kit CW0531 (Beijing Kangwei Century Company), and PCR amplification was performed using universal primers ITS1 and ITS4 as primers. The sequences of the universal primers are as follows:

[0038] ITS1: 5'-TCCGTAGGTGAACCTGCGG-3';

[0039] ITS4: 5'-TCCTCCGCTTATTGATATGC-3'.

[0040] The ITS-PCR amplification reaction system is as follows: total volume 20 μL: 1 μL of 20-50 ng / μL DNA template, 10× Buffer (with Mg 2+)2μL, 2.5mM dNTP 0.5μL, 5U / μl DNA polymerase 0.2μL, 0.2μM primers 0.5μL each, add double distilled water to 20μL. The ITS-PCR reaction conditions are: pre-denaturation at 94℃ for 5min; 94℃ for 1min, 60℃ for 1min, 72℃ for 75s, 30 cycles; 72℃ extension for 10min. As a result, a DNA molecule fragment with a fragment length of 730bp was amplified. It was sent to Sangon Biotech Co., Ltd. for sequencing, and the nucleotide sequence of the DNA fragment is shown in SEQ ID NO: 1. After BLAST comparison, the ITS sequence of the strain Guizhou DL02 of the present invention has the highest similarity with the ITS sequence of Morchella liumei, and the similarity can reach up to 99.73%, and a phylogenetic tree was constructed. Results (see Figure 2 ) The strain Guizhou DL02 of the present invention belongs to the species Morchella sextelata of the genus Morchella in terms of classification; and is different from other Morchella sextelata strains and is a new Morchella sextelata strain.

[0041] Example 3 ISSR identification comparison test of the present invention's strain Qian DL02 and other Morchella lilii

[0042] (I) Experimental materials: (1) the strain "Qian DL02" of the present invention; (2) "Qian Morchella No. 1" (the six-sister Morchella strain approved by Guizhou Province in 2022); (3) "Lefeng No. 2" (the six-sister Morchella strain approved by Guizhou Province in 2023); (4) "Faxing No. 1" (the six-sister Morchella strain promoted for cultivation in Qiandongnan area of ​​Guizhou).

[0043] (II) Test methods

[0044] The genomic DNA of “Qian DL02”, “Qian Morel No. 1”, “Lefeng No. 2” and “Faxing No. 1” were extracted using a new plant genomic DNA extraction kit CW0531 (Beijing Kangwei Century Company), and 20 ISSR primers (see Table 1) were selected for PCR amplification in accordance with the agricultural industry standard of the People’s Republic of China NY / T 1730-2009 “ISSR Method for Authenticity Identification of Edible Fungi”. The primer sequences are as follows:

[0045] Table 1 ISSR random primer sequences

[0046] Primer name Primer sequence 5'-3' Primer name Primer sequence 5'-3' P1 TGCACACACACACAC P11 GAGAGAGAGAGAGAGAAC P2 GTGACACACACACAC P12 AGAGAGAGAGAGAGAGAGGC P3 GTGACGACTCTCTCTCTCT P13 TCTCTCTCTCTCTCTCCG P4 GGATGCAACACACACACAC P14 ACACACACACACACACG P5 CGTGTGTGTGTGTGT P15 GTGTGTGTGTGTGTGTTA P6 AGTGTGTGTGTGTGT P16 TGTGTGTGTGTGTGTGGA P7 CCAGTGGTGGTGGTG P17 ACACACACACACACAC P8 GGAGTGGTGGTGGTG P18 ACACACACACACACACACC P9 AGAGAGAGAGAGAGAGAGG P19 ACACACACACACACACACCT P10 GAGAGAGAGAG AGAGAC P20 ACACACACACACACACACCTG

[0047] The ISSR-PCR amplification reaction system is as follows: the total volume of the PCR reaction is 20 μL, containing 1×PCR reaction buffer, 0.2 mmol / L dNTP, 1U Taq DNA polymerase, 0.4 pmol / L primer, 20ng-50ng template DNA, and sterilized double distilled water to 20 μL. The ISSR-PCR amplification reaction conditions are as follows: pre-denaturation at 94°C for 4 min, then denaturation at 94°C for 30 s, annealing at 5°C below the Tm value of the primer for 45 s, extension at 72°C for 2 min, for a total of 35 cycles; extension at 72°C for 7 min, and storage at 4°C.

[0048] Results (see Figure 3 ) From the ISSR pattern amplified with P9 as primer, it can be seen that the specific bands of the strain Qian DL02 of the present invention and the other three strains are significantly different, indicating that the strain Qian DL02 of the present invention is a new strain of Morchella sextelata.

[0049] Example 4 Cultivation test of strain Guizhou DL02 of the present invention

[0050] Follow these steps:

[0051] (1) Stock culture: Inoculate the 5 mm diameter Guizhou DL02 strain (this strain has been deposited in China Center for Type Culture Collection, Wuhan University, Wuhan, China, with a deposit number of CCTCC NO: M2022899) in the center of the stock culture medium plate with a sterilized and cooled inoculation hook, and culture at 20° C. and relative air humidity of 60-75%. After about 3 days, the mycelium will cover the plate. Continue to culture under light-proof conditions for 7 days, at which time a large number of sclerotia will form on the plate, thereby obtaining the Guizhou DL02 stock culture. Preparation method of the stock culture medium: Peel 200 g of potatoes and cut them into cubes of about 1.5 cm, put them into 800 mL of pure water and boil them for 20 min, filter the extract through 3 layers of gauze, add 20 g of glucose, 18 g of agar, 1 g of potassium dihydrogen phosphate, and 0.5 g of magnesium sulfate, mix well, make up to 1000 mL with pure water, sterilize at 121° C. for 20 min, pour into a 9 cm diameter plate and set aside.

[0052] (2) Stock culture: Use the sterilized and cooled strains to scoop out 5 pieces of Qian DL02 mother strains with a diameter of 5 mm obtained in step (1), inoculate them on the stock culture medium, and culture them at 18°C, relative air humidity of 60-75%, and in dark conditions. The bag is full in about 7 days, and the culture is continued for about 14 days until the mycelium is ripe and the mycelium fills the bottle. At this time, a large number of sclerotia are formed in the bottle, and the Qian DL02 stock is obtained; wherein the components and weight percentages of the stock culture medium are: 80% wheat, 13% humus, 5% rice husk, 1% gypsum, 1% calcium carbonate, and the water content of the culture medium is 60-65%. Mix the components, stir them evenly, put them into a polypropylene plastic bag (16cm×35cm×0.005cm), tie the mouth, and sterilize them at 121°C for 2 hours for use.

[0053] (3) Cultivation of cultivars: Use a sterilized and cooled spawn shovel to dig out the original seed of Qian DL02 obtained in step (2) at a mass ratio of 1:30 and inoculate it on the original seed culture medium for cultivation at 18° C. and a relative humidity of 60-75% in the dark for 20 days. The mycelium will fill the flask and a large number of sclerotia will form in the flask, thereby obtaining the cultivar of Qian DL02.

[0054] (4) Opening furrows, sowing and covering with film: Select arable land in a greenhouse with a pH of 6-6.5 and fine soil, remove weeds and plow the soil, open furrows before sowing, the furrow width is 80-100 cm, and a 50 cm walkway is left between furrows. The soil moisture content is 40-45%. Break the cultivated seeds obtained in step (3) into small particles and evenly spread them on the furrow surface. Sow 400 bags of cultivated seeds per mu, and immediately cover the furrow with a layer of soil with a thickness of about 2-3 cm.

[0055] (5) Mycelium culture and placement of nutrient bags: After sowing, the maximum temperature in the greenhouse is controlled at 15-20°C, the relative humidity of the air is 60-70%, the soil moisture content is 45%, and the light intensity is 50-100 lux. After 5 days, the mycelium will cover the surface of the ridge to form a white "fungus frost". The nutrient bags are placed. Each nutrient bag is cut with two cuts parallel to the long side of the nutrient bag with a clean knife. The cut surface is placed close to the soil on the ridge surface. 2,000 nutrient bags are evenly placed per mu of land. After the nutrient bags are placed, they are covered with black polypropylene film with air holes. The nutrient bags are placed in the field for about 45-50 days, and the black polypropylene film is removed. The preparation method of the nutrient bag is as follows: 90% wheat, 9% rice husk, and 1% quicklime are mixed evenly according to the weight percentage ratio, and the water content is 60-65%, and stirred evenly. The cultivation bag is a polypropylene plastic bag (12cm×24cm×0.005cm). The mixed nutrients are put into the bag, tied with a polypropylene rope, sterilized at 121°C for 1 hour, and then cooled to room temperature.

[0056] (6) Primordial differentiation: After removing the mulch in step (5), spray water to make the soil moisture content reach 50-55%. During the fruiting body growth stage, the maximum temperature in the greenhouse is controlled between 10-20°C and the minimum temperature is not less than 3°C. The relative humidity of the air is 75-85%, and the light intensity is 200-300 lux. The greenhouse is naturally ventilated to induce primordium formation. A large number of primordia will be formed about 5 days after spraying water. After the primordia are formed, continued cultivation will form young mushrooms of about 1-2 cm.

[0057] (7) Management and harvesting of mushrooms: The maximum temperature in the greenhouse is controlled at 10-20℃, the relative humidity is 70-80%, the soil moisture content is 40-45%, the light intensity is 500-1000lux, and the greenhouse is naturally ventilated. When the temperature is high, spray, ventilation through the side windows of the greenhouse, and covering the roof with reflective film are used to cool down. It takes about 20-25 days from the occurrence of primordium to the maturity of the fruiting body. When the fruiting body grows to 5-8cm in height, the ridges and pits of the cap are clear, and the ascocarp part has basically unfolded, it is mature and should be harvested in time.

[0058] Results (see Figure 1 ) The ascocarps of the six-sister morel strain Guizhou DL02 of the present invention are light brown, with a good mushroom shape, a compact fruiting body texture, and a delicate taste. It has high commercial value. Secondly, it can be seen from Table 2 that the cultivation period of the morel strain Guizhou DL02 of the present invention is short (see Table 2), and the period from sowing to mushroom harvesting is 80 to 85 days, while the cultivation period of "Guizhou Morel No. 1", "Lefeng No. 2" and "Faxing No. 1" is 100 to 130 days, that is, the cultivation period of the strain Guizhou DL02 of the present invention is 20 to 50 days shorter than that of other six-sister morels; the average yield of Guizhou DL02 agricultural cultivation is 529.08kg / 667m 2 The above test results show that the strain Guizhou DL02 of the present invention has a shorter cultivation period and higher yield than other existing main cultivated six-sister morel varieties.

[0059] Table 2 Comparative test results of the cultivation cycle and yield of the strain Guizhou DL02 of the present invention and other Morchella lilii

[0060] Guizhou DL02 Guizhou Morel No. 1 Lefeng No.2 Fa Xing No. 1 Cultivation period (d) 80～85 100～110 110～130 100～110 <![CDATA[Yield (kg / 667m 2 )]]> 529.08 330.46 346.2 357.6

[0061] Example 5 Comparative test on the heavy metal chromium stress resistance of the solid strain of the present invention Guizhou DL02

[0062] (I) Test strains: (1) the strain "Qian DL02" of the present invention; (2) "Qian Morchella No. 1" (the six-sister Morchella strain approved by Guizhou Province in 2022); (3) "Lefeng No. 2" (the six-sister Morchella strain approved by Guizhou Province in 2023); (4) "Faxing No. 1" (the six-sister Morchella strain promoted for cultivation in Qiandongnan area of ​​Guizhou).

[0063] (II) Test methods:

[0064] (1) Different concentrations of chromium standard solution were added to PDA culture medium, and the final chromium concentrations of the culture medium were 2, 4, 6, 8, and 10 mg / L, respectively. PDA culture medium without chromium standard solution was used as blank control (CK), with a total of 26 treatments, and the pH value of all culture media was adjusted to 7. Three groups of replicates were set at different concentrations, and the test Morchella liumei mushroom blocks were inoculated and cultured in an incubator at 23°C, and the mycelial growth in culture medium with different concentrations of heavy metal chromium was recorded.

[0065] (2) Determination of hyphae growth rate: After Morchella lilii was inoculated on solid culture medium, the culture was stopped when any treatment filled the plate, the growth time was recorded, the plate was photographed, and the colony diameter of each treatment was measured by the cross-hatch method. The average daily growth rate of the hyphae was calculated by measuring the hyphae length on the plate.

[0066] The results (see Table 3) showed that the solid mycelial growth rate of the strain Qian DL02 of the present invention under different concentrations of heavy metal chromium stress was significantly higher than that of other strains, indicating that the tolerance of Qian DL02 to heavy metal chromium stress was higher than that of other main cultivated strains.

[0067] Table 3 Comparative test results of mycelial growth rate of solid strain Guizhou DL02 of the present invention at different chromium concentrations

[0068]

[0069] Example 6 Heavy metal chromium stress resistance test of the liquid strain of the present invention Guizhou DL02

[0070] (I) Test strains: (1) the strain "Qian DL02" of the present invention; (2) "Qian Morchella No. 1" (the six-sister Morchella strain approved by Guizhou Province in 2022); (3) "Lefeng No. 2" (the six-sister Morchella strain approved by Guizhou Province in 2023); (4) "Faxing No. 1" (the six-sister Morchella strain promoted for cultivation in Qiandongnan area of ​​Guizhou).

[0071] (II) Test methods:

[0072] (1) Different concentrations of chromium standard solution were added to PDB liquid culture medium. The final chromium concentrations in the culture medium were 2, 4, 6, 8, and 10 mg / L, respectively. PDB liquid culture medium without chromium standard solution was used as blank control (CK). The pH value of all culture media was adjusted to 7. Each bottle of culture medium was inoculated with different Morchella lilii strains for culture. Six Morchella lilii blocks with a diameter of 5 mm were inoculated and cultured in a shaker at 23°C and 150 r / min in the dark for 5 days. Three replicates were set for each treatment. The mycelial growth in culture medium with different concentrations of heavy metal chromium was recorded.

[0073] (2) Determination of mycelial biomass: Filter the mycelial pellets in the liquid culture medium with a 100-mesh filter, rinse the mycelial pellets repeatedly with pure water, and then dry the mycelial pellets in an oven at 45°C until constant weight, and weigh the mass of dry mycelium.

[0074] The results (see Table 4) showed that under different chromium concentration stresses, the liquid culture mycelium biomass of the strain Qian DL02 of the present invention was significantly higher than that of other Morchella lilii strains, indicating that the strain Qian DL02 of the present invention has a significantly higher resistance to heavy metal chromium stress than other main cultivated Morchella lilii strains.

[0075] Table 4 Comparative test results of mycelial biomass of the present invention's strain Qian DL02 liquid inoculation at different chromium concentrations

[0076]

Claims

1. A Morchella sextelata strain Guizhou DL02, which is deposited in China Center for Type Culture Collection with a deposit number of CCTCC NO: M2022899.

2. Use of the strain Guizhou DL02 according to claim 1 in food or health products.

3. A food or health product, characterized in that: The food or health product contains the strain Qian DL02 or an extract of Qian DL02 according to claim 1.

4. Use of the strain Guizhou DL02 according to claim 1 in beverages.

5. A beverage, characterized in that The beverage contains the strain Qian DL02 or an extract of Qian DL02 according to claim 1.

6. Use of the strain Guizhou DL02 according to claim 1 in preparing drugs for improving human immunity.

7. A genetically engineered Morchella liumei, characterized in that: The starting strain of the genetically engineered Morchella lilii is the strain Guizhou DL02 described in claim 1.

Images