Aspergillus nidulans UV-14-LA, genetically engineered bacterium of aspergillus nidulans UV-14-LA and production method of echinocandin B

Abstract

The invention discloses aspergillus nidulans UV-14-LA, a genetically engineered bacterium of the aspergillus nidulans UV-14-LA and a production method of echinocandin B. The aspergillus nidulans UV-14-LA has the advantages that the genetically engineered The method comprises the following steps: by taking aspergillus nidulans UV-14 as a chassis strain, mutagenizing to obtain aspergillus nidulans UV-14-LA; the method comprises the following steps: respectively over-expressing an ecdE gene, an ecdH gene, an ecdI gene and an ecdF gene in a strain UV-14-LA to obtain a genetically engineered bacterium of the UV-14-LA; on the basis, the transcription activator gene ecdJ is continuously overexpressed, and the genetically engineered bacterium of UV-14-LA is obtained. The genetically engineered bacteria of the aspergillus nidulans UV-14-LA and UV-14-LA are applied to the preparation of the echinocandin B through microbial fermentation, and the higher yield of the echinocandin B is obtained, and the highest yield of the echinocandin B is 2136.3 mg / L.

Description

Technical Field

[0001] The invention belongs to the technical field of bioengineering, and specifically relates to a production method of Aspergillus nidulans UV-14-LA, a genetically engineered bacterium of Aspergillus nidulans UV-14-LA and echinocandin B. Background Art

[0002] Fungal infections occur worldwide, and patients with deficient or damaged immune systems are more susceptible to such infections, resulting in higher mortality rates. Echinocandins are a new type of antifungal drug that has antibacterial activity against Candida, Aspergillus, and some azole-resistant fungi. Echinocandins interfere with the synthesis of fungal cell walls by inhibiting the biosynthesis of β-(1,3)-glucan, thereby achieving antifungal effects. Mammalian cells do not have cell walls, so this type of drug has low toxicity and side effects and is highly safe.

[0003] The four echinocandin antifungal drugs currently used in clinical practice are anidulafungin, caspofungin, micafungin and razafungin, of which the precursor compounds of anidulafungin and razafungin are both echinocandin B (ECB). Since echinocandin B is mainly synthesized by filamentous fungi as its secondary metabolites, it requires a long fermentation cycle and has a relatively low yield, which limits the industrial production efficiency of echinocandin B. Therefore, the acquisition of high-yield strains is of great practical significance for the fermentation production of echinocandin B.

[0004] The invention patent with authorization announcement number CN 114854603 B discloses a strain with high yield of echinocandin B and its application. The strain is Aspergillus nidulans Gen-9, which can be used to produce echinocandin B. However, the yield of echinocandin B produced by fermentation using this strain is low, only 1257.6 mg / L. Summary of the invention

[0005] To solve the above problems, in a first aspect, the present invention provides Aspergillus nidulans UV-14-LA and genetically engineered bacteria of Aspergillus nidulans UV-14-LA, which can be used in the preparation of echinocandin B by microbial fermentation and have a high echinocandin B yield.

[0006] The technical solution of the present invention to solve the above problems is as follows: Aspergillus nidulans UV-14-LA, which was obtained by LiCl mutagenesis and ARTP mutagenesis of Aspergillus nidulans UV-14.

[0007] The Aspergillus nidulans UV-14 has been disclosed in the invention patent application number 201310477670.8 and is deposited in the China Center for Type Culture Collection with a deposit number of CCTCC NO: M2012300.

[0008] The Aspergillus nidulans UV-14-LA is deposited in the China Center for Type Culture Collection with a deposit number of CCTCC NO: M20242736, a classification name of Aspergillus nidulans, and a deposit date of December 5, 2024.

[0009] Aspergillus nidulans UV-14-LA develops relatively slowly, requiring 7 to 8 days for the spores to mature. Within 14 days, the diameter of the spores on the plate can reach 5 to 6 cm. They are round, green, and fluffy in appearance, with a large number of yellow-brown cleistothecia and white hyphae at the edge of the colony. The center of the bottom of the colony is dark brown with yellow edges.

[0010] A genetically engineered bacterium, wherein the genetically engineered bacterium is obtained by using the Aspergillus nidulans UV-14-LA as a starting strain through Agrobacterium transformation; the genetically engineered bacterium has iD Gene, HkDJ Gene, f Gene or eCE Gene.

[0011] Preferably, the genetically engineered bacteria also has JbXj Gene.

[0012] A genetically engineered bacterium, wherein the genetically engineered bacterium uses a pDHt-gpdA plasmid as a template to construct a recombinant plasmid, transforms the recombinant plasmid into Escherichia coli DH5α competent cells, cultures and screens to obtain clones; then transforms the clones into Agrobacterium competent cells AGL1, cultures to obtain transformed Agrobacterium; then mixes spores of Aspergillus nidulans UV-14-LA with the transformed Agrobacterium to obtain transformants; The recombinant plasmid has iD Gene, HkDJ Gene, f Gene or eCE Recombinant plasmid of gene.

[0013] More preferably, using plasmid pDHt-gpdA as plasmid template, ligating iD Gene, HkDJ Gene, f Gene, eCE The gene is transformed into Escherichia coli, cultured and screened to obtain clones, and then the clones are transformed into Agrobacterium to obtain transformed Agrobacterium, and then the transformed Agrobacterium is mixed with Aspergillus nidulans UV-14-LA to obtain the genetically engineered bacteria of Aspergillus nidulans UV-14-LA.

[0014] Said fThe gene is a glycosidase gene, and the nucleotide sequence is shown in SEQ ID NO.1; Said HkDJ The gene is a cytochrome P450 heme iron-dependent oxygenase gene, and the nucleotide sequence is shown in SEQ ID NO.2; Said iD The gene is a gene encoding acyl-CoA ligase, and the nucleotide sequence is shown in SEQ ID NO.3; Said eCE The gene is a glycoside hydrolase gene, and the nucleotide sequence is shown in SEQ ID NO.4; Said JbXj The gene is a transcription activator gene, and the nucleotide sequence is shown in SEQ ID NO.5.

[0015] Using the above-mentioned Aspergillus nidulans UV-14-LA as the starting strain and the plasmid pDHt-gpdA as the plasmid template, ligate iD The gene is obtained by obtaining a recombinant plasmid pDHt-gpdA-I, which is transformed into Escherichia coli, cultured and screened to obtain clones, which are then transformed into Agrobacterium to obtain transformed Agrobacterium, which is then mixed-cultured with Aspergillus nidulans UV-14-LA to obtain the genetically engineered bacterium UV-14-LA-I of Aspergillus nidulans UV-14-LA.

[0016] Using the above-mentioned Aspergillus nidulans UV-14-LA as the starting strain and the plasmid pDHt-gpdA as the plasmid template, ligate HkDJ The gene is obtained by obtaining a recombinant plasmid pDHt-gpdA-H, which is transformed into Escherichia coli, cultured and screened to obtain clones, which are then transformed into Agrobacterium to obtain transformed Agrobacterium, which is then mixed with Aspergillus nidulans UV-14-LA to obtain the genetically engineered bacteria UV-14-LA-H of Aspergillus nidulans UV-14-LA.

[0017] Using the above-mentioned Aspergillus nidulans UV-14-LA as the starting strain and the plasmid pDHt-gpdA as the plasmid template, ligate f The gene is obtained by obtaining a recombinant plasmid pDHt-gpdA-F, which is transformed into Escherichia coli, cultured and screened to obtain clones, which are then transformed into Agrobacterium to obtain transformed Agrobacterium, which is then mixed with Aspergillus nidulans UV-14-LA to obtain the genetically engineered bacterium UV-14-LA-F of Aspergillus nidulans UV-14-LA.

[0018] Using the above-mentioned Aspergillus nidulans UV-14-LA as the starting strain and the plasmid pDHt-gpdA as the plasmid template, ligate eCEThe gene is obtained by obtaining a recombinant plasmid pDHt-gpdA-E, which is transformed into Escherichia coli, cultured and screened to obtain clones, which are then transformed into Agrobacterium to obtain transformed Agrobacterium, which is then mixed with Aspergillus nidulans UV-14-LA to obtain the genetically engineered bacteria UV-14-LA-E of Aspergillus nidulans UV-14-LA.

[0019] Using the Aspergillus nidulans UV-14-LA-I as the starting strain and the plasmid pDHt-gpdA as the plasmid template, ligate JbXj The gene is obtained by obtaining a recombinant plasmid pDHt-gpdA-J, which is transformed into Escherichia coli, cultured and screened to obtain clones, which are then transformed into Agrobacterium to obtain transformed Agrobacterium, which is then mixed with Aspergillus nidulans UV-14-LA-I to obtain the genetically engineered bacterium UV-14-LA-IJ of Aspergillus nidulans UV-14-LA.

[0020] The specific construction method of the strain UV-14-LA-IJ is as follows: (1) Using strain UV-14-LA as the chassis strain, overexpress the acyl-CoA ligase gene on the plasmid iD :Use pDHt-gpdA plasmid as template and use restriction endonuclease XbaⅠ for digestion; compare the digested plasmid pDHt-gpdA with the plasmid shown in SEQ ID NO.3 iD The gene fragments were connected by homologous recombination technology to construct plasmid pDHt-gpdA-I, which was transformed into Agrobacterium AGL-1 competent cells and co-cultured with UV-14-LA to obtain Aspergillus nidulans UV-14-LA-I; (2) Using UV-14-LA-I as the chassis strain, overexpressing the transcription activator gene on the plasmid JbXj :Use pDHt-gpdA plasmid as template and use restriction endonuclease XbaⅠ for digestion; compare the digested plasmid pDHt-gpdA with the plasmid shown in SEQ ID NO.5 JbXj The gene fragments were connected by homologous recombination technology to construct plasmid pDHt-gpdA-J, the plasmid was transformed into Agrobacterium AGL-1 competent cells, and co-cultured with UV-14-LA-I to obtain Aspergillus nidulans UV-14-LA-IJ.

[0021] The genetically engineered bacteria UV-14-LA-HJ, UV-14-LA-EJ and UV-14-LA-FJ of Aspergillus nidulans UV-14-LA can be constructed according to the above method.

[0022] In a second aspect, the present invention also provides a method for producing echinocandin B: echinocandin B is prepared by fermentation culture using the Aspergillus nidulans UV-14-LA.

[0023] The genetically engineered bacteria of Aspergillus nidulans UV-14-LA can also be used to ferment and culture the echinocandin B.

[0024] The genetically engineered bacteria of Aspergillus nidulans UV-14-LA / Aspergillus nidulans UV-14-LA were inoculated into the fermentation medium, cultured at 25-35°C and 200-280 rpm for 8-12 days to obtain a fermentation broth containing echinocandin B, and the fermentation broth was separated and extracted to obtain echinocandin B.

[0025] Preferably, the fermentation broth is extracted with methanol.

[0026] Preferably, the volume ratio of the fermentation broth to methanol is (0.5-1.5):(4-12).

[0027] More preferably, the volume ratio of the fermentation broth to methanol is (0.8-1.2):(8-12).

[0028] The fermentation medium comprises: 15-25 g / L peanut oil, 5-15 g / L glycerol, 7-10 g / L peptone, 2-4 g / L L-threonine, 5-7 g / L L-ornithine hydrochloride, 65-75 g / L methyl oleate, 35-45 g / L soybean cake powder, 6-10 g / L K2HPO4·3H2O, 0.2-1.0 g / L MgSO4·7H2O, 0.1-0.3 g / L MnSO4·H2O, 0.02-0.1 g / L FeSO4·7H2O, 0.1-0.5 g / L CaCl2, and 0.4-0.8 g / L CuSO4·5H2O; the solvent is deionized water, the pH value is 6.0-6.8, and the medium is sterilized at 115-130°C for 10-30 min.

[0029] The present invention has the following beneficial effects: The present invention uses Aspergillus nidulans UV-14 as a base strain, performs LiCl mutagenesis and ARTP mutagenesis on it to obtain Aspergillus nidulans UV-14-LA, applies Aspergillus nidulans UV-14-LA to prepare echinocandin B by microbial fermentation, and obtains a higher echinocandin B yield of 1537.1 mg / L, which is 22% higher than the echinocandin B yield of 1257.5 mg / L of the base strain UV-14; by adjusting the amount of extraction solvent methanol used in the fermentation liquid treatment process of the strain UV-14-LA, the echinocandin B yield reaches 1627.6 mg / L; Overexpression of glycoside hydrolase genes in strain UV-14-LA eCE , cytochrome P450 heme iron-dependent oxygenase gene ecdH, Acyl-CoA ligase gene ecdI, Glycosidase gene f , and obtained the genetically engineered bacteria UV-14-LA-E, UV-14-LA-H, UV-14-LA-I, and UV-14-LA-F of UV-14-LA, among which the echinocandin B production of strains UV-14-LA-E, UV-14-LA-H, and UV-14-LA-I was higher than 1627.6 mg / L; Overexpression of transcription activator genes in strains UV-14-LA-E, UV-14-LA-H, UV-14-LA-I, and UV-14-LA-F JbXj , strains UV-14-LA-EJ, UV-14-LA-HJ, UV-14-LA-IJ, and UV-14-LA-FJ were obtained, and the echinocandin B production was 1978.5 mg / L, 1967.2 mg / L, 2136.3 mg / L, and 1674.4 mg / L, respectively, which were all higher than the echinocandin B production of Aspergillus nidulans UV-14-LA (1627.6 mg / L); In summary, Aspergillus nidulans UV-14-LA and genetically engineered bacteria of Aspergillus nidulans UV-14-LA can be used to produce echinocandin B and can obtain a higher yield, which lays a certain research foundation for the subsequent industrial production of echinocandin B. BRIEF DESCRIPTION OF THE DRAWINGS

[0030] Figure 1 It is the bacterial lethality curve of different LiCl treatment concentrations; Figure 2 The graph is a graph of the echinocandin B production of different LiCl-induced strains, where the horizontal line is the echinocandin B production of the UV-14 control strain; Figure 3 The bacterial lethality curve at different ARTP irradiation times; Figure 4 The graph is a graph of the echinocandin B production of different ARTP-induced strains, where the horizontal line is the echinocandin B production of the UV-14-L control strain; Figure 5 This is the graph of the echinocandin B production of the ARTP-induced high-yield strain after optimization of the fermentation broth pretreatment; Figure 6 is the plasmid map of pDHt-gpdA-F; Figure 7 is the plasmid map of pDHt-gpdA-H; Figure 8 is the plasmid map of pDHt-gpdA-I; Fig. 9 is the plasmid map of pDHt-gpdA-E; Fig.10 is the plasmid map of pDHt-gpdA-J; Fig.11 It is a graph of the production of echinocandin B by UV-14-LA-E, UV-14-LA-H, UV-14-LA-I, and UV-14-LA-F strains; Fig.12 This is a graph showing the production of echinocandin B by UV-14-LA-EJ, UV-14-LA-FJ, UV-14-LA-HJ, and UV-14-LA-IJ strains. DETAILED DESCRIPTION

[0031] In order to make the purpose, technical scheme and advantages of the present invention more clear, the present invention is further described in detail in conjunction with the accompanying drawings and embodiments. It should be understood that the specific embodiments described herein are only used to explain the present invention, rather than all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without making creative work are within the scope of protection of the present invention.

[0032] The experimental methods in the following examples are all conventional methods unless otherwise specified.

[0033] Unless otherwise specified, the test materials used in the following examples are all conventional biochemical reagents.

[0034] Aspergillus nidulans UV-14 has been disclosed in the invention patent application number 201310477670.8 and is deposited in the China Center for Type Culture Collection with the deposit number CCTCC NO: M2012300.

[0035] Aspergillus nidulans UV-14-LA was deposited in China Center for Type Culture Collection with the deposit number CCTCC NO: M20242736.

[0036] PDA solid culture medium: 200 g / L potato, 20 g / L glucose, 20 g / L agar powder, the solvent is deionized water, autoclave at 115 ℃ for 30 min, and wait for cooling to about 60 ℃ to prepare the plate.

[0037] Seed culture medium: soybean cake powder 25 g / L, glucose 10 g / L, glycerol 10 g / L, solvent is deionized water, pH 6.8~7.0, sterilized at 115 ℃ for 30 min.

[0038] Fermentation medium: peanut oil 20 g / L, glycerol 10 g / L, peptone 8.6 g / L, L-threonine 3.1 g / L, L-ornithine hydrochloride 6.1 g / L, methyl oleate 70 g / L, soybean cake powder 40 g / L, K2HPO4·3H2O 8 g / L, MgSO4·7H2O0.5 g / L, MnSO4·H2O 0.2 g / L, FeSO4·7H2O 0.05 g / L, CaCl20.3 g / L, CuSO4·5H2O 0.6 g / L, solvent is deionized water, pH 6.0~6.8, sterilized at 121 ℃ for 20 min.

[0039] IM liquid culture medium (200 mL): 0.36 g glucose, 1 mL glycerol, 112 mL deionized water, sterilize at 115 °C for 30 min, add 80 mL 2.5×MM salts, 8 mL 40 mM MES and 200 µL 200 uM AS after cooling.

[0040] IM solid medium (200 mL): 0.36 g glucose, 1 mL glycerol, 3 g agar, 112 mL deionized water, sterilize at 115°C for 30 min, add 80 mL 2.5×MM salts, 8 mL 40 mM MES, and 200 µL 200 µM AS after cooling.

[0041] 200 µM AS: 0.393 g AS was dissolved in 10 mL DMSO and sterilized by filtration through a 0.22 µm organic filter.

[0042] 40 mM MES: Dissolve 1.562 g MES in 200 mL deionized water and sterilize by filtration through a 0.22 µm organic filter.

[0043] Table 1: Genes and encoded proteins involved in gene editing Gene name Nucleotide sequence protein SEQ ID NO.1 Glycoside hydrolase SEQ ID NO.2 Glycosidase SEQ ID NO.3 Cytochrome P450 heme iron-dependent oxygenase SEQ ID NO.4 Acyl-CoA ligase SEQ ID NO.5 Transcription activator The genes mentioned in Table 1 are all from the Echinocandin B biosynthesis gene cluster of Eumelanthus rugosus NRRL 11440, GenBank: JX421684.

[0044] Table 2: Primer sequences Primer name Primer sequence (5'-3') ecdE-F CCCGCTTGAGCAGACATCACAtATGAAGCTCAATATCTTCGCCAGTG ecdE-R TCCGGTCGGCATCTACTtctagTTAATGCCATGTCGACTGTATTTCTCTCAC ecdF-F CCCGCTTGAGCAGACATCACATATGTTTCTGCATATTTTGTGTCTCCTTGC ecdF-R TCCGGTCGGCATCTACTTCTAGCTATAAGACAGCTCCTAGCCTGGG ecdH-F CCCGCTTGAGCAGACATCACAtATGAAGCTCAATATCTTCGCCAGTG ecdH-R TCCGGTCGGCATCTACTTCTAGTTAATGCCATGTCGACTGTATTTCTCTCAC ecdI-F CCCCGCTTGAGCAGACATCACAATGGTCTTCACTTCCCCAGC ecdI-R ATCGATCCGGTCGGCATCTACTTTAAATCAACTCCTTCAACTTGAACTTCAGCG ecdJ-F CCCCGCTTGAGCAGACATCACAATGCACTTCGCAGAGAGC ecdJ-R ATCGATCCGGTCGGCATCTACTTCAAGCGTTAGAGTTCAGATCGC pDHt-VF TTTGTTGCCATATTTTCCTGCTCTC pDHt-VR TCTGGAAGAGGTAAACCCGAAAC Example 1: Mutagenesis of starting strain UV-14 using LiCl Take out a glycerol tube of frozen strain UV-14 from the -80℃ refrigerator, streak it on the PDA plate, and invert it at 28℃ for 6-7 days to make the spores of the strain mature. At this time, the Aspergillus nidulans strain appears green or yellow-green. Take 7-10mL of sterile physiological saline in the PDA plate, pour it into a sterile triangular conical bottle filled with glass beads, shake it at 25℃ and 240 r / min for 1h, fully shake and activate the spores, filter them with sterile rapid filter paper, count them with a hemocytometer and microscope, and dilute them to get 10 7 ~10 8 CFU / mL of spore suspension.

[0045] 1 mL of spore suspension was added to 9 mL of solutions containing different lithium chloride concentrations for 30 min of mutagenesis. The lithium chloride concentrations were 0.2%, 0.4%, 0.6%, 0.8%, 1.0%, 1.5%, and 2.0% (v / v). After the mutagenesis, the suspension was diluted to 10 5 / mL, take 0.1 mL and spread it on the PDA plate, and culture it in the dark at 25 ℃ for 4~5 days (the spores are not yet mature at this time), count the colonies on the plate, and use the number of colonies on the plate coated with the spore suspension that has not been induced by LiCl as the blank control, and calculate the lethality according to formula (1-1). Pick the strains with small colony morphology, large shrinkage rate, and dark green color as the target strains and transfer them to PDA plate culture. Seed culture and shake flask culture fermentation are carried out to compare the production of echinocandin B, screen the strains with high production of echinocandin B, and calculate the positive and negative mutation rates according to formula (1-2) and formula (1-3) respectively. Determine the numerical relationship between the lethality and the change of mutagenesis time. Figure 1 As shown in the figure, after treatment with a mutagenic concentration (lithium chloride concentration) of 0.4%, the lethality rate increased significantly; when the mutagenic concentration was 1.0%, the lethality rate was close to 100%; when the mutagenic concentration was 1.5%, the lethality rate was between 85% and 90%. According to modern breeding theory, the positive mutation rate is highest when the bacterial lethality rate is 90% to 95%, so 1.5% is selected as the optimal mutagenic concentration.

[0046] Lethality rate = (number of colonies before mutagenesis - number of colonies after mutagenesis) / number of colonies before mutagenesis × 100% (Formula 1-1) Positive mutation rate = mutant strain with ECB yield increased by more than 10% / strain selected after mutagenesis × 100% (Formula 1-2) Negative mutation rate = mutant strain with ECB production reduced by less than 10% / strain selected after mutagenesis × 100% (Formula 1-3) Example 2: Fermentation verification of high-yield strain of Echinocandin B after mutagenesis The dark green strain cultured on the plate of Example 1 for 7 days was scooped with a sterile inoculation shovel with an area of ​​about 1 cm 2The central bacterial block was inoculated into 50 mL of seed culture medium. The culture was carried out at 25 °C, 240 rpm and in the dark for 3 days. After the culture was completed, the seed liquid was viscous and orange-yellow in color.

[0047] After the cultivation, the seed liquid was inoculated with 4 mL of seed liquid in 50 mL of fermentation medium at an inoculation rate of 8% using a sterile 5 mL pipette, and cultured at 25 °C and 240 rpm for 10 days. During the fermentation process, the color first changed from white to orange-red, and then gradually changed from orange-red to dark brown after the fermentation was completed.

[0048] Biomass determination: The drying and weighing method was used to measure the biomass of the bacteria. After recording the weight of the EP tube, 2 mL of the fermentation liquid was placed in a 2 mL EP tube, centrifuged at 4 °C, 12000 rpm for 10 min, the upper liquid was removed, and then washed three times with deionized water. The precipitate was placed in an electric constant temperature blast drying oven at 75 °C until its weight remained constant. Finally, the dry weight of the bacteria was weighed using an analytical balance.

[0049] Detection method of Echinocandin B: 1. Preparation of Echinocandin B standard solution: Take Echinocandin B standard (C 52 H 81 N7O 16 ), with a purity of 70%, was dissolved in pure methanol and diluted into standard solutions of different concentrations (0.14 g / L, 0.28 g / L, 0.42 g / L, 0.56 g / L, 0.7 g / L), and 0.4 mL was filtered through a filter membrane and placed in a liquid phase bottle for liquid phase detection.

[0050] 2. Pretreatment of fermentation broth: Take 1 mL of fermentation broth in a 2 mL EP tube, centrifuge at 12000 rpm for 10 min at 4 °C, and discard the supernatant (the supernatant contains some echinocandin B and impurities. The impurity peaks in the HPLC overlap with the peaks of echinocandin B, which affects the results of HPLC, so the supernatant is removed); transfer the remaining bacteria to a 10 mL centrifuge tube, add an appropriate amount of methanol to 5 mL, mix well, ultrasonically treat for 10 min, let stand for 24 h, and extract echinocandin B at room temperature. Centrifuge the extract for 5 min at 4 °C, filter the extracted liquid through a 0.22 μm organic membrane, and finally complete the liquid chromatography analysis method.

[0051] 3. Liquid phase detection method: Echinocandin B was detected using an Agilent 1260 high performance liquid chromatograph (Agilent 1260 Infinity II LC System, using a C18 chromatographic column (250×4.6mm, 5μm); the mobile phase ratio (volume ratio) was methanol:acetonitrile:water = 7:1:2; the flow rate was 1 mL / min; the UV detector detection wavelength was 222 nm; the injection volume was 20μL; and the column temperature was 40°C. The retention time of echinocandin B was about 15-18 min.

[0052] The yield of high-yield echinocandin B strain obtained by LiCl mutagenesis is as follows Figure 2 As shown. Compared with the starting strain, 17 strains of strains induced by LiCl had significantly higher echinocandin B production than the starting strain. The strain with the highest echinocandin B production was 1392.4 mg / L, and this strain was named UV-14-L.

[0053] Example 3: Mutagenesis of strain UV-14-L using ARTP (atmospheric pressure room temperature plasma) instrument The UV-14-L described in Example 2 was used as the starting strain. The preparation method of the spore suspension was consistent with the method in Example 1. 10 μL of the spore suspension was evenly coated on the sterilized and cooled sample slide, and the sample slide was placed in the ARTP instrument. The ARTP instrument output power was 100 W, the irradiation distance was 1 mm, the gas flow rate was 10 L / min, the sample volume was 10 μL, the gas introduced was helium, and the treatment time was 0 s, 60 s, 120 s, 180 s, 240 s, 270 s, 300 s, 360 s, 420 s, 480 s, 540s, and 600 s, respectively.

[0054] The induced slide was placed in a 1.5 mL centrifuge tube containing 1 mL of sterile saline and vortexed to elute the spore suspension, which was diluted to 1 × 10 -3 After the gradient, take 150 μL~200 μL and evenly spread it on the surface of PDA culture medium, culture at 28 ℃ for 4~5 days, count the Aspergillus nidulans colonies, and determine the numerical relationship between the lethality and the mutagenesis time. Figure 3 As shown in the figure, when the treatment time is 480 s, the lethality is close to 90%. According to modern breeding theory, the positive mutation rate is highest when the bacterial lethality is 90% to 95%, so 480 s is selected as the optimal mutagenesis time. The fermentation verification of the high-yield strain of echinocandin B after mutagenesis treatment is shown in Example 2.

[0055] The yield of the high-yield echinocandin B strain obtained by ARTP mutagenesis is as follows Figure 4As shown. There are 7 strains with higher echinocandin B production than the starting strain UV-14-L obtained by ARTP mutagenesis, namely A2, A20, A28, A31, A36, A46, and A49; among them, the strain A31 with the highest echinocandin B production was 1537.1 mg / L, and it was named UV-14-LA. It can be seen that the composite mutagenesis method can effectively increase the echinocandin B production of Aspergillus nidulans.

[0056] Example 4: Fermentation of Echinocandin B High-yielding Strain after Optimization of Fermentation Broth Pretreatment Seven strains with higher echinocandin B production than the starting strain UV-14-L obtained in Example 3 were re-inoculated on PDA solid medium and incubated at 28°C for 6-7 days to allow the spores of the strains to mature. At this time, the Aspergillus nidulans strains were green or yellow-green. The dark green strains cultured on the plate for 7 days were scooped with a sterile inoculation shovel with an area of ​​about 1 cm 2 The central bacterial block was inoculated into a seed medium with a liquid volume of 50 mL. The culture was carried out at 25 ℃ and 240 rpm in the dark for 3 days. After the culture was completed, the seed liquid was relatively viscous and orange-yellow in color. The seed liquid after the culture was completed was inoculated with 4 mL of seed liquid in a fermentation medium with a liquid volume of 50 mL using a sterile 5 mL pipette at an inoculation rate of 8%, and cultured at 25 ℃ and 240 rpm for 10 days. During the fermentation process, the color first changed from white to orange-red, and then gradually changed from orange-red to dark brown after the fermentation was completed.

[0057] Detection method of Echinocandin B: 1. Preparation of Echinocandin B standard solution: Take Echinocandin B standard (C 52 H 81 N7O 16 ), with a purity of 70%, was dissolved in pure methanol and diluted into standard solutions of different concentrations (0.14 g / L, 0.28 g / L, 0.42 g / L, 0.56 g / L, 0.7 g / L), and 0.4 mL was filtered through a filter membrane and placed in a liquid phase bottle for liquid phase detection.

[0058] 2. Pretreatment of fermentation broth: Take 1 mL of fermentation broth in a 2 mL EP tube, centrifuge at 12000 rpm for 10 min at 4 °C, and discard the supernatant; transfer the remaining bacteria to a 10 mL centrifuge tube, add an appropriate amount of methanol to 10 mL, mix thoroughly, ultrasonicate for 10 min, let stand for 24 h, and extract echinocandin B at room temperature. Centrifuge the extract for 5 min at 4 °C, filter the extracted liquid through a 0.22 μm organic membrane, and finally complete the liquid chromatography analysis method.

[0059] 3. Liquid phase detection method: Echinocandin B was detected using an Agilent 1260 high performance liquid chromatograph (Agilent 1260 Infinity II LC System, using a C18 chromatographic column (250×4.6mm, 5μm); the mobile phase ratio (volume ratio) was methanol:acetonitrile:water = 7:1:2; the flow rate was 1 mL / min; the UV detector detection wavelength was 222 nm; the injection volume was 20μL; and the column temperature was 40°C. The retention time of echinocandin B was about 15-18 min.

[0060] The results are as follows Figure 5 As shown, after optimizing the fermentation broth pretreatment by increasing the content of extractant methanol, there was a significant increase in yield compared with the starting strain, and the echinocandin B production of UV-14-LA was 1627.6 mg / L.

[0061] Example 5: Construction of strains UV-14-LA-E, UV-14-LA-F, UV-14-LA-H, UV-14-LA-I and shake flask fermentation The strain UV-14-LA obtained in Example 4 was used as the starting strain, and the gene encoding acyl-CoA ligase was overexpressed on the plasmid pDHt-gpdA. iD , cytochrome P450 heme iron-dependent oxygenase gene HkDJ , glycosidase gene f , glycoside hydrolase eCE , and then the overexpressed gene was introduced into the Aspergillus nidulans genome through Agrobacterium transformation.

[0062] (1) Construction of plasmid using pDHt-gpdA-I as an example: pDHt-gpdA plasmid was used as a template and restriction endonuclease XbaⅠ was used for digestion to obtain the linearized plasmid pDHt-gpdA-Line. The genome of UV-14 was extracted using a fungal genomic DNA extraction kit. PCR was performed using the ecdI-F / ecdI-R primers in Table 2 and the extracted genome as a template. The PCR product was digested with DpnⅠ at 37 ℃ for 2 h, and the DNA fragment of the PCR product was recovered using a Clean up kit to obtain the ecdI fragment (nucleotide sequence is shown in SEQ ID NO.3). According to the instructions of One step clone kit (Vazyme Biotech, Nanjing, China), the linearized pDHt-gpdA-Line plasmid and ecdI fragment were connected together, and the ligation product was transformed into Escherichia coli DH5α competent cells by chemical transformation and cultured at 37°C for 12-15 h for screening. Finally, clones were selected and verified by sequencing with primers pDHt-VF / pDHt-VR to obtain pDHt-gpdA-I plasmid.

[0063] Similarly, plasmids pDHt-gpdA-E, pDHt-gpdA-F, and pDHt-gpdA-H were obtained. The plasmid map is shown in Figures 6 to 9 shown.

[0064] (2) Introduction of the target gene Agrobacterium transformation method was used to introduce the target gene fragment with a strong promoter into Agrobacterium competent cell AGL1 (from Beijing Huayueyang Biotechnology Co., Ltd.). The pDHt-gpdA-I plasmid was transformed into Agrobacterium competent cell AGL1 by chemical transformation. A single colony of transformed Agrobacterium was picked and inoculated into 10 mL LB medium containing rifampicin and kanamycin, and cultured at 28 ℃, 200 rpm for 48 h. 1.5 mL of culture solution was centrifuged at 4000 rpm for 10 min. The supernatant was discarded, and the bacteria were suspended in 1 mL IM liquid medium containing AS, and centrifuged at 4000 rpm for 10 min. The supernatant was discarded, and the bacteria were suspended in 4 mL IM liquid medium containing AS, and cultured at 28 ℃, 200 rpm for 6~10 h until the OD600 was 0.6~0.8. Take 100 μL of Aspergillus nidulans spores and mix them with 100 μL of Agrobacterium, spread them evenly on an IM plate containing AS covered with sterile cellophane, and culture them in the dark at 24 ℃ for 2~3 days. Carefully transfer the cellophane to a PDA plate containing 50 μg / mL hygromycin and spread it flat. Culture at 28 ℃ in the dark for 4~7 days until the transformants grow. Use a fungal genomic DNA extraction kit to extract the transformant genome, and use primers pDHt-VF / pDHt-VR for sequencing verification to obtain positive transformants with successful introduction of overexpression genes, and successfully construct effective strains UV-14-LA-E, UV-14-LA-F, UV-14-LA-H, and UV-14-LA-I.

[0065] The constructed effective strains were inoculated into seed culture medium for cultivation. The culture conditions and detection methods were the same as those in Example 4. The yield of echinocandin B was as follows: Fig.11 As shown, it can be seen that overexpression eCE , HkDJ , iD All of them can increase the production of echinocandin B in Aspergillus nidulans, among which overexpression iD The gene production increased most significantly, which was beneficial to the synthesis of echinocandin B by Aspergillus nidulans; however, overexpression f The production of echinocandin B was reduced.

[0066] Example 6: Construction of strains UV-14-LA-EJ, UV-14-LA-FJ, UV-14-LA-HJ, UV-14-LA-IJ and shake flask fermentation The strains UV-14-LA-E, UV-14-LA-F, UV-14-LA-H, UV-14-LA-I in Example 5 were combined with the transcription activator gene JbXj To overlay.

[0067] (1) Construction of plasmid pDHt-gpdA-J: Use the ecdJ-F / ecdJ-R primers in Table 2 and the extracted genome as a template to perform PCR to obtain JbXj The other steps were the same as in Example 5, and finally the plasmid pDHt-gpdA-J was obtained. The plasmid map is shown in Fig.10 shown.

[0068] (2) According to the method in Example 5, the plasmid pDHt-gpdA-J with a strong promoter target gene fragment was introduced into the constructed effective strains UV-14-LA-E, UV-14-LA-F, UV-14-LA-H, and UV-14-LA-I. Use a fungal genomic DNA extraction kit to extract the transformant genome, and use primers pDHt-VF / pDHt-VR for sequencing verification to obtain positive transformants with successful introduction of overexpressed genes. The effective strains UV-14-LA-EJ, UV-14-LA-FJ, UV-14-LA-HJ, and UV-14-LA-IJ were successfully constructed. The constructed effective strains were inoculated into seed culture media for culture. The culture conditions and detection methods were the same as those in Example 4. The yield of echinocandin B is shown in Fig.12 As shown, the yields of UV-14-LA-EJ, UV-14-LA-HJ and UV-14-LA-IJ reached 1978.5 mg / L, 1967.2 mg / L and 2136.3 mg / L, respectively; and the yield of UV-14-LA-FJ was also improved on the original basis, indicating that overexpression of transcription activators can further increase the production of echinocandin B.

Claims

1. Aspergillus nidulans UV-14-LA, characterized in that The Aspergillus nidulans is deposited in the China Center for Type Culture Collection, with the deposit number being CCTCC NO: M 20242736 and the deposit date being December 5, 2024.

2. A genetically engineered bacterium, characterized in that: The genetically engineered bacteria is obtained by using the Aspergillus nidulans UV-14-LA described in claim 1 as the starting strain through Agrobacterium transformation; the genetically engineered bacteria has iD Gene, HkDJ Gene, f Gene or eCE Gene.

3. The genetically engineered bacterium according to claim 2, characterized in that: The genetically engineered bacteria also have JbXj Gene.

4. A genetically engineered bacterium, characterized in that: The genetically engineered bacteria is constructed by using the pDHt-gpdA plasmid as a template to construct a recombinant plasmid, transforming the recombinant plasmid into Escherichia coli DH5α competent cells, culturing and screening to obtain clones; then transforming the clones into Agrobacterium competent cells AGL1, culturing to obtain transformed Agrobacterium; then mixing the spores of Aspergillus nidulans UV-14-LA described in claim 1 with the transformed Agrobacterium to obtain transformants; The recombinant plasmid has iD Gene, HkDJ Gene, f Gene or eCE Recombinant plasmid of gene.

5. A method for producing echinocandin B, characterized in that: The Aspergillus nidulans UV-14-LA described in claim 1 is used for fermentation culture.

6. A method for producing echinocandin B, characterized in that: The genetically engineered bacteria according to any one of claims 2 to 4 are used for fermentation culture.

Images