Application and method of glucose dehydrogenase in preparation of NMNH

Abstract

The invention relates to the technical field of gene engineering and enzyme engineering, in particular to application and method of glucose dehydrogenase in preparation of NMNH, it is found that the glucose dehydrogenase can catalyze NMN to be reduced to generate NMNH, the amount of NMNH generated through the catalytic reaction for 12 h reaches 2.08 mM, meanwhile, the glucose dehydrogenase is low in raw material price, and therefore the cost of industrial production of NMNH can be greatly reduced, and the industrial production cost of NMNH can be greatly reduced. The invention lays a foundation for the application of synthesizing NMNH by enzyme catalysis of NMN.

Description

Technical Field

[0001] The invention relates to the technical fields of genetic engineering and enzyme engineering, and in particular to the use and method of glucose dehydrogenase in preparing NMNH. Background Art

[0002] NAD+ (nicotinamide adenine dinucleotide) plays an important role in human health. As we age, the amount of NAD+ in the human body gradually decreases. The reduction of NAD+ affects the ability of cells to produce energy, leading to the occurrence of various diseases during the aging process, such as hearing and vision loss, cognitive and motor dysfunction, immune deficiency, arthritis caused by autoimmune inflammatory response disorders, metabolic disorders and cardiovascular diseases, etc. Increasing the level of NAD+ in the body plays an important role in maintaining biological health. NAD+ has a large molecular mass and it is difficult for it to enter cells. Proper supplementation of NAD+ precursors in the body will help increase the level of NAD+ in the body, thereby reducing the occurrence of diseases.

[0003] Nicotinamide mononucleotide (NMN) and reduced nicotinamide mononucleotide (NMNH) are two NAD+ precursors. It has been proven that supplementing these two precursors can effectively increase the NAD+ level in organisms. NMNH is the reduced form of NMN and is a more effective NAD+ enhancer than NMN. This is mainly reflected in the following aspects: (1) It increases NAD+ faster; (2) It increases NAD+ to a higher concentration; (3) It requires a lower dose to increase NAD+ levels; (4) High levels of NAD+ in the body last longer; (5) It is applicable to a wider range of tissues, etc.

[0004] At present, there are relatively few technologies for synthesizing NMNH, and chemical synthesis and bio-enzyme catalysis have been reported. The chemical synthesis method uses the reducing agent thiourea dioxide (TDO) to reduce NMN to NMNH, and then purifies it by preparative chromatography. In this method, the reducing agent TDO used is irritating to the skin and mucous membranes, and is prone to explosive decomposition under high temperature and impact conditions. At the same time, the cost of preparative chromatography purification technology is relatively high. Compared with the chemical method, the bio-enzyme catalysis method has the advantage of being green and environmentally friendly. The currently reported enzyme-catalyzed synthesis of NMNH technology is to use NADH pyrophosphatase to catalyze NADH (reduced nicotinamide adenine dinucleotide) to generate NMNH and AMP. This method uses the substrate NADH, the raw material is expensive, and the mass loss rate reaches 50%. From an economic point of view, the commercial value of this technology is low.

[0005] Therefore, the current research on the synthesis of NMNH is very insufficient, which seriously limits the commercialization of this important substance. The bio-enzyme catalysis technology mainly relies on efficient functional enzymes. Therefore, for this important substance NMNH, screening suitable dehydrogenases to catalyze the reduction of NMN to generate NMNH will promote the commercialization of NMNH. Summary of the invention

[0006] In view of the above-mentioned shortcomings of the prior art, the object of the present invention is to provide a use and method of glucose dehydrogenase in preparing NMNH, so as to solve the problems in the prior art.

[0007] To achieve the above-mentioned object and other related objects, the present invention provides the use of any of the following substances in the preparation of NMNH: glucose dehydrogenase, glucose dehydrogenase homologous protein, glucose dehydrogenase or its homologous protein encoding gene, nucleic acid construct comprising the encoding gene, cell comprising the nucleic acid construct, cell having exogenous glucose dehydrogenase or its homologous protein encoding gene integrated into the genome.

[0008] Preferably, the use is the use in catalyzing NMN to prepare NMNH.

[0009] The present invention also provides a nucleic acid construct, the nucleotide sequence of the nucleic acid construct is shown as SEQ ID No.19.

[0010] The present invention also provides a cell, wherein the cell contains the nucleic acid construct or an exogenous polynucleotide as shown in SEQ ID No. 18 is integrated into the genome.

[0011] The present invention also provides a method for preparing NMNH, which comprises using glucose dehydrogenase to catalyze NMN to obtain NMNH.

[0012] Preferably, the temperature for catalyzing NMN using glucose dehydrogenase is 25°C-40°C.

[0013] Preferably, the pH value of NMN catalyzed by glucose dehydrogenase is 6-10.

[0014] Preferably, when glucose dehydrogenase is used to catalyze NMN, the initial concentration of NMN is 6 to 60 mM based on the total volume of the catalytic system.

[0015] As described above, the use and method of glucose dehydrogenase in the preparation of NMNH of the present invention have the following beneficial effects: a precedent for the bioenzymatic synthesis of NMNH has been established; when the reaction temperature is controlled at 30°C and pH 8.0, and the initial concentration of NMN is 36mM, the amount of NMNH generated by the catalytic reaction of glucose dehydrogenase for 12h reaches 2.08mM; the technology for preparing NMNH by biological method is green and environmentally friendly, and no toxic chemical reagents are introduced into the reaction system; the raw material price of glucose dehydrogenase is low, which is conducive to the industrial development of NMNH. In short, the present invention lays a foundation for the application of bioenzymatic catalysis of NMN to synthesize NMNH. BRIEF DESCRIPTION OF THE DRAWINGS

[0016] Figure 1 The liquid chromatogram shows the reaction of NMN synthesizing NMNH catalyzed by the glucose dehydrogenase of the present invention. DETAILED DESCRIPTION

[0017] The present invention provides use of any one of the following substances in preparing NMNH: glucose dehydrogenase, a homologous protein of glucose dehydrogenase, a gene encoding glucose dehydrogenase or its homologous protein, a nucleic acid construct comprising the encoding gene, a cell comprising the nucleic acid construct, and a cell having an exogenous gene encoding glucose dehydrogenase or its homologous protein integrated into its genome.

[0018] Homologous proteins in the present invention refer to proteins with obvious similarity in amino acid sequence and performing the same or similar functions in different organisms or the same organism. The similarity is more than 90%, such as more than 95%, more than 96%, more than 97%, more than 98% or more than 99%. The homologous protein can be a mutant obtained by mutation based on wild-type glucose dehydrogenase.

[0019] In certain embodiments of the present invention, the use is for catalyzing NMN to prepare NMNH.

[0020] In certain embodiments of the present invention, the amino acid sequence of the glucose dehydrogenase is as shown in any of SEQ ID NO.1, 9 to 17, or has a sequence identity of more than 90% with the sequence shown in any of SEQ ID NO.1, 9 to 17, and has the functions of the amino acid sequence defined in SEQ ID NO.1, 9 to 17. Further, it can be a sequence obtained by replacing, deleting or adding one or more (specifically 1-50, 1-30, 1-20, 1-10, 1-5 or 1-3) amino acids in the amino acid sequence shown in SEQ ID NO.1, 9 to 17, or a sequence obtained by adding one or more (specifically 1-50, 1-30, 1-20, 1-10, 1-5 or 1-3) amino acids at the N-terminus and / or C-terminus, and having the functions of a polypeptide fragment of the amino acid sequence shown in SEQ ID NO.1, 9 to 17. The amino acid sequence may have a sequence identity of 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or more than 99% with SEQ ID No. 1, 9-17.

[0021] The nucleotide sequences corresponding to the gene encoding the glucose dehydrogenase or its homologous protein include one or more.

[0022] In a specific embodiment, the nucleotide sequence corresponding to the gene encoding glucose dehydrogenase or its homologous protein is shown in SEQ ID No.18:

[0023] atgtatccggatttaaaaggaaaagtcgtcgctattacaggagctgcttcagggctcggaaaggcgatggccattcgctt

[0024] cggcaaggagcaggcaaaagtggttatcaactattatagtaataaacaagatccgaacgaggtaaaagaagaggtcatca

[0025] aggcgggcggtgaagctgttgtcgtccaaggagatgtcacgaaagaggaagatgtaaaaaatatcgtgcaaacggcaatt

[0026] aaggagttcggcacactcgatattatgattaataatgccggtcttgaaaatcctgtgccatctcacgaaatgccgctcaa

[0027] ggattgggataaagtcatcggcacgaacttaacgggtgcctttttaggaagccgtgaagcgattaaatatttcgtagaaa

[0028] acgatatcaagggaaatgtcattaacatgtccagtgtgcacgaagtgattccttggccgttatttgtccactatgcggca

[0029] agtaaaggcgggataaagctgatgacagaaacattagcgttggaatacgcgccgaagggcattcgcgtcaataatattgg

[0030] gccaggtgcgatcaacacgccaatcaatgctgaaaaattcgctgaccctaaacagaaagctgatgtagaaagcatgattc

[0031] caatgggatatatcggcgaaccggaggagatcgccgcagtagcagcctggcttgcttcgaaggaagccagctacgtcaca

[0032] ggcatcacgttatattcgcggacggcggtatgacacaatatccttcattccaggcaggccgcggttaa (SEQ ID No. 18)

[0033] The "nucleic acid construct" refers to an artificially constructed nucleic acid segment that can be introduced into target cells or tissues, and the nucleic acid construct can be various expression vectors.

[0034] The type of expression vector is not specifically limited. An expression vector refers to a nucleic acid molecule that allows the insertion of exogenous nucleotides without destroying the ability of the vector to replicate and / or integrate in a host cell. An expression vector may include a nucleic acid sequence that allows it to replicate in a host cell, such as an origin of replication. An expression vector may also include one or more selective marker genes and other genetic factors. An expression vector is a vector that contains necessary regulatory sequences to allow the transcription and translation of an inserted gene or genes. An expression vector is selected from a eukaryotic expression vector or a prokaryotic expression vector.

[0035] The prokaryotic expression vector is selected from an Escherichia coli expression vector, a Bacillus subtilis expression vector or a Streptomyces expression vector. In a preferred embodiment, the prokaryotic expression vector is selected from an Escherichia coli expression vector. Compared with other expression systems, the Escherichia coli expression system has a clear genetic background, a short culture cycle, a high expression level of the target gene, and strong anti-pollution ability. The Escherichia coli expression vector is, for example, a pET expression vector, specifically pET28a, pET32a, which can be stably expressed in Escherichia coli. The expression vector can also be a pCW expression vector or a pUC expression vector.

[0036] The eukaryotic expression vector is selected from a yeast expression vector, an insect expression vector or a mammalian expression vector. The mammalian expression vector is selected from a retroviral expression vector, a lentiviral expression vector, an adenoviral expression vector, and an adeno-associated viral expression vector. In a preferred embodiment, the eukaryotic expression vector is selected from a retroviral expression vector, which can be stably expressed in a cell line, and the retroviral vector is, for example, pMSCV.

[0037]

[0038] ATTTATACCCATATAAATCAGCATCCATGTTGGAATTTAATCGCGGCCTAGAGCAAGAC

[0039] GTTTCCCGTTGAATATGGCTCATAACACCCCTTGTATTACTGTTTATGTAAGCAGACAG

[0040] TTTTATTGTTCATGACCAAAATCCCTTAACGTGAGTTTTCGTTCCACTGAGCGTCAGAC

[0041] CCCGTAGAAAAGATCAAAGGATCTTCTTGAGATCCTTTTTTTCTGCGCGTAATCTGCTG

[0042] CTTGCAAACAAAAAAACCACCGCTACCAGCGGTGGTTTGTTTGCCGGATCAAGAGCTA

[0043] CCAACTCTTTTTCCGAAGGTAACTGGCTTCAGCAGAGCGCAGATACCAAATACTGTCCT

[0044] TCTAGTGTAGCCGTAGTTAGGCCACCACTTCAAGAACTCTGTAGCACCGCCTACATACC

[0045] TCGCTCTGCTAATCCTGTTACCAGTGGCTGCTGCCAGTGGCGATAAGTCGTGTCTTACC

[0046] GGGTTGGACTCAAGACGATAGTTACCGGATAAGGCGCAGCGGTCGGGCTGAACGGGG

[0047] GGTTCGTGCACACAGCCCAGCTTGGAGCGAACGACCTACACCGAACTGAGATACCTAC

[0048] AGCGTGAGCTATGAGAAAGCGCCACGCTTCCCGAAGGGAGAAAGGCGGACAGGTATC

[0049] CGGTAAGCGGCAGGGTCGGAACAGGAGAGCGCACGAGGGAGCTTCCAGGGGGAAACG

[0050] CCTGGTATCTTTATAGTCCTGTCGGGTTTCGCCACCTCTGACTTGAGCGTCGATTTTTGT

[0051] GATGCTCGTCAGGGGGGCGGAGCCTATGGAAAAACGCCAGCAACGCGGCCTTTTTACG

[0052] GTTCCTGGCCTTTTGCTGGCCTTTTGCTCACATGTTCTTTCCTGCGTTATCCCCTGATTCT

[0053] GTGGATAACCGTATTACCGCCTTTGAGTGAGCTGATACCGCTCGCCGCAGCCGAACGA

[0054] CCGAGCGCAGCGAGTCAGTGAGCGAGGAAGCGGAAGAGCGCCTGATGCGGTATTTTCT

[0055] CCTTACGCATCTGTGCGGTATTTCACACCGCATATATGGTGCACTCTCAGTACAATCTG

[0056] CTCTGATGCCGCATAGTTAAGCCAGTATACACTCCGCTATCGCTACGTGACTGGGTCAT

[0057] GGCTGCGCCCCGACACCCGCCAACACCCGCTGACGCGCCCTGACGGGCTTGTCTGCTC

[0058] CCGGCATCCGCTTACAGACAAGCTGTGACCGTCTCCGGGAGCTGCATGTGTCAGAGGT

[0059] TTTCACCGTCATCACCGAAACGCGCGAGGCAGCTGCGGTAAAGCTCATCAGCGTGGTC

[0060] GTGAAGCGATTCACAGATGTCTGCCTGTTCATCCGCGTCCAGCTCGTTGAGTTTCTCCA

[0061] GAAGCGTTAATGTCTGGCTTCTGATAAAGCGGGCCATGTTAAGGGCGGTTTTTTCCTGT

[0062] TTGGTCACTGATGCCTCCGTGTAAGGGGGATTTCTGTTCATGGGGGTAATGATACCGAT

[0063] GAAACGAGAGAGGATGCTCACGATACGGGTTACTGATGATGAACATGCCCGGTTACTG

[0064] GAACGTTGTGAGGGTAAACAACTGGCGGTATGGATGCGGCGGGACCAGAGAAAAATC

[0065] ACTCAGGGTCAATGCCAGCGCTTCGTTAATACAGATGTAGGTGTTCCACAGGGTAGCC

[0066] AGCAGCATCCTGCGATGCAGATCCGGAACATAATGGTGCAGGGCGCTGACTTCCGCGT

[0067] TTCCAGACTTTACGAAACACGGAAACCGAAGACCATTCATGTTGTTGCTCAGGTCGCA

[0068] GACGTTTTGCAGCAGCAGTCGCTTCACGTTCGCTCGCGTATCGGTGATTCATTCTGCTA

[0069] ACCAGTAAGGCAACCCCGCCAGCCTAGCCGGGTCCTCAACGACAGGAGCACGATCATG

[0070] CGCACCCGTGGGGCCGCCATGCCGGCGATAATGGCCTGCTTCTCGCCGAAACGTTTGG

[0071] TGGCGGGACCAGTGACGAAGGCTTGAGCGAGGGCGTGCAAGATTCCGAATACCGCAA

[0072] GCGACAGGCCGATCATCGTCGCGCTCCAGCGAAAGCGGTCCTCGCCGAAAATGACCCA

[0073] GAGCGCTGCCGGCACCTGTCCTACGAGTTGCATGATAAAGAAGACAGTCATAAGTGCG

[0074] GCGACGATAGTCATGCCCCGCGCCCACCGGAAGGAGCTGACTGGGTTGAAGGCTCTCA

[0075] AGGGCATCGGTCGAGATCCCGGTGCCTAATGAGTGAGCTAACTTACATTAATTGCGTT

[0076] GCGCTCACTGCCCGCTTTCCAGTCGGGAAACCTGTCGTGCCAGCTGCATTAATGAATCG

[0077] GCCAACGCGCGGGGAGAGGCGGTTTGCGTATTGGGCGCCAGGGTGGTTTTTCTTTTCAC

[0078] CAGTGAGACGGGCAACAGCTGATTGCCCTTCACCGCCTGGCCCTGAGAGAGTTGCAGC

[0079] AAGCGGTCCACGCTGGTTTGCCCCAGCAGGCGAAAATCCTGTTTGATGGTGGTTAACG

[0080] GCGGGATATAACATGAGCTGTCTTCGGTATCGTCGTATCCCACTACCGAGATATCCGCA

[0081] CCAACGCGCAGCCCGGACTCGGTAATGGCGCGCATTGCGCCCAGCGCCATCTGATCGT

[0082] TGGCAACCAGCATCGCAGTGGGAACGATGCCCTCATTCAGCATTTGCATGGTTTGTTGA

[0083] AAACCGGACATGGCACTCCAGTCGCCTTCCCGTTCCGCTATCGGCTGAATTTGATTGCG

[0084] AGTGAGATATTTATGCCAGCCAGCCAGACGCAGACGCGCCGAGACAGAACTTAATGGG

[0085] CCCGCTAACAGCGCGATTTGCTGGTGACCCAATGCGACCAGATGCTCCACGCCCAGTC

[0086] GCGTACCGTCTTCATGGGAGAAAATAATACTGTTGATGGGTGTCTGGTCAGAGACATC

[0087] AAGAAATAACGCCGGAACATTAGTGCAGGCAGCTTCCACAGCAATGGCATCCTGGTCA

[0088] TCCAGCGGATAGTTAATGATCAGCCCACTGACGCGTTGCGCGAGAAGATTGTGCACCG

[0089] CCGCTTTACAGGCTTCGACGCCGCTTCGTTCTACCATCGACACCACCACGCTGGCACCC

[0090] AGTTGATCGGCGCGAGATTTAATCGCCGCGACAATTTGCGACGGCGCGTGCAGGGCCA

[0091] GACTGGAGGTGGCAACGCCAATCAGCAACGACTGTTTGCCCGCCAGTTGTTGTGCCAC

[0092] GCGGTTGGGAATGTAATTCAGCTCCGCCATCGCCGCTTCCACTTTTTCCCGCGTTTTCGC

[0093] AGAAACGTGGCTGGCCTGGTTCACCACGCGGGAAACGGTCTGATAAGAGACACCGGC

[0094] ATACTCTGCGACATCGTATAACGTTACTGGTTTCACATTCACCACCCTGAATTGACTCT

[0095] CTTCCGGGCGCTATCATGCCATACCGCGAAAGGTTTTGCGCCATTCGATGGTGTCCGGG

[0096] ATCTCGACGCTCTCCCTTATGCGACTCCTGCATTAGGAAGCAGCCCAGTAGTAGGTTGA

[0097] GGCCGTTGAGCACCGCCGCCGCAAGGAATGGTGCATGCAAGGAGATGGCGCCCAACA

[0098] GTCCCCCGGCCACGGGGCCTGCCACCATACCCACGCCGAAACAAGCGCTCATGAGCCC

[0099] GAAGTGGCGAGCCCGATCTTCCCCATCGGTGATGTCGGCGATATAGGCGCCAGCAACC

[0100] GCACCTGTGGCGCCGGTGATGCCGGCCACGATGCGTCCGGCGTAGAGGATCGAGATCT

[0101] CGATCCCGCGAAATTAATACGACTCACTATAGGGGAATTGTGAGCGGATAACAATTCC

[0102] CCTCTAGAAATAATTTTGTTTAACTTTAAGAAGGAGATATACCATGGGCAGCAGCCATC

[0103] ATCATCATCATCACAGCAGCGGCCTGGTGCCGCGCGGCAGCCATATGGCTAGCATGAC

[0104] TGGTGGACAGCAAATGGGTCGCGGATCCGAATTCGAGCTCCGTCGACAAGCTTGCGGC

[0105] CGCACTCGAGCACCACCACCACCACCACTGAGATCCGGCTGCTAACAAAGCCCGAAAG

[0106] GAAGCTGAGTTGGCTGCTGCCACCGCTGAGCAATAACTAGCATAACCCCTTGGGGCCTCTAAACGGGTCTTGAGGGGTTTTTTGCTGAAAGGAGGAACTATATCCGGAT(SEQ IDNo.19)

[0107] The host cell is selected from eukaryotic host cells or prokaryotic host cells. Eukaryotic host cells are selected from fungi such as yeast, insects, birds, plants, C.elegans or nematodes or mammalian host cells. A non-limiting example of an insect cell is a Spodopterafrugiperda (Sf) cell. An example of a yeast host cell is Saccharomyces cerevisiae (S.cerevisiae), Kluyveromyces lactis (Kluyveromyces lactis, K.lactis) or Yarrowia lipolytica (Yarrowia lipolytica). An example of a mammalian cell is a COS cell, a baby hamster kidney cell, a mouse L cell, a LNCaP cell, a Chinese hamster ovary (CHO) cell, a human embryonic kidney (HEK) cell, an African green monkey cell, a CV1 cell, a Vero or a Hep-2 cell. Examples of prokaryotic host cells include bacterial cells, such as E. coli, Streptomyces, B. subtilis, Salmonella typhi, or mycobacteria.

[0108] Those skilled in the art can transfect the expression vector into host cells according to methods well known in the art to obtain cells containing the coding gene of glucose dehydrogenase or its homologous protein. For example, the expression vector can be introduced into eukaryotic cells by calcium phosphate coprecipitation, electroporation, microinjection, liposome transfection or transfection using a polyamine transfection reagent.

[0109] The present invention also provides a nucleic acid construct, the nucleotide sequence of the nucleic acid construct is shown as SEQ ID No.19.

[0110] The present invention also provides a cell, wherein the cell contains the nucleic acid construct or an exogenous polynucleotide as shown in SEQ ID No. 18 is integrated into the genome.

[0111] It is an existing technology in the art to produce glucose dehydrogenase using the cells.

[0112] The present invention also provides a method for preparing NMNH, which comprises using glucose dehydrogenase to catalyze NMN to obtain NMNH.

[0113] In certain embodiments of the present invention, the temperature for catalyzing NMN using glucose dehydrogenase is 25°C-40°C. For example, the temperature is 25-30°C, 30-35°C, or 35-40°C.

[0114] In certain embodiments of the present invention, the pH value of using glucose dehydrogenase to catalyze NMN is 6-10, for example, pH 6-7, 7-7.5, 7.5-8, 8-8.5, 8.5-9.

[0115] In certain embodiments of the present invention, when glucose dehydrogenase is used to catalyze NMN, the final concentration of glucose dehydrogenase is 0.5 mg / mL to 10.0 mg / mL based on the total volume of the catalytic system. The concentration of glucose in the catalytic system is, for example, 0.5-2 mg / mL, 2-4 mg / mL, 4-6 mg / mL, 6-8 mg / mL, 8-10 mg / mL.

[0116] In certain embodiments of the present invention, when glucose dehydrogenase is used to catalyze NMN, the initial concentration of NMN is 6 to 60 mM based on the total volume of the catalytic system. For example, the initial concentration of NMN is 6 to 10 mM, 10 to 20 mM, 20 to 30 mM, 30 to 35 mM, 35 to 40 mM, 40 to 50 mM, or 50 to 60 mM.

[0117] In certain embodiments of the present invention, the catalytic system for catalyzing NMN using glucose dehydrogenase includes: glucose dehydrogenase, NMN, glucose, NaCl, and pH buffer.

[0118] In certain embodiments of the present invention, based on the total volume of the catalytic system, the concentration of glucose in the catalytic system is 0.05-0.5 mol / L. The concentration of glucose in the catalytic system is, for example, 0.05-0.1 mol / L, 0.1-0.2 mol / L, 0.2-0.3 mol / L, 0.3-0.4 mol / L, 0.4-0.5 mol / L.

[0119] In certain embodiments of the present invention, based on the total volume of the catalytic system, the concentration of NaCl in the catalytic system is 0.5 to 4.0 mol / L. The concentration of NaCl in the catalytic system is, for example, 0.5 to 1 mol / L, 1 to 1.5 mol / L, 1.5 to 2 mol / L, 2 to 2.5 mol / L, 2.5 to 3 mol / L, 3 to 3.5 mol / L, 3.5 to 4 mol / L.

[0120] In certain embodiments of the present invention, the pH buffer is, for example, Tris-HCL buffer.

[0121] In certain embodiments of the present invention, the method comprises the steps of:

[0122] 1) culturing the cells to induce the expression of glucose dehydrogenase, and after the induction, collecting the cells and isolating to obtain an enzyme solution of glucose dehydrogenase;

[0123] 2) Using the enzyme solution obtained in step 1) to catalyze NMN to obtain NMNH.

[0124] In certain embodiments of the present invention, the culture conditions of the cells in step 1) include any of the following: a culture temperature of 25-32° C., a rotation speed of 150-250 rpm, and a culture medium of LB medium.

[0125] In certain embodiments of the present invention, in step 1), when the culture system is cultured to an OD600 of 0.5-1.0, the expression of glucose dehydrogenase is induced.

[0126] In certain embodiments of the present invention, IPTG is used to induce the expression of glucose dehydrogenase in step 1). In certain embodiments of the present invention, the final concentration of IPTG is 0.3 to 0.6 mM based on the total volume of the culture system. In certain embodiments of the present invention, the induction time is 14 to 18 hours.

[0127] In certain embodiments of the invention, the bacterial cells are collected by centrifugation.

[0128] In certain embodiments of the present invention, the separation method is: the collected bacterial cells are disrupted by ultrasound and centrifuged to obtain the enzyme solution of glucose dehydrogenase.

[0129] The following describes the embodiments of the present invention through specific examples, and those skilled in the art can easily understand other advantages and effects of the present invention from the contents disclosed in this specification. The present invention can also be implemented or applied through other different specific embodiments, and the details in this specification can also be modified or changed in various ways based on different viewpoints and applications without departing from the spirit of the present invention.

[0130] Before further describing the specific embodiments of the present invention, it should be understood that the scope of protection of the present invention is not limited to the specific embodiments described below; it should also be understood that the terms used in the examples of the present invention are for describing the specific embodiments rather than for limiting the scope of protection of the present invention; in the present specification and claims, unless otherwise expressly stated herein, the singular forms "a", "an" and "the" include plural forms.

[0131] When the embodiments give numerical ranges, it should be understood that, unless otherwise specified in the present invention, both endpoints of each numerical range and any numerical value between the two endpoints can be selected. Unless otherwise defined, all technical and scientific terms used in the present invention have the same meaning as those generally understood by those skilled in the art. In addition to the specific methods, equipment, and materials used in the embodiments, according to the grasp of the prior art by those skilled in the art and the record of the present invention, any methods, equipment, and materials of the prior art similar or equivalent to the methods, equipment, and materials described in the embodiments of the present invention can also be used to realize the present invention.

[0132] The technical solution adopted in the embodiment is:

[0133] By screening dehydrogenases that catalyze the synthesis of NMN into NMNH, it was found that lactate dehydrogenase, glycerol dehydrogenase, alcohol dehydrogenase, phosphate dehydrogenase, butanol dehydrogenase, alanine dehydrogenase, serine dehydrogenase, and glucose dehydrogenase can all catalyze the conversion of NMN. Preferably, glucose dehydrogenases such as BhGDH (SEQ ID NO.9), BstGDH (SEQ ID NO.10), BvaGDH (SEQ ID NO.11), and BsuGDH (SEQ ID NO.13) have higher conversion effects, among which BsuGDH (SEQ ID NO.13) is the best.

[0134] Example 1: Screening for dehydrogenases that catalyze the synthesis of NMN into NMNH

[0135] Genetic Screening:

[0136] Various dehydrogenases were screened from the NCBI database, and the screened genes were: 1. Glucose dehydrogenase, the amino acid sequence of which is shown in the sequence SEQ ID NO.1 (GenBank: WP_070081367.1; recorded as: BaGDH). 2. Lactate dehydrogenase, the amino acid sequence of which is shown in the sequence SEQ ID NO.2 (GenBank: AKD31452.1; recorded as: BvLDHA). 3. Glycerol dehydrogenase, the amino acid sequence of which is shown in the sequence SEQ ID NO.3 (GenBank: AKD28668.1; recorded as: BvGDE). 4. Alcohol dehydrogenase, the amino acid sequence of which is shown in the sequence SEQID NO.4 (GenBank: WP_132105496.1; recorded as: BmGDH). 5. Phosphate dehydrogenase, the amino acid sequence of which is shown in the sequence SEQID NO.5 (GenBank: AKD30882.1; recorded as: BaPGDH). 6. Butanol dehydrogenase, the amino acid sequence is as shown in SEQ ID NO.6 (GenBank: WP_156240463.1; denoted as: BsYQDH). 7. Alanine dehydrogenase, the amino acid sequence is as shown in SEQ ID NO.7 (GenBank: WP_269386815.1; denoted as: BaADH). 8. Serine dehydrogenase, the amino acid sequence is as shown in SEQ ID NO.8 (GenBank: AKD31204.1; denoted as: BvHDE).

[0137] Construction of host bacteria expressing various dehydrogenases:

[0138] The coding genes of various screened dehydrogenases (glucose dehydrogenase, lactate dehydrogenase, glycerol dehydrogenase, alcohol dehydrogenase, phosphate dehydrogenase, butanol dehydrogenase, alanine dehydrogenase, and serine dehydrogenase) were commissioned to Jiangsu Saisuofei Biotechnology Co., Ltd. for synthesis, cloned into plasmid pET28a, and transformed into BL21 (DE3) hosts respectively to obtain the corresponding engineered bacteria.

[0139] Induce the expression of various dehydrogenases:

[0140] The genetically engineered bacteria expressing glucose dehydrogenase, lactate dehydrogenase, glycerol dehydrogenase, alcohol dehydrogenase, phosphate dehydrogenase, butanol dehydrogenase, alanine dehydrogenase, and serine dehydrogenase were inoculated into 3 mL of test tube LB medium (LB medium composition: yeast powder 5g / L, trypsin 10g / L, sodium chloride 10g / L, pH 7.0) to prepare seed solution. The culture temperature was controlled at 30°C and the rotation speed was 200rpm, and the culture was completed for 16h.

[0141] After the culture was completed, the seed solution was inoculated into a 50 mL shake flask LB medium. The culture conditions were consistent with those when preparing the seed solution, and the culture temperature was controlled at 30 ° C and the rotation speed was 200 rpm. The OD600 value was detected during the culture process. When the OD600 was in the range of 0.5-1.0, IPTG (the final concentration of IPTG was 0.5 mM) was added to induce the expression of the recombinant enzyme (various dehydrogenases), and the induction time was about 16 hours. After the induction was completed, the cells were collected separately under a centrifugal force of 12000g. At the same time, the collected cells were washed twice with Tris-HCl buffer (pH7.5, concentration of 50 mM), and the resulting cells were frozen and stored at -20 ° C.

[0142] Preparation of various dehydrogenases:

[0143] Add 1 mL of Tris-HCl buffer (pH 7.5, concentration of 50 mM) to the above-mentioned frozen bacteria to suspend the cells. The suspended bacteria were broken with an ultrasonic disruptor (model SCIENTZ-IID, Ningbo Xinzhi Biotechnology Co., Ltd.). The breaking conditions were: ultrasonic for 3 seconds, stop for 6 seconds, and the total ultrasonic time was 5 minutes. The broken enzyme solution was centrifuged at 12000g and 4°C for 10 minutes, and the supernatant obtained was the enzyme solution containing glucose dehydrogenase, lactate dehydrogenase, glycerol dehydrogenase, alcohol dehydrogenase, phosphate dehydrogenase, butanol dehydrogenase, alanine dehydrogenase, and serine dehydrogenase, which can be used for subsequent enzyme catalysis experiments.

[0144] Screening for dehydrogenases that catalyze the synthesis of NMN into NMNH:

[0145] The crude enzyme solutions of glucose dehydrogenase, lactate dehydrogenase, glycerol dehydrogenase, alcohol dehydrogenase, phosphate dehydrogenase, butanol dehydrogenase, alanine dehydrogenase, and serine dehydrogenase obtained above were subjected to enzyme catalysis experiments to investigate the conversion rate of NMN to NMNH. The enzyme catalysis system consists of 800 μL of 50 mM pH 7.5 Tris-HCl buffer, 100 μL of 60 mM NMN solution, 50 μL of 20 M NaCl solution, 50 μL of 2 M substrate solution, and 5 mg / mL of enzyme solution. The substrate solution selects different substrates according to the detected enzyme, such as glucose dehydrogenase using glucose as a substrate, lactate dehydrogenase using lactic acid as a substrate, glycerol dehydrogenase using glycerol as a substrate, alcohol dehydrogenase using ethanol as a substrate, phosphate dehydrogenase using phosphate as a substrate, butanol dehydrogenase using n-butanol as a substrate, alanine dehydrogenase using alanine as a substrate, and serine dehydrogenase using serine as a substrate. Enzyme catalytic reaction conditions: temperature 30°C, shaker speed 50rpm. The enzyme catalytic reaction starts with the addition of substrate NMN and ends after 12h. After the end, 1mL of sample is taken for HPLC analysis of NMN and NMNH content. The appropriate dehydrogenase is preliminarily determined based on the NMNH content in the reaction solution.

[0146] in conclusion:

[0147] According to the data of enzyme catalytic reaction, glucose dehydrogenase, lactate dehydrogenase, glycerol dehydrogenase, alcohol dehydrogenase, phosphate dehydrogenase, butanol dehydrogenase, alanine dehydrogenase, and serine dehydrogenase reacted for 12 hours, and the content of NMN in the reaction system can be reduced. The results are shown in the table below. Among them, glucose dehydrogenase, the amino acid sequence of SEQ ID NO.1 (GenBank: WP_070081367.1; denoted as: BaGDH) has better performance.

[0148] Different dehydrogenases catalyze NMN

[0149]

[0150] Example 2: Screening for glucose dehydrogenase that catalyzes the synthesis of NMN into NMNH

[0151] The homologous genes of glucose dehydrogenase (SEQ ID NO.1, GenBank: WP_070081367.1) were screened from the NCBI database. The amino acid sequences of the screened glucose dehydrogenase homologous genes are as follows: SEQ ID NO.9 (GenBank: WP_202647102.1; recorded as: BhGDH), SEQ ID NO.10 (GenBank: WP_243572584.1; recorded as: BstGDH), SEQ ID NO.11 (GenBank: WP_100741417.1; recorded as: BvaGDH), SEQ ID NO.12 (GenBank: WP_025284235.1; recorded as: BveGDH), SEQ ID NO.13 (GenBank: WP_003246720.1; recorded as: BsuGDH), SEQ ID NO.14 (GenBank: WP_180358503.1; recorded as: EcGDH), SEQ ID NO.15 (GenBank: WP_135800292.1; recorded as: KoGDH), SEQ ID NO.16 (GenBank: EGN2788592.1; recorded as: SeGDH), SEQ ID NO.17 (GenBank: HCD1253839.1; recorded as: CaGDH). The genes encoding glucose dehydrogenase screened were commissioned to Jiangsu Saisuofei Biotechnology Co., Ltd. for synthesis, cloned into plasmid pET28a, and transformed into BL21 (DE3) hosts respectively. The obtained engineered bacteria were recorded as BL21-BaGDH; BL21-BhGDH; BL21-BstGDH; BL21-BvaGDH; BL21-BveGDH; BL21-BsuGDH; BL21-EcGDH; BL21-KoGDH; BL21-SeGDH; BL21-CaGDH.

[0152] Induce glucose dehydrogenase expression:

[0153] The genetically engineered bacteria BL21-BaGDH; BL21-BhGDH; BL21-BstGDH; BL21-BvaGDH; BL21-BveGDH; BL21-BsuGDH; BL21-EcGDH; BL21-KoGDH; BL21-SeGDH; BL21-CaGDH obtained above were inoculated into 3 mL of test tube LB medium (LB medium composition: yeast powder 5g / L, trypsin 10g / L, sodium chloride 10g / L, pH 7.0) to prepare seed solution. The culture temperature was controlled at 30°C and the rotation speed was 200rpm, and the culture was completed after 16 hours.

[0154] After the culture was completed, the seed solution was inoculated into a 50 mL shake flask LB medium. The culture conditions were consistent with those when preparing the seed solution, and the culture temperature was controlled at 30 ° C and the rotation speed was 200 rpm. The OD600 value was detected during the culture process. When the OD600 was in the range of 0.5-1.0, IPTG (IPTG final concentration was 0.5 mM) was added to induce the expression of the recombinase, and the induction time was about 16 hours. After the induction was completed, the bacteria were collected under a centrifugal force of 12000g. At the same time, the collected bacteria were washed twice with Tris-HCl buffer (pH7.5, concentration of 50 mM), and the resulting bacteria were stored frozen at -20 ° C.

[0155] Preparation of glucose dehydrogenase:

[0156] Add 1 mL of Tris-HcL buffer (pH 7.5, concentration 50 mM) to the above frozen bacteria to suspend the cells. The suspended bacteria were broken with an ultrasonic disruptor (model SCIENTZ-IID, Ningbo Xinzhi Biotechnology Co., Ltd.). The breaking conditions were: ultrasonic for 3 seconds, stop for 6 seconds, and the total ultrasonic time was 5 minutes. The broken enzyme solution was centrifuged at 12000g and 4°C for 10 minutes. The supernatant obtained was the enzyme solution containing glucose dehydrogenase, which can be used for subsequent enzyme catalysis experiments.

[0157] Screening of glucose dehydrogenase that catalyzes the synthesis of NMN into NMNH:

[0158] The glucose dehydrogenase solution obtained above was subjected to an enzyme catalytic experiment to investigate the conversion rate of NMN to NMNH. The enzyme catalytic system consists of 800 μL of 50 mM pH 7.5 Tris-HCl buffer, 100 μL of 60 mM NMN solution, 50 μL of 2 M glucose solution, 50 μL of 20 M NaCl solution, and 5 mg / ml of enzyme solution. Enzyme catalytic reaction conditions: temperature 30 ° C, shaker speed 50 rpm. The enzyme catalytic reaction starts with the input of substrate NMN. After the input of NMN, 1 mL was sampled from the reaction bottle, and the concentration of NMN in the initial reaction solution was detected by HPLC (recorded as 0 h); the reaction was terminated after 12 h, and 1 mL was sampled. HPLC analyzed the residual amount of NMN at the end of the reaction (12 h) and the amount of NMNH generated. The conversion rate was calculated based on the concentration of NMN at the beginning of the reaction, the residual amount of NMN at the end of the reaction, and the amount of NMNH generated.

[0159] The NMNH conversion rate was calculated according to formula ①:

[0160] B(12) / [A(0)–A(12)]×100%①

[0161] Among them, A(0) is the concentration of NMN at the beginning of the reaction; A(12) is the concentration of NMN in the reaction bottle after 12 hours of reaction; B(12) is the concentration of NMNH in the reaction bottle after 12 hours of reaction.

[0162] Detection method of NMN and NMNH: BioCore SAX 5um 4.6*250mm chromatographic column was used, the injection volume was 5μL, the mobile phase was 50mM disodium hydrogen phosphate, the flow rate was controlled at 0.5mL / min, the column oven temperature was 25℃, and the detection wavelength of NMN and NMNH was 225nm.

[0163] The conversion rates of glucose dehydrogenase from different sources after 12 h of reaction are shown in Table 1.

[0164] Table 1 Conversion rate of glucose dehydrogenase from different sources

[0165]

[0166] According to the results in Table 1, it was preliminarily determined that the conversion rates of glucose dehydrogenases such as BhGDH, BstGDH, BvaGDH, and BsuGDH were relatively high, reaching more than 10%; especially the glucose dehydrogenase BsuGDH, with a conversion rate of 13.23%. In addition, the liquid chromatogram of glucose dehydrogenase (BsuGDH, SEQ ID NO.13, GenBank: WP_003246720.1) catalyzing NMN to NMNH after 12 hours of reaction is shown in Figure 1 , it can be seen that NMNH is produced.

[0167] Example 3: Optimization of Glucose Dehydrogenase Catalytic Reaction Conditions

[0168] The strain BL21-BsuGDH was used as the starting strain, and glucose dehydrogenase enzyme solution was prepared after induced expression and cell disruption. The prepared enzyme solution was used to subsequently investigate the enzyme catalytic performance of glucose dehydrogenase under different temperatures, different pH values, and different initial NMN concentrations.

[0169] (1) Catalytic performance of glucose dehydrogenase at different temperatures

[0170] The performance of the prepared glucose dehydrogenase in catalyzing the synthesis of NMNH from NMN at different temperatures was investigated. The enzyme catalytic system consists of 800 μL of 50 mM pH 7.5 Tris-HCL buffer, 100 μL of 60 mM NMN, 50 μL of 2 M glucose, 50 μL of 20 M NaCl, and 5 mg / ml of enzyme solution. The reaction conditions of enzyme catalysis: the temperature was set at 25 ° C, 30 ° C, 37 ° C, and 40 ° C, and the shaking speed was 50 rpm. The enzyme-catalyzed reaction started with the addition of substrate NMN and ended after 12 hours. After the end, 1 mL of sample was taken out of the reaction bottle, and the amount of NMNH generated in the reaction solution was detected by HPLC. The results of glucose dehydrogenase catalyzing the synthesis of NMNH from NMN at different temperatures are shown in Table 3.

[0171] Table 3 The yield of NMNH synthesized by glucose dehydrogenase at different temperatures

[0172]

[0173] According to the yield of NMNH synthesized by glucose dehydrogenase at different temperatures in Table 3, glucose dehydrogenase can catalyze NMN to synthesize NMNH in the range of 25°C to 40°C. Among them, the amount of NMNH synthesized at 30°C is the highest, reaching 0.794mM.

[0174] (2) Catalytic performance of glucose dehydrogenase at different pH

[0175] The performance of the prepared glucose dehydrogenase in catalyzing the synthesis of NMNH from NMN at different pH values ​​was investigated. The enzyme catalytic system consists of 100 μL of 60 mM NMN, 50 μL of 2 M glucose, 50 μL of 20 M NaCl, 5 mg / ml of enzyme solution, and 800 μL of buffer. Reactions at different pH values ​​were controlled by using different pH buffers: pH 7.5 (50 mM pH 7.5 Tris-HCL buffer), pH 8.0 (50 mM pH 8.0 Tris-HCL buffer), pH 8.5 (50 mM pH 8.5 Tris-HCL buffer), and pH 9.0 (50 mM pH 9.0 Tris-HCL buffer). Enzyme-catalyzed reaction conditions: temperature 30 ° C, shaker speed 50 rpm. The enzyme-catalyzed reaction started with the addition of substrate NMN and ended after 12 h. After the end, 1 mL of sample was taken out from the reaction bottle, and the amount of NMNH generated in the reaction solution was detected by HPLC. The results of glucose dehydrogenase catalyzing NMN to NMNH at different pH values ​​are shown in Table 4.

[0176] Table 4 The yield of NMNH synthesized by glucose dehydrogenase at different pH values

[0177]

[0178] According to the yield of NMNH synthesized by glucose dehydrogenase at different pH values ​​in Table 4, glucose dehydrogenase can synthesize NMNH in the pH range of 7.5-9.0, among which the amount of NMNH synthesized at pH 8.0 is the highest, reaching 0.805mM.

[0179] (3) The yield of NMNH synthesized by glucose dehydrogenase at different initial NMN concentrations

[0180] The yield of NMNH synthesized by the prepared glucose dehydrogenase at different initial NMN concentrations was investigated. The enzyme-catalyzed reaction system consisted of 100 μL of NMN mother solution (the mother solution concentrations were 60 mM, 180 mM, 360 mM, and 540 mM, respectively), 50 μL of 2 M glucose, 50 μL of 20 M NaCl, and 800 μL of 50 mM pH 8.0 Tris-HCL buffer. Enzyme-catalyzed reaction conditions: temperature 30 ° C, shaker 50 rpm. The enzyme-catalyzed reaction started with the addition of substrate NMN and ended after 12 h. After the reaction, 1 mL of sample was taken out of the reaction bottle, and the amount of NMNH generated in the reaction solution was detected by HPLC. The results of glucose dehydrogenase synthesizing NMNH at different initial NMN concentrations are shown in Table 4.

[0181] Table 5 The yield of NMNH synthesized by glucose dehydrogenase at different initial NMN concentrations

[0182]

[0183] According to the yield of NMNH synthesized by glucose dehydrogenase at different initial concentrations of NMN in Table 5, it can be seen that glucose dehydrogenase can convert and synthesize NMNH at different concentrations. Among them, when the initial NMN concentration is 36mM, the yield of synthesized NMNH is the highest, reaching 2.08mM.

[0184] The above examples are for the purpose of illustrating the embodiments disclosed by the present invention and are not to be construed as limiting the present invention. In addition, the various modifications listed herein and the variations of the methods in the invention are obvious to those skilled in the art without departing from the scope and spirit of the present invention. Although the present invention has been specifically described in conjunction with various specific preferred embodiments of the present invention, it should be understood that the present invention should not be limited to these specific embodiments. In fact, various modifications as described above that are obvious to those skilled in the art to obtain the invention should be included within the scope of the present invention.

Claims

1. Use of any of the following substances in the preparation of NMNH: glucose dehydrogenase, a homologous protein of glucose dehydrogenase, a gene encoding glucose dehydrogenase or a homologous protein thereof, a nucleic acid construct comprising the encoding gene, a cell comprising the nucleic acid construct, a cell having an exogenous gene encoding glucose dehydrogenase or a variant thereof integrated into its genome.

2. The use according to claim 1, characterized in that The use is to catalyze NMN to prepare NMNH.

3. The use according to claim 1, characterized in that The amino acid sequence of the glucose dehydrogenase is as shown in SEQ ID NO. 1, 9 to 17, or a sequence having a sequence identity of 90% or more to a sequence shown in any one of SEQ ID Nos. 1, 9 to 17, and having the function of an amino acid sequence defined by SEQ ID Nos. 1, 9 to 17.

4. The use according to claim 1, characterized in that The nucleotide sequence of the gene encoding the glucose dehydrogenase or its homologous protein is shown in SEQ ID No.

18.

5. The use according to claim 1, characterized in that: The nucleic acid construct is an expression vector, and the expression vector is selected from a eukaryotic expression vector or a prokaryotic expression vector; preferably, the prokaryotic expression vector is selected from an Escherichia coli expression vector, a Bacillus subtilis expression vector or a Streptomyces expression vector; more preferably, the nucleotide sequence of the nucleic acid construct is shown in SEQ ID No.

19.

6. A nucleic acid construct, characterized in that The nucleotide sequence of the nucleic acid construct is shown in SEQ ID No.

19.

7. A cell, characterized in that The cell contains the nucleic acid construct of claim 6 or an exogenous polynucleotide as shown in SEQ ID No. 18 integrated into its genome.

8. A method for preparing NMNH, characterized in that: The preparation method includes using glucose dehydrogenase to catalyze NMN to obtain NMNH.

9. The method according to claim 8, characterized in that Also includes any one or more of the following features: 1) The temperature for using glucose dehydrogenase to catalyze NMN is 25°C-40°C; 2) Using glucose dehydrogenase to catalyze NMN at a pH of 6-10; 3) When glucose dehydrogenase is used to catalyze NMN, the final concentration of glucose dehydrogenase is 0.5 mg / mL to 10.0 mg / mL based on the total volume of the catalytic system; 4) When glucose dehydrogenase is used to catalyze NMN, the initial concentration of NMN is 6 to 60 mM based on the total volume of the catalytic system; 5) The catalytic system using glucose dehydrogenase to catalyze NMN also includes glucose, NaCl, and pH buffer; preferably, based on the total volume of the catalytic system, the concentration of glucose in the catalytic system is 0.05-0.5 mol / L; preferably, based on the total volume of the catalytic system, the concentration of NaCl in the catalytic system is 0.5-2.0 mol / L.

10. The method according to claim 8, characterized in that The method comprises the following steps: 1) culturing the cell according to claim 7, inducing the expression of glucose dehydrogenase, collecting the cells after the induction and separating to the enzyme solution of glucose dehydrogenase; 2) Using the enzyme solution obtained in step 1) to catalyze NMN to obtain NMNH.

Images