Primer group and kit for detecting SMN1 exon polymorphism

Abstract

The invention discloses a primer group and a kit for detecting SMN1 exon polymorphism as well as a method and application for detecting SMN1 exon polymorphism. The primer group comprises a multiple PCR amplification primer and a UEP primer used for a single base extension reaction, multiple PCR amplification is firstly carried out, SAP purification is then carried out, the extension reaction is then carried out, nucleic acid mass spectrometry detection is carried out on an extension product, and related genotype information is obtained. The method has the advantages of high accuracy, high flux, low cost and short period, 96 samples or 384 samples can be detected in one batch, only 8-10 hours are needed, the time is short, and the price is low. According to the invention, SMN1EXON7 and SMN1EXON8 can be synchronously detected, the sensitivity is high, a detection result can be obtained by only needing a trace amount of genome DNA, and the detection result has certain significance for realizing auxiliary diagnosis of SMA patients and carrier screening.

Description

Technical Field

[0001] The present invention relates to a primer set, a kit and a method for detecting SMN1 exon polymorphism of spinal muscular atrophy. Background Art

[0002] Spinal muscular atrophy is the most common neuromuscular disease in children, with muscle weakness and atrophy caused by degeneration of α-motor neurons in the anterior horn of the spinal cord as the main clinical features. The incidence of SMA is about 1 / 10,000, the carrier rate in the population is about 1 / 50, and the carrier rate in the Chinese population is 1 / 42 to 1 / 48.

[0003] SMA is an autosomal recessive genetic disease, and its main pathogenic gene is the survival motor neuron gene 1 (SMN1). About 95% of SMA patients are caused by homozygous deletion of the SMN1 gene. 5% are caused by compound heterozygous mutations of SMN1, that is, one allele is deleted and the other allele has a minor pathogenic mutation. The pathogenic gene SMN1 and the modifier gene SMN2 of SMA are highly homologous. SMN1 determines the occurrence of the disease, and SMN2 affects the severity and progression of the disease, making the genetic diagnosis of SMA different from that of most single-gene genetic diseases. The onset age of SMA patients varies greatly, and the disease can occur from before birth to adulthood. The main manifestations are progressive muscle weakness and atrophy mainly in the proximal limbs. As the disease progresses, multiple systems such as respiratory, digestive, and skeletal systems may be affected. Standardized SMA genetic diagnosis and application will provide important help for clinical diagnosis, management, prevention, and genetic counseling.

[0004] A person who has only heterozygous mutations in the SMN1 gene is called an SMA carrier, and generally does not develop the disease. If both husband and wife are carriers, each child born to the couple has a 25% chance of being a patient, a 50% chance of being a carrier, and a 25% chance of being healthy. SMN1 exon gene testing can assess the risk of the subject and his or her offspring, and guide the subject's parents to have another child.

[0005] At present, the main methods used in clinical SMA gene detection are: restriction fragment length polymorphism polymerase chain reaction technology (PCR-RFLP), denaturing high performance liquid chromatography analysis (PCR-DHPLC), multiple ligation probe amplification technology (MLPA), real-time fluorescence quantitative PCR, high-throughput sequencing, etc. PCR-RFLP method can only detect homozygous deletion of exon 7 of SMN1 gene, and cannot detect carriers of single copy deletion. PCR-DHPLC method, MLPA method and high-throughput sequencing can be used to detect homozygous deletion patients and heterozygous deletion carriers, but the operation is complicated, the throughput is low, the time is long, specific instruments are required, and the price is relatively expensive. Real-time fluorescence quantitative PCR technology is prone to produce non-specific results when detecting exons 7 and 8 of SMN1 gene. Second-generation sequencing (NGS) can obtain hundreds of pharmacogenomics-related gene information in one test, but the disadvantage of second-generation sequencing is that the cost is high, and its detection cost is difficult to be accepted by the public. Therefore, it is necessary to develop a high-throughput, low-cost, and high-accuracy detection solution. Summary of the invention

[0006] The purpose of the present invention is to provide a primer set and a kit for detecting SMN1 exon polymorphism, and a method for detecting Exon7 and Exon8 polymorphism using the primer set and the kit.

[0007] The technical solution adopted by the present invention is:

[0008] A primer set for detecting SMN1 exon polymorphism, comprising multiple PCR amplification primers, wherein the multiple PCR amplification primers include exon 7 amplification primers and exon 8 amplification primers, wherein the base sequence of the exon 7 amplification primer is shown in SEQ ID NOs: 1-2, and the base sequence of the exon 8 amplification primer is shown in SEQ ID NOs: 3-4;

[0009] SEQ ID NO: 1: ACGTTGGATGAGCACCTTCCTTTCTTTTTG

[0010] SEQ ID NO:2:ACGTTGGATGTCTTGTGAAACAAAATGC

[0011] SEQ ID NO:3:ACGTTGGATGATAACCAAATGCAATGTGAA

[0012] SEQ ID NO: 4: ACGTTGGATGTACAACACCCTTCTCACAG.

[0013] Furthermore, the primer set also includes ALB reference gene amplification primers, and the base sequences of the ALB reference gene amplification primers are shown in SEQ ID NOs: 5 to 6:

[0014] SEQ ID NO: 5: ACGTTGGATGAAGCACAGAGAAAAGAGGC;

[0015] SEQ ID NO: 6: ACGTTGGATGCTTATTCATCTGTTTTTC.

[0016] The primer set also includes a UEP primer for a single base extension reaction, the base sequence of the UEP primer for exon 7 is shown in SEQ ID NO: 7, the base sequence of the UEP primer for exon 8 is shown in SEQ ID NO: 8, and the base sequence of the UEP primer for the ALB reference gene is shown in SEQ ID NO: 9:

[0017] SEQ ID NO:7: TTTATTTTCCTTACAGGGTTT

[0018] SEQ ID NO:8:CCCGTGCTGGCCTCCCACCCCCACC

[0019] SEQ ID NO:9: GTGTAAAGCCAACACCC.

[0020] The present invention also provides an application of a primer set for detecting SMN1 exon polymorphism, which is at least one of the following (1)-(2): (1) detecting SMN1 exon polymorphism on a sample; (2) preparing a kit for detecting SMN1 exon polymorphism on a sample.

[0021] Preferably, the above primer set is used to prepare a kit for detecting SMN1 exon polymorphism.

[0022] The present invention also provides a kit for detecting SMN1 exon polymorphism, the kit comprising the above-mentioned multiple PCR amplification primers and UEP primers.

[0023] Furthermore, the kit comprises a multiplex PCR amplification reaction system containing the multiplex PCR amplification primers, a shrimp alkaline phosphatase (SAP) purification reaction system, and a single base extension reaction system containing the UEP primers.

[0024] Furthermore, the multiplex PCR amplification reaction solution includes multiplex PCR amplification primers having base sequences as shown in SEQ ID NOs: 1 to 6, and the concentration of each primer is 0.1 to 1 μM (preferably 0.5 μM);

[0025] Preferably, the multiplex PCR amplification reaction solution comprises multiplex PCR amplification primers, PCR buffer, deoxynucleoside triphosphate mixture (dNTP), DNA polymerase, and MgCl2.

[0026] The SAP purification reaction system comprises SAP enzyme and SAP buffer.

[0027] SAP enzyme and SAP buffer can be purchased from Agena.

[0028] The single base extension reaction system includes UEP primers with base sequences as shown in SEQ ID NOs: 7 to 9, and the concentration of each primer is 0.1 to 1 μM (preferably 0.7 μM).

[0029] Preferably, the single base extension reaction system comprises UEP primer, Buffer Plus, Terminationmix and Pro Enzyme.

[0030] The Buffer Plus, Termination mix and Pro Enzyme were purchased from Agena.

[0031] The present invention also provides the use of the kit in detecting SMN1 gene exon polymorphism. The SMN1 gene exon polymorphism includes the copy number of exon 7 and exon 8.

[0032] The present invention also provides a method for detecting SMN1 gene exon polymorphism in vitro for non-diagnostic purposes using the kit, the method comprising the following steps:

[0033] (1) Multiplex PCR amplification reaction

[0034] Extracting template DNA from samples, preparing a multiplex PCR amplification reaction system, performing multiplex PCR amplification reactions, and obtaining multiplex PCR amplification products;

[0035] The multiplex PCR amplification reaction system is a 5 μL reaction system, including the following components:

[0036] Ultrapure water 1.8μL, 10xPCR Buffer 0.5μL, 25mM MgCl2 0.4μL, dNTP 0.1μL, P Mix 1μL (primer mixture), PCR Enzyme 0.2μL, DNA template 1μL.

[0037] The reaction conditions for the multiplex PCR amplification reaction were 95°C for 2 minutes; 95°C for 30 seconds, 56°C for 30 seconds, and 72°C for 60 seconds, for 45 cycles; and then 72°C for 5 minutes.

[0038] The P mix is ​​the primer sequence of SEQ ID NO: 1 to 6, and the concentration of each primer is 0.5 μM;

[0039] (2) Shrimp alkaline phosphatase (SAP) purification reaction:

[0040] The multiplex PCR amplification products were purified with SAP enzyme. The SAP purification reaction system included the following components: 1.53 μL of ultrapure water, 0.17 μL of SAP Buffer, 0.3 μL of SAP Enzyme, and 5 μL of amplification products, a total of 7 μL of reaction system; and then the purified products were obtained.

[0041] The reaction conditions for the purification reaction were 37°C for 40 minutes and 80°C for 5 minutes.

[0042] (3) Single base extension reaction

[0043] The purified product of step (2) is subjected to a single base extension reaction, wherein the single base extension reaction system comprises the following components: 0.62 μL of ultrapure water, 0.2 μL of Buffer Plus, 0.2 μL of Termination mix, 0.94 μL of UEPMix, 0.04 μL of Pro Enzyme, and 7 μL of purified product, a total of 9 μL of reaction system; obtaining an extension product;

[0044] UEP Mix is ​​the primer sequence of SEQ ID NO: 7 to 9, and the concentration of each primer is 0.7 μM;

[0045] The reaction procedure of the single base extension reaction is 94° C. for 30 s, {94° C. for 5 s, (41° C. for 5 s, 80° C. for 5 s) 5 internal cycles} 39 external cycles, 72° C. for 3 min.

[0046] (4) Nucleic acid mass spectrometry analysis

[0047] The extension products were detected by nucleic acid mass spectrometer to obtain the copy numbers of exons 7 and 8 of SMN1.

[0048] The nucleic acid mass spectrometer is generally a MALDI-TOF MS matrix-assisted laser desorption ionization-time of flight mass spectrometer.

[0049] The nucleic acid mass spectrometer detector converts the electrical signal into a visible peak graph. Each genotype has a unique molecular weight. The software automatically analyzes the corresponding base type to obtain the final genotyping result. The Exon7 and Exon8 results are automatically interpreted based on the data results from the offline data input formula.

[0050] Furthermore, in step (4), the deletion of exons 7 and 8 is calculated and determined based on the copy numbers of exons 7 and 8 of SMN1.

[0051] The calculation steps are generally:

[0052] 1. Calculate the Ratio values ​​of ALB_QC, exon7_840CT, and exon8:

[0053]

[0054]

[0055] 2. The following samples are not included in the calculation of Exon7 and Exon8 cutoff values:

[0056] (1) Negative and positive quality control products and blank reference products;

[0057] (2) Samples with ALB_QCRatio<0.4;

[0058] (3) For the sample indicators ALB_QC Hight1, ALB_QC Hight2, Exon7_840CT Hight1, Exon7_840CT Hight2, Exon8 Hight2, and Exon8 Hight3, if any of the values ​​is ≤3, such sample is not included in the calculation of the cutoff value.

[0059] 3. Calculate the exon7 cutoff value:

[0060] (1)

[0061] (2) Calculate the overall mean (Avg) and Stdev.s of the exon7_840CTALB values ​​of the remaining samples except 2

[0062] (3) Calculate the |exon7_840CTALB value - Avg | / Stdev.s for each sample except 2. Samples with this value (absolute value) > 3 are not included in the subsequent calculations.

[0063] (4) Calculate the overall mean (Avg) and Stdev.s of the remaining samples above

[0064] (5) Calculate Exon7 cutoff value = Avg - 1.282Stdev.s

[0065] 4. Calculate the exon8 cutoff value:

[0066] (1)

[0067] (2) Calculate the overall mean (Avg) and Stdev.s of the exon8ALB values ​​of the remaining samples except 2

[0068] (3) Calculate the |exon8 ALB value - Avg| / Stdev.s for each sample except 2. Samples with this value (absolute value) > 3 are not included in the subsequent calculations.

[0069] (4) Calculate the overall mean (Avg) and Stdev.s of the remaining samples above

[0070] (5) Calculate Exon8 cutoff value = Avg-1.65Stdev.s

[0071] 5. Exon7 result interpretation: Exon7_840CTALB value ≤ Exon7 cutoff value, the result is heterozygous deletion; Exon7_840CTALB value > Exon7 cutoff value, the result is undetected deletion; undetected deletion represents normal;

[0072] 6. Exon8 result interpretation: Exon8 ALB value ≤ Exon8 cutoff value, the result is heterozygous deletion; Exon8 ALB value > Exon8 cutoff value, the result is undetected deletion; undetected deletion represents normal;

[0073] 7. When Exon7_HEIGHT1 is equal to 0, it is initially judged as a homozygous deletion, and the gold standard - multiplex ligation-dependent probe amplification (MLPA) technology is used for verification;

[0074] 8. When Exon2_HEIGHT2 is equal to 0, it is preliminarily judged as a homozygous deletion, and the gold standard - multiplex ligation-dependent probe amplification technology (MLPA) is used for verification.

[0075] The above data processing methods are conventional methods in the art.

[0076] The present invention firstly performs PCR amplification with self-designed primers, then SAP purification, and finally uses self-designed probes to perform extension reaction of target bases. The obtained extension products are subjected to nucleic acid mass spectrometry detection, and finally relevant genotype information is obtained.

[0077] The present invention provides a kit for detecting the copy number of exons 7 and 8 of SMN1 with high accuracy, high throughput, low cost and short cycle. Compared with conventional Sanger sequencing, pyrophosphate sequencing and real-time fluorescence PCR technology, it has a significant high throughput advantage, that is, 96 samples can be detected in one batch, and each sample can detect multiple gene sites; compared with NGS, the present invention can complete a batch of 96 samples in only 8-10 hours, and it also has a more affordable price. The present invention can synchronously detect SMN1EXON7 and SMN1 EXON8, with high sensitivity, and only a trace amount of genomic DNA is needed to obtain the test results. The test results are of certain significance for the auxiliary diagnosis and carrier screening of SMA patients. BRIEF DESCRIPTION OF THE DRAWINGS

[0078] Figure 1 This is the mass spectrum result of sample No. 455 SMA_E7, and the result is marked with a black frame.

[0079] Figure 2 This is the mass spectrum result of sample No. 455 SMA_E8, and the result is marked with a black frame.

[0080] Figure 3 This is the QPCR validation result of sample No. 455 SMA_E7, and the result is marked with an arrow.

[0081] Figure 4 This is the QPCR validation result of sample No. 455 SMA_E8, and the result is marked with an arrow.

[0082] Figure 5 This is the mass spectrometry result of the SMA_E7 site of sample 468, and the result is marked with a black frame.

[0083] Figure 6 This is the mass spectrometry result of the SMA_E8 site of sample 468, and the result is marked with a black frame.

[0084] Figure 7 This is the QPCR validation result of sample No. 468 SMA_E7, and the result is marked with an arrow.

[0085] Figure 8 This is the QPCR validation result of sample 468 SMA_E8, and the result is marked with an arrow.

[0086] Fig. 9 This is the mass spectrum result of sample No. 645 SMA_E7, and the result is marked with a black frame.

[0087] Fig.10 This is the mass spectrum result of sample No. 645 SMA_E8, and the result is marked with a black frame.

[0088] Fig.11This is the QPCR validation result of sample No. 645 SMA_E7, and the result is marked with an arrow.

[0089] Fig.12 This is the QPCR validation result of sample No. 645 SMA_E8, and the result is marked with an arrow.

[0090] Fig.13 This is the mass spectrum result of sample No. 764 SMA_E7, and the result is marked with a black frame.

[0091] Fig.14 This is the mass spectrum result of sample No. 764 SMA_E8, and the result is marked with a black frame.

[0092] Fig.15 This is the QPCR validation result of sample 764, SMA_E7, and the result is marked with an arrow.

[0093] Fig.16 This is the QPCR validation result of sample 764, SMA_E8, and the result is marked with an arrow.

[0094] Fig.17 This is the mass spectrometry result of sample No. 674 SMA_E7. DETAILED DESCRIPTION

[0095] The technical solution of the present invention is further described below with reference to specific embodiments, but the protection scope of the present invention is not limited thereto.

[0096] In the present invention, SEQ NO1 to SEQ NO9 were all commissioned to be synthesized by Shanghai Agena Company.

[0097] Example 1

[0098] Ten whole blood samples were collected. Genomic DNA was extracted first, followed by multiple PCR reaction, SAP purification and single base extension reaction, and the products were then placed in nucleic acid mass spectrometry for detection. Finally, the data was analyzed by relevant software to obtain the copy number of the SMN1 gene in each sample. At the same time, it was verified by the Tianlong QPCR results, and the consistency rate of the two was 100%.

[0099] Detection method of the kit of the present invention: 1. Multiplex PCR amplification reaction

[0100] Single sample PCR amplification system: ultrapure water 1.8μL, 10xPCRBuffer 0.5μL (PCR Reagent And Spectro CHIP Kit, purchased from Agena Bioscience, catalog number: 21327M), 25mM MgCl2 0.4μL, dNTP 0.1μL, P Mix 1μL primer mixture, PCR Enzyme 0.2μL (PCR Reagent And Spectro CHIP Kit, purchased from Agena Bioscience, catalog number: 21327M), DNA template 1μL, a total of 5μL reaction system. The reaction conditions are 95℃ for 2 minutes; 95℃ for 30 seconds, 56℃ for 30 seconds, 72℃ for 60 seconds, 45 cycles; 72℃ for 5 minutes. The primers of P Mix are SEQ ID NO: 1 to 6 in Table 1, and the concentration of each primer is 0.5μM.

[0101] The DNA template was extracted using the CWE960 Blood DNA Kit from Kangwei Century. The multiplex PCR primer sequences are shown in Table 1:

[0102] Table 1

[0103]

[0104] 2. Shrimp alkaline phosphatase (SAP) purification reaction

[0105] 2 μL of SAP mixed solution was added to the above amplification reaction wells, including: 1.53 μL ultrapure water, 0.17 μL SAP Buffer, 0.3 μL SAP Enzyme (iPLEX Pro kit, purchased from Agena Bioscience, catalog number: 10212), to obtain a SAP purification system: 1.53 μL ultrapure water, 0.17 μL SAP Buffer, 0.3 μL SAP Enzyme, 5 μL first step PCR amplification product, a total of 7 μL reaction system. The reaction conditions for the purification reaction were 37°C for 40 minutes and 80°C for 5 minutes.

[0106] 3 Single base extension reaction

[0107] After the purification reaction was completed, 2 μL of iPLEX reaction system was added to the reaction space, and the extension reaction system for each well was obtained as follows: 0.62 μL of ultrapure water, 0.2 μL of iPLEX Buffer Plus (iPLEX Pro kit, purchased from Agena Bioscience, catalog number: 10212), 0.2 μL of iPLEX Termination mix (iPLEX Pro kit, purchased from Agena Bioscience, catalog number: 10212), 0.94 μL of UEP Mix, i.e., extension primer mixture, 0.04 μL of iPLEX Pro Enzyme (iPLEX Pro kit, purchased from Agena Bioscience, catalog number: 10212), and 7 μL of the second step purified product, a total of 9 μL reaction system. The extended UEPMix sequence is the SEQ ID NO: 7 to 9 primer sequence in Table 2, and the concentration of each primer is 0.7 μM. The reaction conditions are shown in Table 3.

[0108] Table 2

[0109]

[0110] Table 3

[0111]

[0112] 4. Nucleic acid mass spectrometry analysis

[0113] Add 35 μL of deionized water to the extension product. Place the sample in the MALDI-TOF MS matrix-assisted laser desorption ionization-time of flight mass spectrometer, and set the detection parameters: Wells to Process is set to Automatic, Start Disoense Condition is set to 1000, Resin Volume is set to 13, Shot is set to 30, Maximum Acquisitions is set to 9, Minimum Good Spectra and Maximum Good Spectra are both set to 5, and 5 items need to be checked, including TumOffHyAfterAnalysis, Transfer Resin to MTP, Dispense Samples onto Chips, Transferchips toAnayzer, and AnalyzeChips. Then the mass spectrometer spotter spots the extension product onto the SpectroCHIP (chip) for detection. After the detection is completed, the detector converts the electrical signal into a visual peak graph. Each genotype has a unique molecular weight. The software automatically analyzes the corresponding base type. Click the mass spectrometry software to generate the offline data results. The data results were entered into the program to automatically calculate the cutoff values ​​for reading Exon7 and Exon8 for each sample.

[0114] 5. Interpretation of nucleic acid mass spectrometry test results

[0115] The specific method for determining the copy number of Exon7 and Exon8 is as follows:

[0116] 3. First calculate the Ratio values ​​of ALB_QC, exon7_840CT, and exon8:

[0117]

[0118]

[0119] 4. Secondly, the following samples are not included in the calculation of Exon7 and Exon8 cutoff values:

[0120] (1) Negative and positive quality control products and blank reference products;

[0121] (2) Samples with ALB_QCRatio<0.4;

[0122] (3) For the sample indicators ALB_QC Hight1, ALB_QC Hight2, Exon7_840CT Hight1, Exon7_840CT Hight2, Exon8 Hight2, and Exon8 Hight3, if any of the values ​​is ≤3, such sample is not included in the calculation of the cutoff value.

[0123] 3. Calculate the exon7 cutoff value:

[0124] (1)

[0125] (2) Calculate the overall mean (Avg) and Stdev.s of the exon7_840CTALB values ​​of the remaining samples except 2

[0126] (3) Calculate the |exon7_840CTALB value - Avg | / Stdev.s for each sample except 2. Samples with this value (absolute value) > 3 are not included in the subsequent calculations.

[0127] (4) Calculate the overall mean (Avg) and Stdev.s of the remaining samples above

[0128] (5) Calculate Exon7 cutoff value = Avg - 1.282Stdev.s

[0129] 4. Calculate the exon8 cutoff value:

[0130] (1)

[0131] (2) Calculate the overall mean (Avg) and Stdev.s of the exon8ALB values ​​of the remaining samples except 2

[0132] (3) Calculate the |exon8 ALB value - Avg| / Stdev.s for each sample except 2. Samples with this value (absolute value) > 3 are not included in the subsequent calculations.

[0133] (4) Calculate the overall mean (Avg) and Stdev.s of the remaining samples above

[0134] (5) Calculate Exon8 cutoff value = Avg-1.65Stdev.s

[0135] 5. Exon7 result interpretation: Exon7_840CTALB value ≤ Exon7 cutoff value, the result is a heterozygous deletion; Exon7_840CTALB value > Exon7 cutoff value, the result is an undetected deletion;

[0136] 6. Exon8 result interpretation: Exon8 ALB value ≤ Exon8 cutoff value, the result is heterozygous deletion; Exon8 ALB value > Exon8 cutoff value, the result is undetected deletion. Undetected deletion represents normal;

[0137] 7. When Exon7_HEIGHT1 is equal to 0, it is initially judged as a homozygous deletion, and the gold standard - multiplex ligation-dependent probe amplification (MLPA) technology is used for verification;

[0138] 8. When Exon2_HEIGHT2 is equal to 0, it is preliminarily judged as a homozygous deletion, and the gold standard - multiplex ligation-dependent probe amplification technology (MLPA) is used for verification.

[0139] The results of the 10 test samples are shown in Table 4.

[0140] Table 4 shows the test results of 10 samples:

[0141] Table 4

[0142]

[0143]

[0144] It can be seen from the test results that the kit of the present invention can successfully detect the deletion of exons 7 and 8 of the SMN1 gene.

[0145] The same samples were verified by Tianlong QPCR, and the Tianlong QPCR and mass spectra of the 10 samples were exactly the same. The detection spectra of the representative sites were compared. Figures 1 to 16 shown.

[0146] in Figure 1 This is the mass spectrum result of sample No. 455 SMA_E7, and the result is marked with a black frame.

[0147] Figure 2 This is the mass spectrum result of sample No. 455 SMA_E8, and the result is marked with a black frame.

[0148] Figure 3 This is the QPCR validation result of sample No. 455 SMA_E7, and the result is marked with an arrow.

[0149] Figure 4 This is the QPCR validation result of sample No. 455 SMA_E8, and the result is marked with an arrow.

[0150] Figure 5 This is the mass spectrometry result of the SMA_E7 site of sample 468, and the result is marked with a black frame.

[0151] Figure 6This is the mass spectrometry result of the SMA_E8 site of sample 468, and the result is marked with a black frame.

[0152] Figure 7 This is the QPCR validation result of sample 468 SMA_E7, and the result is marked with an arrow.

[0153] Figure 8 This is the QPCR validation result of sample 468 SMA_E8, and the result is marked with an arrow.

[0154] Fig. 9 This is the mass spectrum result of sample No. 645 SMA_E7, and the result is marked with a black frame.

[0155] Fig.10 This is the mass spectrum result of sample No. 645 SMA_E8, and the result is marked with a black frame.

[0156] Fig.11 This is the QPCR validation result of sample No. 645 SMA_E7, and the result is marked with an arrow.

[0157] Fig.12 This is the QPCR validation result of sample No. 645 SMA_E8, and the result is marked with an arrow.

[0158] Fig.13 This is the mass spectrum result of sample No. 764 SMA_E7, and the result is marked with a black frame.

[0159] Fig.14 This is the mass spectrum result of sample No. 764 SMA_E8, and the result is marked with a black frame.

[0160] Fig.15 This is the QPCR validation result of sample 764, SMA_E7, and the result is marked with an arrow.

[0161] Fig.16 This is the QPCR validation result of sample 764, SMA_E8, and the result is marked with an arrow.

[0162] Figures 1 to 16 The results showed that the mass spectrometry method of the present invention was completely consistent with the results of Tianlong QPCR.

[0163] The mass spectrometry results of another sample, sample 674 SMA_E7, are as follows Fig.17 As shown in the figure, it was initially judged as a homozygous deletion based on the peak graph, and the C peak height of exon 7 was 0. The red vertical line position was selected in the figure. In the calculation formula, Exon7_HEIGHT1 is equal to 0. It was initially judged as a homozygous deletion, and then verified by the gold standard - multiple ligation-dependent probe amplification (MLPA), and the results were consistent.

Claims

1. A primer set for detecting SMN1 exon polymorphism, characterized in that The primer set includes multiple PCR amplification primers, and the multiple PCR amplification primers include exon 7 amplification primers and exon 8 amplification primers, the base sequence of the exon 7 amplification primers is shown in SEQ ID NOs: 1-2, and the base sequence of the exon 8 amplification primers is shown in SEQ ID NOs: 3-4; SEQ ID NO: 1: ACGTTGGATGAGCACCTTCCTTTCTTTTTG SEQ ID NO:2:ACGTTGGATGTCTTGTGAAACAAAATGC SEQ ID NO:3:ACGTTGGATGATAACCAAATGCAATGTGAA SEQ ID NO: 4: ACGTTGGATGTACAACACCCTTCTCACAG.

2. The primer set according to claim 1, characterized in that The primer set also includes ALB reference gene amplification primers, and the base sequences of the ALB reference gene amplification primers are shown in SEQ ID NOs: 5-6: SEQ ID NO: 5: ACGTTGGATGAAGCACAGAGAAAAGAGGC; SEQ ID NO: 6: ACGTTGGATGCTTATTCATCTGTTTTTC.

3. The primer set according to claim 2, characterized in that The primer set also includes a UEP primer for a single base extension reaction, the base sequence of the UEP primer for exon 7 is shown in SEQ ID NO: 7, the base sequence of the UEP primer for exon 8 is shown in SEQ ID NO: 8, and the base sequence of the UEP primer for the ALB reference gene is shown in SEQ ID NO: 9: SEQ ID NO:7: TTTATTTTCCTTACAGGGTTT SEQ ID NO:8:CCCGTGCTGGCCTCCCACCCCCACC SEQ ID NO:9: GTGTAAAGCCAACACCC.

4. Use of a primer set for detecting SMN1 exon polymorphism according to any one of claims 1 to 3, characterized in that At least one of the following (1)-(2): (1) performing SMN1 exon polymorphism detection on a sample; (2) preparing a kit for performing SMN1 exon polymorphism detection on a sample. 5 . A kit for detecting SMN1 exon polymorphism, comprising the primer set according to claim 3 .

6. The kit as claimed in claim 5, characterized in that The kit comprises a multiplex PCR amplification reaction system containing the multiplex PCR amplification primers, a SAP purification reaction system, and a single base extension reaction system containing the UEP primers.

7. The kit according to claim 6, characterized in that The multiplex PCR amplification reaction solution comprises multiplex PCR amplification primers having base sequences as shown in SEQ ID NOs: 1 to 6, PCR buffer, a deoxynucleoside triphosphate mixture, DNA polymerase, and MgCl2; The SAP purification reaction system comprises SAP enzyme and SAP buffer; The single base extension reaction system comprises UEP primers with base sequences as shown in SEQ ID NOs: 7 to 9, BufferPlus, Termination mix and Pro Enzyme.

8. Use of the kit according to any one of claims 5 to 7 in detecting SMN1 gene exon polymorphism; the SMN1 gene exon polymorphism includes the copy number of exon 7 and exon 8.

9. A method for detecting SMN1 gene exon polymorphism in vitro for non-diagnostic purposes using the kit according to any one of claims 5 to 7, characterized in that The method comprises the following steps: (1) Multiplex PCR amplification reaction Extracting template DNA from samples, preparing a multiplex PCR amplification reaction system, performing multiplex PCR amplification reactions, and obtaining multiplex PCR amplification products; (2) SAP purification reaction: Purifying the multiplex PCR amplification products with SAP enzyme to obtain purified products; (3) Single base extension reaction The purified product of step (2) is subjected to a single base extension reaction to obtain an extension product; (4) Nucleic acid mass spectrometry analysis The extension products were detected by nucleic acid mass spectrometer to obtain the copy numbers of exons 7 and 8 of SMN1.

10. The method according to claim 9, characterized in that In the step (4), the deletion of exons 7 and 8 is calculated and determined based on the copy numbers of exons 7 and 8 of SMN1.

Images