The invention relates to a high-expression molecular marker 5apos for gastric cancer screening. -tiRNAGly

Abstract

The invention provides a high-expression molecular marker 5 '-tiRNAGly for gastric cancer screening, and relates to the technical field of biomedicine, the invention provides the high-expression molecular marker for gastric cancer screening, and the high-expression molecular marker is characterized in that the molecular marker is 5'-tiRNAGly, and the 5 '-tiRNAGly is derived from 5'-half of tRNA-Gly-GCC. A specific verification experiment proves that the 5 '-tiRNAGly can be used as a gastric cancer diagnosis marker, the gastric cancer can be diagnosed and predicted by detecting the expression quantity of the 5'-tiRNAGly in serum, and the 5 '-tiRNAGly has the advantages of high specificity and sensitivity and the like.

Description

Technical Field

[0001] The present invention relates to the field of biomedical technology, and in particular to a highly expressed molecular marker 5′ tiRNA for gastric cancer screening Gly . Background Art

[0002] Gastric cancer is one of the most common malignant tumors in the world, with the morbidity and mortality ranking fifth and fourth in the world, respectively. Gastric cancer usually has no obvious symptoms in the early stages. In addition, the sensitivity and specificity of traditional markers suitable for gastric cancer screening are low, resulting in many gastric cancer patients reaching the advanced stage of gastric cancer when they are discovered, with a poor prognosis. In recent years, although substantial progress has been made in the treatment of gastric cancer, further research and development is still needed. Current gastric cancer biomarkers, including carcinoembryonic antigen (CEA), carbohydrate antigen 199 (CA199), and carbohydrate antigen 724 (CA724), have a low positive rate in the diagnosis of gastric cancer. Therefore, it is of great clinical significance to explore diagnostic markers with high sensitivity and specificity and specific mechanisms of action in gastric cancer.

[0003] tRNA-derived small RNAs (tsRNAs) are found to be derivative fragments produced by specific cleavage of precursor tRNA or mature tRNA by different nucleases under specific circumstances. They can be divided into tRNA-derived fragments (tRFs) and tRNA halves (tiRNAs) according to the different cleavage sites. tsRNAs have significant differences in the body fluids of patients with various cancers, have good diagnostic efficacy, and have the potential to become good tumor diagnostic markers. If tsRNAs are combined with liquid biopsy technology to screen out tsRNAs that have significant differences in the experience of gastric cancer patients, and in clinical practice, the expression levels of tsRNAs in patient fluid samples are detected and analyzed to monitor the patient's tumor progression in real time, it will open up a new way for the clinical diagnosis of gastric cancer.

[0004] tsRNAs can play biological roles through a variety of regulatory mechanisms, including interacting with proteins or mRNAs to regulate gene transcription and translation, epigenetic modification and cell cycle, etc. With the development of high-throughput sequencing technology, more and more studies have found that the dysregulation of tsRNAs is closely related to the occurrence and development of tumors. Therefore, finding dysregulated tsRNAs in gastric cancer and exploring their specific mechanisms of action are of great significance for the diagnosis and treatment of gastric cancer. Summary of the invention

[0005] The purpose of the present invention is to find dysregulated tsRNAs in gastric cancer and explore their specific mechanism of action for the diagnosis and treatment of gastric cancer.

[0006] In order to achieve the above object, the present invention adopts the following technical solutions:

[0007] A highly expressed molecular marker for gastric cancer screening, characterized in that: the molecular marker is 5'-tiRNA Gly , the 5′-tiRNA Gly It is derived from the 5'-half of tRNA-Gly-GCC.

[0008] The present application also provides the 5′-tiRNA described above Gly Its application as a detection target in the preparation of diagnostic gastric cancer products.

[0009] Preferably, the product is a reagent or a kit.

[0010] Preferably, the product is verified by 5′-tiRNA Gly The expression dynamics of TNF-α can be used to monitor the prognosis of gastric cancer patients.

[0011] Based on the above application, the present application provides a detection kit for gastric cancer, characterized in that: the detection kit is based on 5′-tiRNA Gly To detect the target.

[0012] Preferably, the detection kit also includes other medically acceptable reagents.

[0013] The present application also provides the 5′-tiRNA described above Gly Application as a target in the preparation of products for the treatment of gastric cancer.

[0014] Preferably, the drug is used to inhibit 5′-tiRNA Gly .

[0015] Compared with the prior art, this application has the following beneficial effects:

[0016] (1) The present invention first discovered and confirmed the highly expressed 5′-tiRNA Gly It can be used as a diagnostic marker for gastric cancer by detecting 5′-tiRNA in serum Gly The expression level can be used to diagnose and predict gastric cancer, and it can also distinguish gastric cancer patients from gastritis patients. It is convenient to sample and easy to detect, and has the advantages of high sensitivity and specificity.

[0017] (2) The present invention detected and found that 5′-tiRNA Gly The expression of 5′-tiRNA in gastric cancer tissue was significantly higher than that in adjacent tissues, and that in the serum of gastric cancer patients was significantly higher than that of healthy subjects. The expression of 5′-tiRNA in the serum of gastric cancer patients was higher than that of human gastric mucosal epithelial cell lines. GlyThe expression level of 5′-tiRNA was correlated with T stage, lymph node metastasis, TNM stage and nerve / vascular invasion; Gly The expression level of 5′-tiRNA was reduced. Gly It can be used as a diagnostic marker for gastric cancer and dynamically monitor the prognosis of gastric cancer patients;

[0018] (3) The present invention found that 5′-tiRNA Gly It has good stability, its detection method is not easily affected by external factors, has good reproducibility, and the SYBR Green fluorescent dye method can simultaneously detect 5′-tiRNA without the need to design a separate probe Gly and internal reference genes, which are economical and convenient;

[0019] (4) Biomarker 5′-tiRNA provided by the present invention Gly The sensitivity of distinguishing gastric cancer patients from healthy subjects in serum was 0.74, the specificity was 0.87, and the AUC was 0.837, which was higher than that of conventional gastric cancer biomarkers CEA, CA199, and CA724. The AUC increased continuously after combining with these three biomarkers, and reached the maximum value after combining with the four biomarkers, further improving the 5′-tiRNA Gly The diagnostic efficacy of

[0020] (5) The present invention detected and found that 5′-tiRNA Gly It can also distinguish patients with gastric cancer from patients with gastritis. Gly The expression of 5′-tiRNA in the serum of patients with gastric cancer was significantly higher than that in patients with gastritis. Gly The AUC in patients with gastric cancer and gastritis was 0.779, which was higher than that of CEA, CA199, and CA724. The AUC continued to increase after being combined with these three, and reached the maximum value after the combination of the four.

[0021] (6) 5′-tiRNA of the present invention Gly Correlation with proliferation of gastric cancer using 5′-tiRNA in PDX models Gly Antagomir can inhibit tumor growth. The 3' end of antogimir is modified with cholesterol, the 5' end is modified with two thio skeletons, the 3' end is modified with four thio skeletons, and the whole chain is modified with methoxy groups. It has a higher affinity with the cell membrane and can be enriched in target cells to achieve efficient, specific and stable interference. The drug candidate is a biological product that is effective in treating gastric cancer.

[0022] (7) The present invention infers 5′-tiRNA based on experimental results Gly It has an inhibitory effect on the Warburg effect in gastric cancer cells, and further studies have found that OGDHL can act as a 5′-tiRNAGly Target molecules affecting gastric cancer, elucidating 5′-tiRNA Gly The mechanism of regulating the Warburg effect in gastric cancer cells provides new targets and technical support for targeted treatment of gastric cancer. BRIEF DESCRIPTION OF THE DRAWINGS

[0023] Figure 1 5′-tiRNA in gastric cancer tissue Gly of screening; among which: Figure 1 A is a heat map of differential tsRNAs in three pairs of GC tissues and adjacent tissues; Figure 1 B is qRT-PCR detection of 5′-tiRNA in 50 pairs of GC tissues Gly The expression level of Figure 1 C is the 5′-tiRNA in the UCSC database Gly biological information; Figure 1 D is 5′-tiRNA in MINTbase v2.0 Gly biological information; Figure 1 E is 5′-tiRNA Gly Schematic diagram of the structure; Figure 1 F is 5′-tiRNA Gly Amplification curve of Figure 1 G is 5′-tiRNA Gly Melting curve of

[0024] Figure 2 To detect 5′-tiRNA Gly Methodological assessment of Figure 2 A After being placed at room temperature and repeatedly frozen and thawed for a period of time, 5′-tiRNA Gly ct value; Figure 2 B is the detection of 5′-tiRNA by agarose gel electrophoresis Gly ;

[0025] Figure 3 5′-tiRNA Gly Diagnostic value in gastric cancer serum; among them: Figure 3 A is qRT-PCR detection of 5′-tiRNA in the serum of patients with gastric cancer, gastritis and healthy subjects Gly The expression level of Figure 3 B is 5′-tiRNA in patients with gastric cancer before and after surgery Gly Comparison of expression levels; Figure 3 C-3E is 5′-tiRNA Gly , independent and combined ROC analysis of CEA, CA199 and CA724 in the serum of gastric cancer patients and healthy subjects; Figure 3 F-3H is 5′-tiRNA Gly, independent and combined ROC analysis of CEA, CA199 and CA724 in the serum of patients with gastric cancer and gastritis;

[0026] Figure 4 5′-tiRNA Gly Functional studies in vivo and in vitro; including: Figure 4 A: qRT-PCR detection of 5′-tiRNA Gly Expression levels in GC cell lines; Figure 4 B: qRT-PCR detection of 5′-tiRNA Gly The transfection efficiency; Figure 4 C and 4D are CCK-8 assays to detect transfected 5′-tiRNA Gly Effects of inhibitors and mimetics on the proliferation ability of GC cells; Figure 4 E and 4F are colony formation assays to detect transfected 5′-tiRNA Gly Effects of inhibitors and mimetics on the proliferation ability of GC cells; Figure 4 G and 4H are EdU assays to detect transfected 5′-tiRNA Gly Effects of inhibitors and mimetics on the proliferation ability of GC cells; Figure 4 I is a schematic diagram of the gastric cancer PDX model; Figure 4 J is the size of the tumor; Figure 4 K is the weight of the tumor; Figure 4 L is the tumor inhibition rate; Figure 4 M is the HE and IHC staining results of tumor tissue;

[0027] Figure 5 5′-tiRNA gly Targeted regulation of OGDHL expression; including: Figure 5 A: FISH experiment to detect 5′-tiRNA Gly cellular localization; Figure 5 B is 5′-tiRNA Gly The nuclear-cytoplasmic distribution ratio in the cell; Figure 5 C is KEGG biological pathway enrichment analysis of 5′-tiRNA Gly Functions; Figure 5 D is the prediction of 5′-tiRNA by miRanda and TargetScan database Gly Potential downstream target genes; Figure 5 E is the intersection of the two databases, target genes, metabolic pathways and glycolysis processes, and 5′-tiRNAs are predicted together Gly Potential downstream target genes; Figure 5 F is the detection of transfected 5′-tiRNA Gly The expression levels of three target genes in two GC cells after mock treatment; Figure 5G is a schematic diagram of the dual luciferase reporter gene experiment; Figure 5 H is a dual luciferase reporter gene experiment to verify the interaction between OGDHL and 5′-tiRNA Gly The combination relationship;

[0028] Figure 6 5′-tiRNA Gly Targeting OGDHL promotes the Warburg effect and progression of gastric cancer; among them: Figure 6 A is the detection of transfected 5′-tiRNA Gly changes in glucose uptake and lactate production after inhibitors and mimics; Figure 6 B is the expression level of OGDHL in TCGA and GTEx databases; Figure 6 C is the expression level of OGDHL in gastric cancer tissue; Figure 6 D is the expression level of OGDHL in gastric cancer cell lines; Figure 6 E is the effect of overexpression and interference of OGDHL on the proliferation ability of gastric cancer cells detected by CCK-8 assay; Figure 6 F is the clone formation test to detect the effect of overexpression and interference of OGDHL on the proliferation ability of GC cells; Figure 6 G is the EdU test to detect the effects of overexpression and interference of OGDHL on the proliferation ability of GC cells; Figure 6 H is 5′-tiRNA Gly The effects of mimics and inhibitors in the CCK-8 assay were restored by overexpression or disruption of OGDHL; Figure 6 I is 5′-tiRNA Gly The effects of mimics and inhibitors in clonogenic assays were restored by overexpression or disruption of OGDHL; Figure 6 J is 5′-tiRNA Gly The effects of mimics and inhibitors on glucose uptake and lactate production were restored by overexpression or disruption of OGDHL. DETAILED DESCRIPTION

[0029] The present invention is further described in detail below in conjunction with specific embodiments.

[0030] A highly expressed molecular marker for gastric cancer screening, wherein the molecular marker is 5′-tiRNA Gly , the 5′-tiRNA Gly It is derived from the 5'-half of tRNA-Gly-GCC.

[0031] Based on the above content, the present application also provides 5′-tiRNA Gly Application in the preparation of a product for diagnosing gastric cancer, wherein the product is a reagent or a kit.

[0032] The product was verified by 5′-tiRNA Gly The expression dynamics of TNF-α can be used to monitor the prognosis of gastric cancer patients.

[0033] The present application also provides a detection kit for gastric cancer, wherein the detection kit is based on 5′-tiRNA Gly To detect the target.

[0034] In one embodiment, the detection kit further includes other medically acceptable reagents.

[0035] The above contents are verified by specific verification experiments as follows:

[0036] Example 1: Expression profile of tsRNA and 5′-tiRNA in gastric cancer tissue Gly Filter

[0037] In order to identify new biomarkers in gastric cancer tissues and study the molecular mechanisms involved, this application collected 3 pairs of gastric cancer and adjacent tissues for tsRNA sequencing ( Figure 1 A) Based on the average expression of each group and the uniformity of fluorescence signals, the top three tsRNAs with significantly upregulated expression were selected for verification in this application. qRT-PCR results showed that 5′-tiRNA Gly In 50 pairs of gastric cancer tissues, the expression was significantly higher than that in the corresponding adjacent tissues ( Figure 1 B) UCSC database shows that 5′-tiRNA Gly Located on chromosome chr1: 161,413,094-161,413,124, length 31nt ( Figure 1 C) MINTbase database shows that 5′-tiRNA Gly It is derived from the 5'-half of tRNA-G1y-GCC, and the cleavage site is shown in the figure ( Figure 1 D and 1E). The smooth amplification curve and single-peak melting curve demonstrate the specificity of the detection method ( Figure 1 F and 1G).

[0038] Example 2: 5′-tiRNA Gly Methodological evaluation

[0039] To study the detection of 5′-tiRNA Gly Whether the expression level method can be applied to clinical analysis is comprehensively evaluated in this application. First, serum mixtures are used in this application to test its accuracy. GlyThe results of the room temperature and repeated freeze-thaw experiments showed that the 5′-tiRNA Gly There was no significant difference in expression among these conditions (P>0.05) ( Figure 2 A), indicating that 5′-tiRNA Gly The detection method is not easily affected and has good stability and repeatability. Agarose gel electrophoresis showed that 5′-tiRNA Gly The size of the qRT-PCR product is about 80 bp ( Figure 2 B).

[0040] Table 1 5′-tiRNA Gly The inter-assay CV and intra-assay CV

[0041]

[0042] Example 3: 5′-tiRNA Gly A new serum biomarker for gastric cancer

[0043] To explore 5′-tiRNA Gly Whether it has the potential to become a serum marker for gastric cancer, this application detected 5′-tiRNA Gly The expression levels in the serum of 118 gastric cancer patients, 52 gastritis patients and 105 healthy subjects.

[0044] qRT-PCR results showed that 5′-tiRNA in gastric cancer patients Gly The expression level of Figure 3 A) In addition, 5′-tiRNA Gly The expression level of Figure 3 B).

[0045] ROC curve analysis showed that 5′-tiRNA Gly It has excellent test efficiency for identifying gastric cancer (sensitivity 0.74, specificity 0.87, AUC 0.837), which is better than CEA, CA199 and CA724 ( Figure 3 C; Table 2). After the combination of these three, the AUC continued to increase, reaching the maximum after the combination of the four, further improving the 5′-tiRNA Gly The diagnostic efficacy ( Figure 3 D-3E).

[0046] Since the symptoms of gastritis and early gastric cancer are similar and difficult to distinguish, this application further conducted ROC analysis on 118 gastric cancer patients and 52 gastritis patients. Gly The AUC of 100 μg / ml was higher than that of CEA, CA199 and CA724, and was further improved after combination, which is consistent with previous results ( Figure 3 F-3H), indicating 5′-tiRNA Gly It can also distinguish patients with gastric cancer from patients with gastritis, and has the potential to become a diagnostic marker for gastric cancer. Gly Whether it has clinical application value, in this application, according to 5′-tiRNA Gly The median expression level in the serum of gastric cancer patients was used to divide 118 gastric cancer patients into a relatively high expression group (N=59) and a relatively low expression group (N=59). The chi-square test results showed that 5′-tiRNA Gly The expression level of was correlated with T stage, lymph node metastasis, TNM stage and nerve / vascular invasion, but had no significant correlation with other pathological parameters (Table 3).

[0047] The above results show that serum 5′-tiRNA Gly It has high diagnostic efficacy in the diagnosis of gastric cancer and has the potential to become a gastric cancer marker and dynamically monitor the prognosis of gastric cancer patients.

[0048] Table 2 5'-tiRNA Gly Diagnostic efficacy in gastric cancer serum

[0049]

[0050] Table 3 Serum 5'-tiRNA Gly Correlation study with clinical pathological parameters

[0051]

[0052] Example 4: 5′-tiRNA Gly Promotes gastric cancer cell proliferation and affects tumor growth in PDX models

[0053] In this application, 5′-tiRNA is further studied Gly The biological function of β-catenin in gastric cancer was firstly detected in gastric cancer cell lines, and its expression was found to be significantly increased in HGC-27, MKN-45 and AGS ( Figure 4 A) In this application, 5′-tiRNA was transfected into AGS and MKN-45 cells with relatively high expression levels. Gly Inhibitors, while HGC-27 and MKN-45 cells with relatively low expression levels were transfected with 5′-tiRNA GlySimulation, good transfection effect ( Figure 4 B) CCK8, colony formation and EdU assay results showed that transfection with 5′-tiRNA Gly The proliferation ability of gastric cancer cells was weakened after the inhibitor was used, while the 5′-tiRNA was transfected Gly The proliferation ability of gastric cancer cells was enhanced after the simulation. Figure 4 C-4H). Subsequently, a PDX model was constructed in this application, and the clinical chemotherapy drug 5-FU was set up as a control to test the in vivo 5′-tiRNA Cly Does it have the same inhibitory effect on gastric cancer? Figure 4 I) The results showed that compared with the antagonist control group, injection of 5′-tiRNA Gly Antagonist-induced tumor volume reduction ( Figure 4 J) Weight reduction Figure 4 K), growth is inhibited ( Figure 4 L). In addition, 5′-tiRNA Gly The antagonist also inhibited the expression of Ki67 protein in tumor tissue and promoted the expression of Cleaved caspase3 protein ( Figure 4 M). The above results suggest that 5′-tiRNA Gly It can promote the progression of gastric cancer both in vitro and in vivo.

[0054] Example 5: 5′-tiRNA Gly Directly targeting OGDHL and regulating the expression of OGDHL To further explore the 5′-tiRNA Gly The mechanism of promoting the malignant progression of gastric cancer was investigated by FISH ( Figure 5 A) and nuclear-cytoplasmic separation ( Figure 5 B) Experimental detection of 5′-tiRNA Gly Subcellular localization of the gene was found to be mainly located in the cytoplasm, and it may exert its biological function by regulating downstream target genes through miRNA-like effects. KEGG enrichment analysis showed that its target genes were mainly enriched in metabolic pathways ( Figure 5 C) Next, the 5′-tiRNA was predicted by the miRanda and TargetScan databases in this application. Gly Target genes ( Figure 5 D), combined with the metabolic pathway in KEGG (Pathway ID: hsa01100) and the glycolysis process in GO (GOID: 0006096), three potential target genes (OGDHL, OGDH and PFKL) were further screened out ( Figure 5 E). qRT-PCR results showed that transfection with 5′-tiRNA Gly After the simulation, only the expression of OGDHL decreased significantly ( Figure 5F) Dual luciferase reporter gene assay showed that transfection with 5′-tiRNA Gly The fluorescence intensity of OGDHL-WT decreased after the mimic, but it had no effect on OGDHL-MUT, suggesting that 5′-tiRNA Gly There may be a binding relationship with OGDHL ( Figure 5 G, 5H). The above experiments suggest that 5′-tiRNA Gly Targeting OGDHL and reducing the expression of OGDHL in gastric cancer.

[0055] Example 6: 5′-tiRNA Gly Binding to OGDHL promotes the Warburg effect and progression of gastric cancer

[0056] KEGG enrichment analysis showed that 5′-tiRNA Gly The target genes are mainly enriched in metabolic pathways. Since the Warburg effect is a common feature of metabolic disorders in tumor cells, in this application, 5′-tiRNA is transfected Gly The results showed that the glucose uptake and lactate production of gastric cancer cells were detected after transfection with 5′-tiRNA Gly The glucose uptake and lactate production of gastric cancer cells decreased after the inhibitor was used, while the 5′-tiRNA Gly The results after the simulation were opposite, suggesting that 5′-tiRNA Gly May promote the Warburg effect of gastric cancer cells ( Figure 6 A).

[0057] OGDHL is one of the important components of the key enzyme OGDHC in the tricarboxylic acid cycle. qRT-PCR results showed that the expression level of OGDHL was significantly reduced in gastric cancer tissues, which was consistent with the results of the TCGA STAD database ( Figure 6 B, 6C). OGDHL expression was decreased in gastric cancer cell lines HGC-27, AGS and MKN-45 ( Figure 6 D). In order to evaluate the biological role of OGDHL in gastric cancer, an AGS cell line with stable overexpression of OGDHL and a shRNA interference vector were constructed in this application. The results of CCK8, clone formation and EdU experiments showed that the proliferation ability of AGS with stable overexpression of OGDHL was weakened, and the proliferation ability of HGC-27 was enhanced after knocking down OGDHL, suggesting that OGDHL can inhibit the malignant progression of gastric cancer ( Figure 6 E-6G). Subsequently, rescue experiments were performed in this application, and the results showed that overexpression of OGDHL could rescue 5′-tiRNA Gly The mimics promoted gastric cancer cell proliferation, glucose uptake and lactate production, while knockdown of OGDHL could rescue the 5′-tiRNAGly Inhibitory effects of inhibitors on gastric cancer cell proliferation, glucose uptake and lactate production ( Figure 6 H-6J). The above results suggest that 5′-tiRNA Gly Promoting the Warburg effect and progression of gastric cancer by targeting OGDHL.

[0058] The following are some of the experimental steps used in the above examples:

[0059] 1. Raw materials and reagents

[0060] 1. Specimen collection: 50 pairs of gastric cancer tissues and paracancerous tissues (including 3 pairs of tissues for tsRNAs sequencing) were collected from the Affiliated Hospital of Nantong University from 2019 to 2021. Serum samples were obtained from 118 gastric cancer patients, 105 healthy controls, 52 gastritis patients, and 39 gastric cancer patients who underwent surgery 7 days ago. All gastric cancer patients received a pathological diagnosis of gastric cancer. All patients involved in this study signed informed consent, and the research protocol was approved by the local hospital ethics committee.

[0061] 2. tsRNA sequencing: Total RNA of the sample was extracted and the quality and integrity of the RNA was evaluated. A small RNA library was then established, and after passing the quality inspection, the SE50 mode was selected for tsRNA sequencing on the HiSeq 2500 platform, which was completed by Guangzhou Ruibo Biotechnology Co., Ltd.

[0062] 3. Extraction of total RNA:

[0063] (1) For the extraction steps of total RNA from blood: use BioTeke's blood total RNA rapid extraction kit (centrifugal column type). Add 900 μL of lysis buffer RLS to 300 μL of serum sample, blow the liquid sample to help lysis; vortex the homogenized sample vigorously for at least 1 minute, incubate at 15-30°C for 5 minutes to completely decompose the ribosomes; add 200 μL of chloroform, shake vigorously for 15 seconds and incubate at room temperature for 3 minutes; centrifuge at 4°C and 12000 rpm for 10 minutes, the sample will be separated into three layers: the lower organic phase, the middle layer and the upper colorless aqueous phase. RNA exists in the aqueous phase. The capacity of the aqueous phase is about 60% of the volume of the added lysis buffer RLS. Pipette 700 μL of the aqueous phase and transfer it to a new tube; add 1 volume of 70% ethanol and mix it by inversion; absorb the resulting solution. Transfer 700 μL into adsorption column RA, centrifuge at 12000 rpm for 1 minute, discard the waste liquid, and put the adsorption column back into the collection tube; transfer the remaining 700 μL solution into adsorption column RA again, centrifuge at 12000 rpm for 1 minute, discard the waste liquid; add 500 μL deproteinization solution RE, centrifuge at 12000 rpm for 1 minute, discard the waste liquid; add 700 μL rinse solution RW, centrifuge at 12000 rpm for 1 minute, discard the waste liquid; centrifuge at 12000 rpm for 2 minutes to remove the rinse solution as much as possible; take out the adsorption column RA, put it into an RNase-free centrifuge tube, add 50-80 μL DEPC water (heated in a 65-70°C water bath in advance) to the middle part of the adsorption membrane according to the expected RNA yield, let it stand at room temperature for 2 minutes, centrifuge at 12000 rpm for 1 minute, and collect the RNA stock solution.

[0064] (2) For the extraction of total cellular RNA: remove the culture medium from the cells to be treated, rinse them with PBS, add 500 μL RNA-easy Isolation Reagent (Vazyme) to lyse for 15 minutes, and then transfer them to a 1.5 mL EP tube; add 200 μL DEPC water to the lysate for extraction, mix well and let stand for 5 minutes; centrifuge at 12000g for 15 minutes; take out the EP tube, the solution is divided into an upper aqueous phase and a dark lower precipitate, carefully transfer the upper aqueous phase to a new EP tube; add an equal volume of isopropanol, mix well, and let stand at room temperature for 10 minutes; centrifuge at 12000g for 10 minutes at room temperature, a white precipitate is visible, and the supernatant is carefully discarded; add 500 μL 75% ethanol, flick the bottom of the tube to suspend the precipitate, and turn it upside down several times; centrifuge at 7500g for 10 minutes at room temperature, discard the supernatant, turn the EP tube upside down, and remove the water stains; open the lid and bake in an oven at 60°C for 5-10 minutes; add 20-30 μL DEPC water; bake in oven at 60℃ for 5 minutes to promote dissolution; shake and mix, then centrifuge to save the RNA stock solution; use Nanodrop to detect RNA concentration and purity.

[0065] (3) For the extraction of total RNA from tissues: cut 30 mg of tissue and place it in a 1.5 mL EP tube, add 3 3 mm grinding beads; add 500 μL RNA-easy Isolation Reagent; grind with a grinder until no visible residue is left; add 200 μL RNase-free water to the lysate, mix well and let stand for 5 minutes; the subsequent steps are the same as for extracting cellular RNA.

[0066] 4. Reverse transcription and SYBR Green fluorescent dye qRT-PCR

[0067] (1) Reverse transcription

[0068] After quantification according to the total RNA concentration, the reverse transcription system (Table 1-1) was prepared using the Revert Aid RT reverse transcription kit (Thermo Fisher Scientific) and the reverse transcription reaction was performed under the reaction conditions of 42°C for 60 min and 70°C for 5 min. After the reverse transcription was completed, the sample was placed at 4°C for use.

[0069] Table 1-1 Reverse transcription system

[0070]

[0071] (2) qRT-PCR

[0072] After preparing the reaction system (Table 1-2), qRT-PCR reaction was performed on ABIQuantStudio5. The reaction conditions were 95°C pre-denaturation for 30 s, followed by 40 cycles (95°C denaturation for 10 s, 60°C annealing and extension for 30 s).

[0073] Table 1-2 PCR reaction system

[0074]

[0075] U6 and β-actin were used as internal references for tsRNAs and mRNAs. -ΔΔCT method determines the expression,

[0076] ΔΔCt=ΔCt tumor[Ct(target)-Ct(reference)] -ΔCt control[Ct(target)-Ct(reference)] .

[0077] The reverse transcription and qRT-PCR primers were synthesized by Sangon Biotechnology Co., Ltd. and the sequences are as follows (5'-3'):

[0078] 5′-tiRNA Gly Specific RT primers:

[0079] GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACGGCGAG;

[0080] Specific RT primer for U6: CGCTTCACGAATTTGCGTGTCAT;

[0081] 5′-tiRNA Gly Specific upstream primer F: TGGGTGGTTCAGTGGTAGAATT;

[0082] Downstream primer R: AGTGCAGGGTCCGAGGTATT;

[0083] U6 specific upstream primer F: GCTTCGGCAGCACATATACTAAAAT; downstream primer R: CGCTTCACGAATTTGCGTGTCAT;

[0084] OGDHL-specific upstream primer F: CAAGTCCAGCTTTGACCAAATG; downstream primer R: CACCAGGTCATAGTACACCTTT;

[0085] β-actin specific upstream primer F: TCAAGATCATTGCTCCTCCTGAG; downstream primer R: ACATCTGCTGGAAGGTGGACA.

[0086] 5. Agarose Gel Electrophoresis

[0087] Prepare 1L 1×TAE solution for standby use; prepare 2% agarose gel solution (100mL 1×TAE + 2g agarose); heat the prepared solution repeatedly in a microwave oven until the solution is clear; add 10μL Gel-Red and mix quickly, then pour into the gel preparation tank and insert a comb; after the gel solidifies, put it into 1×TAE buffer, add 5μL DNA marker to each well, mix the sample and loading buffer in proportion and add them to the well, and perform electrophoresis at 110V for 40min; after the electrophoresis, perform UV imaging and take pictures.

[0088] 6. Room temperature placement and repeated freeze-thaw experiments

[0089] Twenty serum samples were randomly mixed and placed at room temperature (25°C) for 0, 6, 12, 18 and 24 h, and RNA was extracted and 5′-tiRNA was detected. Gly Subsequently, the pooled serum was frozen and thawed at -80°C and room temperature 0, 1, 3, 5, and 10 times. RNA was extracted and 5′-tiRNA was detected Gly expression.

[0090] 7. Cell Culture

[0091] Human gastric cancer cell lines (HGC-27, AGS, MKN-45) and human gastric epithelial cell line (GES-1) were obtained from the cell bank of the Chinese Academy of Sciences. AGS was cultured in F12 medium, and the other cell lines were cultured in RPMI 1640 medium containing 10% fetal bovine serum and 1% penicillin and streptomycin. The medium was renewed every two days, and the cells were cultured in an incubator at 37°C with 5% CO2.

[0092] 8. Cell Transfection

[0093] The cells in good condition were plated in a 6-well plate, and the experiment was started when the cell fusion reached about 60-70%; two EP tubes were prepared, 125 μL of basal culture medium and 3.75 μL of 1ipo3000 (Thermo Fisher Scientific) were added to the first EP tube, and 125 μL of basal culture medium and inhibitors, mimics or 2500 ng of plasmid solution were added to the second EP tube; after incubation at room temperature for 5 minutes, the second tube was added to the first tube, mixed, and incubated at room temperature for 10 minutes; after replacing the complete culture medium in the six-well plate, the mixture was evenly added to the six-well plate, and cell function experiments were performed after 24-48 hours.

[0094] Suzhou Genema Gene Co., Ltd. synthesized 5′-tiRNA Gly Inhibitors and mimics, shRNAs of OGDHL and control vectors:

[0095] mimics NC sense: UUCUCCGAACGUGUCACGUTT;

[0096] mimics NC antisense: ACGUGACACGUUCGGAGAATT;

[0097] 5'-tiRNA Gly Mimics sense:

[0098] GCAUGGGUGGUUCAGUGGUAGAAUUCUCGCC;

[0099] 5'-tiRNA Gly Mimics antisense:

[0100] CGAGAAUUCUACCACUGAACCACCCAUGCUU;

[0101] inhibitor NC: CAGUACUUUUGUGUAGUACAA;

[0102] 5'-tiRNA Gly inhibitor:

[0103] GGCGAGAAUUCUACCACUGAACCACCCAUGC;

[0104] shOGDHL:GGAGAAACACTTTCAACAAAG;

[0105] shNC:TTCTCCGAACGTGTCACGT.

[0106] 9. Lentiviral infection

[0107] AGS cells were infected with lentiviral particles and puromycin was used as a selection marker to establish a complementing cell line. The sequence of the OGDHL lentiviral vector is shown in SEQ ID NO:1.

[0108] 10.CCK-8

[0109] 48 hours after transfection, 3 × 10 3 Cells were placed in a 96-well plate, and 10 μL of CCK-8 detection reagent was added to each well after the cells adhered to the wall. Incubated at 37°C for 2-3 hours, the absorbance values ​​at 450nm and 630nm were read using an ELISA reader, and the detection was performed once every 24 hours for three consecutive times, and the absorbance value at 450nm minus 630nm was calculated.

[0110] 11. Clone Formation Assay

[0111] 48 hours after transfection, 1,000 cells were seeded into 6-well plates, and the medium was refreshed every 4 days. Approximately 14 days later, the cells were fixed with 4% paraformaldehyde and subsequently photographed with crystal violet staining.

[0112] 12.EdU proliferation assay

[0113] 48 h after transfection, 1×10 5 Cells were inoculated into 24-well plates. When the cell confluence reached about 70%, the experiment was performed according to the protocol in the EdU-555 cell proliferation detection kit (Beyotime). First, the culture medium was replaced with a culture medium containing 10 μM EdU and the cells were incubated for 2 h. After fixation with 4% paraformaldehyde, the cells were stained with Azide555 and Hoechst 33342 fluorescent dyes. Finally, the cell proliferation was observed under a fluorescence microscope.

[0114] 13. Transwell experiment

[0115] Inoculate 5 × 10 5A complete culture medium containing 20% ​​fetal bovine serum was added to the lower chamber. A layer of matrix gel was spread in the upper chamber before the invasion experiment. After the matrix gel solidified, the tumor cells were seeded. After 2 days, they were fixed with paraformaldehyde, stained, and photographed and counted under a microscope.

[0116] 14. Establishment of PDX Model

[0117] The animal experiment protocol used in this study was approved by the Animal Management Committee of Nantong University and strictly complied with the ethical guidelines for animal experiments. Freshly obtained gastric cancer tissues were refrigerated at 4°C, quickly cut into small fragments, and mixed with 10% Matrigel (Corning, USA) at 4°C. These tissue fragments were immediately transplanted subcutaneously into the right side of three NOD-SCID mice (F1) under sterile conditions, and all animals received sterile food and water. When the tumor reached 1.5 cm 3 When the tumor grew to 5 mm, a portion was cut off, divided into smaller pieces, and implanted into another three NOD-SCID mice (F2). The procedure was repeated and 12 pieces from the three tumors were transplanted into another 12 NOD-SCID mice (F3). When the tumor grew to 5 mm, the NC group and the antagomir group received intratumoral injections of 5 nmol each time, once every 3 days. The 5-FU group received intraperitoneal injections, also once every 3 days. Suzhou Jima Gene Co., Ltd. synthesized 5′-tiRNA Gly antagomir and antagomir NC, 5'-tiRNA Gly Antagomir: GGCGAGAAUUCUACCACUGAACCACCCAUGC; Antagomir NC: UUGUACUACACAAAAGUACUG, antogimir 3' end is cholesterol modified, 5' end is modified with two thio backbones, 3' end is modified with four thio backbones, and the whole chain is methoxy modified.

[0118] 15. RNA FISH

[0119] Place the cells in a 24-well plate and culture 6 × 10 4cells, and the experiment was started using a FISH kit (RiboBio) when the cell confluence reached about 70%; the cells were washed with PBS and fixed with 4% paraformaldehyde at room temperature for 10 minutes, washed three times with PBS, and 1 mL of pre-cooled permeabilization solution was added and placed at 4°C for 5 minutes. The permeabilization solution was discarded and washed three times with PBS; after pre-hybridization at 37°C for 30 minutes, a hybridization solution containing the probe was added, and hybridization was carried out in the dark at 37°C overnight; on the next day, the cells were washed with wash solution I, wash solution II, wash solution III and PBS in sequence under dark conditions; under dark conditions, DAPI staining was performed for 10 minutes, and then washed three times with PBS; the cell slide was taken out, sealed with a sealing medium, and then photographed with a fluorescence microscope.

[0120] 16. Nuclear and cytoplasmic RNA isolation experiment

[0121] Trypsinize the cultured cells and collect at least 5 × 10 6 cells into a 1.5 mL EP tube. TM Kit (Thermo Fisher Scientific) procedures and instructions, 60 μL of nuclear and cytoplasmic RNA were extracted and stored in a -80°C freezer.

[0122] 17. Dual luciferase reporter gene assay

[0123] Prediction of 5′-tiRNA by TargetScan software Gly The binding site of OGDHL was detected by PCR amplification of the 3'-UTR fragment of OGDHL, which was recovered and purified and then connected to the pmirGLO vector. Finally, the recombinant vector was double-digested and DNA sequenced for identification. Using Renilla luciferase as the internal reference gene and firefly luciferase as the reporter gene, cells were plated in 24-well culture plates and co-transfected with 5'-tiRNA in the cells. Gly The mimic / mimic NC and the luciferase OGDHL reporter gene containing the WT / MUT binding site were assayed using the dual luciferase reporter gene assay system (Promega, USA). After 48 h, the substrate was added to detect the fluorescence intensity generated by the reaction. The ratio of firefly fluorescence to Renilla fluorescence was calculated to verify the 5′-tiRNA Gly Integration relationship with OGDHL.

[0124] 18. Glucose uptake and lactic acid production detection

[0125] After transfection, 1×10 6 Cells were inoculated into 6-well plates. After 24 h of incubation in basal medium, the supernatant was collected for analysis. According to the protocol, lactate detection kit and glucose kit (Nanjing Jiancheng Bioengineering Research Institute Co., Ltd.) were used for analysis.

[0126] 19. Statistical Analysis

[0127] Statistical analysis was performed using IBM SPSS Statistics 20.0 and GraphPad Prism version 9. Data are presented as mean ± standard deviation (SD). For normally distributed data, t-test, one-way ANOVA, or two-way ANOVA were used for statistical analysis. Non-normally distributed data were tested using the Mann-Whitney U test, Kruskal-Wallis test, or Wilcoxon test. Chi-square test was used to analyze 5′-tiRNA Gly Correlation between serum 5′-tiRNA and pathological parameters. Create and calculate ROC and area under the curve (AUC) to evaluate the relationship between serum 5′-tiRNA and gastric cancer Gly The Youden index is used to determine the diagnostic effect of 5′-tiRNA Gly The cutoff values ​​of CEA, CA199 and CA724 were set according to the reference range of the Affiliated Hospital of Nantong University, which were 5 ng / mL, 37 U / mL and 10 U / mL respectively. Statistical significance was set at P value < 0.05.

[0128] In summary, this application proves through specific verification experiments that 5′-tiRNA Gly It can be used as a diagnostic marker for gastric cancer by detecting 5′-tiRNA in serum Gly The expression level can be used to diagnose and predict gastric cancer, which has the advantages of high specificity and sensitivity.

Claims

1. A highly expressed molecular marker for gastric cancer screening, characterized in that: The molecular marker is 5'-tiRNA Gly , the 5'-tiRNA Gly It is derived from the 5'-half of tRNA-Gly-GCC.

2. 5'-tiRNA as claimed in claim 1 Gly Its application as a detection target in the preparation of diagnostic gastric cancer products.

3. 5'-tiRNA according to claim 2 Gly Application in the preparation of gastric cancer diagnosis products, characterized by: The product is a reagent or a kit.

4. 5'-tiRNA according to claim 3 Gly Application in the preparation of gastric cancer diagnosis products, characterized by: The product was verified by 5'-tiRNA Gly The expression dynamics of TNF-α can be used to monitor the prognosis of gastric cancer patients.

5. A detection kit for gastric cancer, characterized in that: The detection kit is based on 5'-tiRNA Gly To detect the target.

6. A detection kit for gastric cancer according to claim 5, characterized in that: The detection kit also includes other medically acceptable reagents.

7. 5'-tiRNA as claimed in claim 1 Gly Application as a target in the preparation of products for the treatment of gastric cancer.

8. The 5'-tiRNA according to claim 7 Gly The application of the target in the preparation of a drug for treating gastric cancer is characterized by: The drug is used to inhibit 5'-tiRNA Gly .

Images