Method for producing cell, method for producing heteromultimeric protein, method for producing bispecific antibody, vector set, mammalian cell, CHO cell, and method for producing cell pool

Abstract

The vector group is introduced into a host cell, and a cell for producing a heteromultimeric protein is selected from the host cells into which the vector group is introduced. The vector group is a group comprising a first expression vector and a second expression vector, and an expression cassette of at least one type of subunit X constituting a part of the subunit of the heteromultimeric protein is included in both the first expression vector and the second expression vector. Expression cassettes of a subunit Y remaining after the subunit X is removed from the subunits constituting the heteromultimeric protein are included in one of the first expression vector and the second expression vector for each type.

Description

Technical Field

[0001] The present disclosure relates to methods for preparing cells, methods for producing heteromultimeric proteins, methods for producing bispecific antibodies, vector sets, mammalian cells, CHO cells, and methods for preparing cell pools. Background Art

[0002] Patent Document 1 discloses a method for selecting cells expressing a bispecific antibody, which comprises transducing eukaryotic cells using a lentivirus.

[0003] Patent Document 2 discloses that a bispecific anti-HER2 antibody is produced by culturing a host cell containing an expression vector for the bispecific anti-HER2 antibody.

[0004] Patent document 3 discloses a multispecific antigen-binding molecule comprising (1) a domain comprising an antibody variable region having glypican 3 binding activity, (2) a domain comprising an antibody variable region having T-cell receptor complex binding activity, and (3) a domain comprising an Fc region with reduced binding activity to Fcγ receptors, wherein the variable regions of (1) and (2) have a common amino acid sequence in the L chain variable region contained in the variable regions.

[0005] Patent Document 4 discloses a multispecific antigen-binding molecule comprising a first antigen-binding site that recognizes coagulation factor IX and a second antigen-binding site that recognizes coagulation factor X, and having a function of replacing the function of coagulation factor VIII.

[0006] Patent Document 5 discloses a bispecific antibody comprising an antigen-binding domain that binds to CD40 and an antigen-binding domain that binds to EpCAM.

[0007] Patent Document 6 discloses a bispecific anti-HER2 antibody having a common light chain and two heavy chains that are different from each other.

[0008] Patent Document 7 discloses a bispecific antibody that binds to the extracellular portion of PD-1 and the extracellular portion of TIM-3.

[0009] Patent Document 8 discloses a bispecific antibody that binds to hPD-L1 and TIGIT or LAG-3.

[0010] Patent Document 9 discloses a bispecific antibody that binds to CD38 and PD-L1.

[0011] Patent Document 10 discloses a fibronectin secretion leader that promotes the secretion of a target polypeptide produced in a host cell.

[0012] Prior art literature

[0013] Patent Literature

[0014] Patent Document 1: Japanese Patent Application No. 2015-503907

[0015] Patent Document 2: Japanese Patent Application No. 2017-501706

[0016] Patent Document 3: International Publication No. 2016 / 047722

[0017] Patent Document 4: International Publication No. 2012 / 067176

[0018] Patent Document 5: International Publication No. 2019 / 093342

[0019] Patent Document 6: Japanese Patent Application No. 2018-504113

[0020] Patent Document 7: Japanese Patent Application No. 2020-532281

[0021] Patent Document 8: Japanese Patent Application No. 2019-528083

[0022] Patent Document 9: Japanese Patent Application No. 2019-516396

[0023] Patent Document 10: International Publication No. 2014 / 177826 Summary of the invention

[0024] Problems to be solved by the invention

[0025] In the past, for the purpose of preparing cells that produce heteromultimeric proteins, expression vectors of subunits constituting heteromultimeric proteins were introduced into host cells. For example, when a heteromultimeric protein is composed of 1 subunit A, 1 subunit B, and 1 subunit C, an expression vector containing 1 expression cassette of subunit A, 1 expression cassette of subunit B, and 1 expression cassette of subunit C is introduced into a host cell. In simple terms, the above three subunits are expressed at an expression ratio of 1:1:1 to generate a heteromultimeric protein. However, in reality, the expression level or purity of the heteromultimeric protein is low, and the production of the heteromultimeric protein sometimes does not reach the expected value. As reasons for this, it is considered that the transcription rate or translation rate of each subunit is different; some subunits are easy to decompose; when the number of subunits of a specific type is excessive, all subunits aggregate, etc.

[0026] As a means of increasing the expression level or purity of heteromultimeric proteins, it is considered to know the optimal ratio of subunit expression levels in advance and place the expression cassettes of the subunits in one expression vector according to the ratio of the number of subunits. However, it is not necessarily easy to know the optimal ratio of subunit expression levels. In addition, when the optimal ratio of subunit expression levels is a relatively large integer (e.g., 1:2:3), the total number of expression cassettes placed in one expression vector increases. As a result, the size of the expression vector increases, and the introduction rate into the host cell decreases.

[0027] As another means of increasing the expression level or purity of a heteromultimeric protein, it is considered to place the expression cassettes of the subunits in separate expression vectors and introduce multiple expression vectors into the host cell. For example, when a heteromultimeric protein is composed of subunit A, subunit B, and subunit C, expression vector A of subunit A, expression vector B of subunit B, and expression vector C of subunit C are introduced into the host cell. The number of expression vectors A, expression vector B, and expression vector C introduced into the host cell varies from host cell to host cell, so the number of each expression cassette possessed by the host cell is diverse. From a variety of host cells, cells with high expression level or purity of the heteromultimeric protein are selected. However, it is necessary to construct the same number of expression vectors as the number of subunits constituting the heteromultimeric protein, and it is necessary to prepare the same number of selection markers as the number of subunits.

[0028] The present disclosure provides a means different from the above two means as a means for increasing the expression amount or purity of a heteromultimeric protein.

[0029] One embodiment of the present disclosure aims to provide a method for producing cells that are excellent in the productivity of heteromultimeric proteins or bispecific antibodies.

[0030] One embodiment of the present disclosure aims to provide a method for producing a heteromultimeric protein or a bispecific antibody with excellent productivity.

[0031] One embodiment of the present disclosure is to provide a vector set used in the preparation of cells producing a heteromultimeric protein or a bispecific antibody.

[0032] One embodiment of the present disclosure is to provide mammalian cells and CHO cells that produce heteromultimeric proteins or bispecific antibodies.

[0033] One embodiment of the present disclosure aims to provide a method for preparing a cell pool used for screening cells producing a heteromultimeric protein or a bispecific antibody.

[0034] Means for solving problems

[0035] The method for preparing cells disclosed herein introduces a first expression vector and a second expression vector (ie, two expression vectors) into a host cell to express a heteromultimeric protein.

[0036] In both the first expression vector and the second expression vector, an expression cassette of a subunit of interest (generally a subunit whose expression is to be enhanced) is placed. The subunit of interest may be one or more than two. The expression cassettes of the remaining subunits other than the subunit of interest are placed in either the first expression vector or the second expression vector according to their types.

[0037] By introducing both the first expression vector and the second expression vector into the host cell, the expression of all subunits is ensured. Since the expression cassette of the subunit of interest is present in both the first expression vector and the second expression vector, the amount of introduction becomes larger, and the expression of the subunit of interest can be enhanced.

[0038] The number of the first expression vector and the second expression vector introduced into the host cell varies from host cell to host cell, so the number of each expression cassette in the host cell varies. Cells that meet the evaluation criteria (e.g., the expression amount or purity of the heteromultimeric protein) are selected from a variety of host cells.

[0039] Specific means for solving the problems include the following.

[0040] <1> A method for preparing a cell, which is a method for preparing a cell that produces a heteromultimeric protein composed of n subunits (n is an integer greater than or equal to 2), the method comprising:

[0041] Introducing the vector assembly into a host cell, and

[0042] Selecting cells producing heteromultimeric proteins from host cells introduced with the vector group;

[0043] Vector set: a vector set consisting of a first expression vector and a second expression vector,

[0044] An expression cassette for at least one subunit X that is a part of the n subunits is contained in both the first expression vector and the second expression vector,

[0045] The expression cassette for the subunit Y remaining after removing the subunit X from the n types of subunits is contained in one of the first expression vector and the second expression vector according to the type.

[0046] <2> according to <1> The method for preparing the cell, wherein

[0047] The vector group is the following vector group;

[0048] Vector set: a vector set consisting of a first expression vector and a second expression vector,

[0049] An expression cassette for at least one subunit X that is a part of the n subunits is contained in both the first expression vector and the second expression vector,

[0050] All expression cassettes for subunit Y remaining after subunit X is removed from the n types of subunits are contained in one of the first expression vector and the second expression vector.

[0051] <3> according to <1> or <2> The method for preparing the cell, wherein

[0052] A heteromultimeric protein composed of n subunits is a heteromultimeric protein composed of 2 or more and 6 or less subunits.

[0053] The at least one subunit X is one, two or three subunit Xs.

[0054] <4> according to <1> or <2> The method for preparing the cell, wherein

[0055] A heteromultimeric protein composed of n subunits is a heteromultimeric protein composed of 3 or 4 subunits.

[0056] The at least one subunit X is one, two or three subunit Xs.

[0057] <5> according to <1> or <2> The method for preparing the cell, wherein

[0058] A heteromultimeric protein composed of n subunits is a heteromultimeric protein composed of 3 subunits.

[0059] The at least one subunit X is one or two subunit Xs.

[0060] <6> according to <1> ~ <5> The method for preparing a cell according to any one of items, wherein the heteromultimeric protein is an antibody.

[0061] <7> according to <1> ~ <5> The method for preparing a cell according to any one of items, wherein the heteromultimeric protein is a bispecific antibody.

[0062] <8> according to <1> ~ <7> The method for producing a cell according to any one of items, wherein the expression cassettes of the subunits constituting the heteromultimeric protein all contain the same type of promoter.

[0063] <9> according to <8> The cell preparation method, wherein the promoter is the hEF-1α promoter.

[0064] <10> according to <1> ~ <9> The method for preparing a cell according to any one of the above, wherein

[0065] At least one of the expression cassettes constituting the subunits of the heteromultimeric protein comprises a coding sequence for a fibronectin secretion leader,

[0066] In the expression cassette comprising the coding sequence of the fibronectin secretion leader, the coding sequences of the subunits constituting the heteromultimeric protein are arranged downstream of the coding sequence of the fibronectin secretion leader in the same reading frame.

[0067] <11> according to <1> ~ <9> The method for preparing a cell according to any one of the above, wherein

[0068] The expression cassettes of the subunits constituting the heteromultimeric protein all contain the coding sequence of the fibronectin secretion leader,

[0069] The coding sequences of the subunits constituting the heteromultimeric protein are arranged downstream of the coding sequence of the fibronectin secretory leader in the same reading frame.

[0070] <12> according to <1> ~ <11> The method for preparing a cell according to any one of the above, wherein

[0071] The first expression vector further comprises an expression cassette for a first selection marker,

[0072] The second expression vector further comprises an expression cassette for a second selection marker.

[0073] <13> according to <12> The method for preparing the cell, wherein

[0074] The first selection marker and the second selection marker are selection markers of different types from each other,

[0075] The first selection marker is at least one selected from the group consisting of a dihydrofolate reductase gene, a glutamine synthetase gene, and an antibiotic resistance gene.

[0076] The second selection marker is at least one selected from the group consisting of a dihydrofolate reductase gene, a glutamine synthetase gene, and an antibiotic resistance gene.

[0077] <14> according to <1> ~ <13> The method for preparing a cell according to any one of items, wherein the host cell is a mammalian cell.

[0078] <15> according to <1> ~ <13> The method for preparing a cell according to any one of the above, wherein the host cell is a CHO cell (Chinese hamster ovary cell).

[0079] <16> according to <1> ~ <13> The method for preparing a cell according to any one of the above, wherein the host cell is a CHO-DG44 cell, a CHO-K1 cell, a CHO-DXB11 cell, a CHOpro3 - Cells or cell lines derived from these cells.

[0080] <17-1> According to <1> The method for preparing the cell, wherein

[0081] The heteromultimeric protein is a bispecific antibody composed of a first H chain, a second H chain, and an L chain common to the first H chain and the second H chain.

[0082] Subunit X is the L chain, subunit Y is the first H chain and the second H chain,

[0083] The vector group is the following vector group;

[0084] Vector set: a vector set consisting of a first expression vector and a second expression vector,

[0085] Both the first expression vector and the second expression vector contain an expression cassette for the L chain,

[0086] One of the first expression vector and the second expression vector comprises an expression cassette for the first H chain,

[0087] One of the first expression vector and the second expression vector contains an expression cassette for the second H chain.

[0088] <17-2> A method for preparing a cell that produces a bispecific antibody composed of a first H chain, a second H chain, and an L chain common to the first H chain and the second H chain, the method comprising:

[0089] Introducing the vector assembly into a host cell, and

[0090] Selecting cells producing bispecific antibodies from host cells introduced with the vector group;

[0091] Vector set: a vector set consisting of a first expression vector and a second expression vector,

[0092] Both the first expression vector and the second expression vector contain an expression cassette for the L chain,

[0093] One of the first expression vector and the second expression vector comprises an expression cassette for the first H chain,

[0094] One of the first expression vector and the second expression vector contains an expression cassette for the second H chain.

[0095] <17-3> The method for producing a cell according to any one of <17-1> or <17-2>, wherein one of the first expression vector and the second expression vector comprises an expression cassette for the first H chain and an expression cassette for the second H chain.

[0096] <17-4> The method for preparing a cell according to any one of <17-1> to <17-3>, wherein

[0097] The first expression vector comprises an expression cassette for the L chain, an expression cassette for the first H chain, and an expression cassette for the second H chain,

[0098] The second expression vector contains an L chain expression cassette.

[0099] <17-5> The method for producing a cell according to any one of <17-1> to <17-4>, wherein the bispecific antibody is a tetramer consisting of one first H chain, one second H chain, and two L chains.

[0100] <18-1> The method for preparing a cell according to any one of <17-1> to <17-5>, wherein

[0101] The first expression vector and the second expression vector each contain one L chain expression cassette,

[0102] One of the first expression vector and the second expression vector comprises an expression cassette for the first H chain,

[0103] One of the first expression vector and the second expression vector contains one expression cassette for the second H chain.

[0104] <18-2> According to <1> The method for preparing the cell, wherein

[0105] The heteromultimeric protein is a bispecific antibody composed of H chain, L chain and scFv-Fc.

[0106] Subunit X is L chain and scFv-Fc, subunit Y is H chain,

[0107] The carrier group is the following carrier group A;

[0108] Vector group A: a vector group consisting of a first expression vector and a second expression vector,

[0109] Both the first expression vector and the second expression vector contain an expression cassette for the L chain and an expression cassette for scFv-Fc,

[0110] One of the first expression vector and the second expression vector contains an expression cassette for the H chain.

[0111] <18-3> According to <1> The method for preparing the cell, wherein

[0112] The heteromultimeric protein is a bispecific antibody composed of H chain, L chain and scFv-Fc.

[0113] Subunit X is scFv-Fc, subunit Y is H chain and L chain,

[0114] The vector group is the following vector group B;

[0115] Vector group B: a vector group consisting of the first expression vector and the second expression vector

[0116] Both the first expression vector and the second expression vector contain an expression cassette for scFv-Fc,

[0117] One of the first expression vector and the second expression vector comprises an expression cassette for the H chain,

[0118] One of the first expression vector and the second expression vector contains an expression cassette for the L chain.

[0119] <18-4> A method for preparing a cell that produces a bispecific antibody composed of an H chain, an L chain, and scFv-Fc, the method comprising:

[0120] Introducing vector group A or B into host cells, and

[0121] Selecting cells producing bispecific antibodies from host cells introduced with vector group A or B;

[0122] Vector group A: a vector group consisting of a first expression vector and a second expression vector,

[0123] Both the first expression vector and the second expression vector contain an expression cassette for the L chain and an expression cassette for scFv-Fc,

[0124] One of the first expression vector and the second expression vector comprises an expression cassette for the H chain;

[0125] Vector group B: a vector group consisting of the first expression vector and the second expression vector,

[0126] Both the first expression vector and the second expression vector contain an expression cassette for scFv-Fc,

[0127] One of the first expression vector and the second expression vector comprises an expression cassette for the H chain,

[0128] One of the first expression vector and the second expression vector contains an expression cassette for the L chain.

[0129] <18-5> The method for producing a cell according to any one of <18-2> to <18-4>, wherein the bispecific antibody is a trimer consisting of one H chain, one L chain, and one scFv-Fc.

[0130] <19> The method for producing a cell according to any one of <17-1> to <17-5> and <18-1> to <18-5>, wherein the expression cassettes for the subunits constituting the bispecific antibody all contain the same type of promoter.

[0131] <20> according to <19> The cell preparation method, wherein the promoter is the hEF-1α promoter.

[0132] <21> According to <17-1>~<17-5>, <18-1>~<18-5>, <19> and <20> The method for preparing a cell according to any one of the above, wherein

[0133] At least one of the expression cassettes constituting the subunits of the bispecific antibody comprises a coding sequence for a fibronectin secretion leader,

[0134] In the expression cassette comprising the coding sequence of the fibronectin secretion leader, the coding sequences of the subunits constituting the bispecific antibody are arranged downstream of the coding sequence of the fibronectin secretion leader in the same reading frame.

[0135] <22> According to <17-1>~<17-5>, <18-1>~<18-5>, <19> and <20> The method for preparing a cell according to any one of the above, wherein

[0136] The expression cassettes of the subunits constituting the bispecific antibody all contain the coding sequence of the fibronectin secretion leader,

[0137] The coding sequences of the subunits constituting the bispecific antibody are arranged downstream of the coding sequence of the fibronectin secretion leader in the same reading frame.

[0138] <23> According to <17-1>~<17-5>, <18-1>~<18-5> and <19> ~ <22> The method for preparing a cell according to any one of the above, wherein

[0139] The first expression vector further comprises an expression cassette for a first selection marker,

[0140] The second expression vector further comprises an expression cassette for a second selection marker.

[0141] <24> according to <23> The method for preparing the cell, wherein

[0142] The first expression vector comprises an expression cassette for the L chain, an expression cassette for the first H chain, an expression cassette for the second H chain, and an expression cassette for the first selection marker,

[0143] The second expression vector contains an expression cassette for the L chain and an expression cassette for the second selection marker.

[0144] <25> according to <24> The method for preparing the cell, wherein

[0145] The first selection marker and the second selection marker are selection markers of different types from each other,

[0146] The first selection marker is the dihydrofolate reductase gene or the glutamine synthetase gene.

[0147] <26> according to <24> The method for preparing the cell, wherein

[0148] The first selection marker is a dihydrofolate reductase gene or a glutamine synthetase gene,

[0149] The second selectable marker is an antibiotic resistance gene.

[0150] <27> According to <17-1>~<17-5>, <18-1>~<18-5> and <19> ~ <26> The method for preparing a cell according to any one of items, wherein the host cell is a mammalian cell.

[0151] <28> According to <17-1>~<17-5>, <18-1>~<18-5> and <19> ~ <26> The method for preparing a cell according to any one of the above, wherein the host cell is a CHO cell (Chinese hamster ovary cell).

[0152] <29> According to <17-1>~<17-5>, <18-1>~<18-5> and <19> ~ <26> The method for preparing a cell according to any one of the above, wherein the host cell is a CHO-DG44 cell, a CHO-K1 cell, a CHO-DXB11 cell, a CHOpro3 - Cells or cell lines derived from these cells.

[0153] <30> A method for producing a heteromultimeric protein, comprising:

[0154] Cultivate through <1> ~ <16> A cell prepared by the method for preparing a cell according to any one of items.

[0155] <31> A method for producing a bispecific antibody, comprising

[0156] Cultivate by <17-1> ~ <17-5>, <18-1> ~ <18-5> and <19> ~ <29> A cell prepared by the method for preparing a cell according to any one of items.

[0157] <32> A vector set for expressing a heteromultimeric protein composed of n subunits (n is an integer greater than or equal to 2),

[0158] is a set of a first expression vector and a second expression vector,

[0159] An expression cassette for at least one subunit X that is a part of the n subunits is contained in both the first expression vector and the second expression vector,

[0160] The expression cassette for the subunit Y remaining after removing the subunit X from the n types of subunits is contained in one of the first expression vector and the second expression vector according to the type.

[0161] <33> according to <32> The vector set is a set of a first expression vector and a second expression vector,

[0162] An expression cassette for at least one subunit X that is a part of the n subunits is contained in both the first expression vector and the second expression vector,

[0163] All expression cassettes for subunit Y remaining after subunit X is removed from the n types of subunits are contained in one of the first expression vector and the second expression vector.

[0164] <34> according to <32> or <33> The vector group, wherein

[0165] A heteromultimeric protein composed of n subunits is a heteromultimeric protein composed of 2 or more and 6 or less subunits.

[0166] The at least one subunit X is one, two or three subunit Xs.

[0167] <35> according to <32> or <33> The vector group, wherein

[0168] A heteromultimeric protein composed of n subunits is a heteromultimeric protein composed of 3 or 4 subunits.

[0169] The at least one subunit X is one, two or three subunit Xs.

[0170] <36> according to <32> or <33> The vector group, wherein

[0171] A heteromultimeric protein composed of n subunits is a heteromultimeric protein composed of 3 subunits.

[0172] The at least one subunit X is one or two subunit Xs.

[0173] <37> according to <32> ~ <36> The vector set described in any one of items, wherein the heteromultimeric protein is an antibody.

[0174] <38> according to <32> ~ <36> The vector set described in any one of the above items, wherein the heteromultimeric protein is a bispecific antibody.

[0175] <39> according to <32> ~ <38> The vector set described in any one of the above items, wherein the expression cassettes of the subunits constituting the heteromultimeric protein all contain the same type of promoter.

[0176] <40> according to <39> The vector set, wherein the promoter is the hEF-1α promoter.

[0177] <41> according to <32> ~ <40> The vector set described in any one of the above items, wherein

[0178] At least one of the expression cassettes constituting the subunits of the heteromultimeric protein comprises a coding sequence for a fibronectin secretion leader,

[0179] In the expression cassette comprising the coding sequence of the fibronectin secretion leader, the coding sequences of the subunits constituting the heteromultimeric protein are arranged downstream of the coding sequence of the fibronectin secretion leader in the same reading frame.

[0180] <42> according to <32> ~ <40> The vector set described in any one of the above items, wherein

[0181] The expression cassettes of the subunits constituting the heteromultimeric protein all contain the coding sequence of the fibronectin secretion leader,

[0182] The coding sequences of the subunits constituting the heteromultimeric protein are arranged downstream of the coding sequence of the fibronectin secretory leader in the same reading frame.

[0183] <43> according to <32> ~ <42> The vector set described in any one of the above items, wherein

[0184] The first expression vector further comprises an expression cassette for a first selection marker,

[0185] The second expression vector further comprises an expression cassette for a second selection marker.

[0186] <44> according to <43> The vector group, wherein

[0187] The first selection marker and the second selection marker are selection markers of different types from each other,

[0188] The first selection marker is at least one selected from the group consisting of a dihydrofolate reductase gene, a glutamine synthetase gene, and an antibiotic resistance gene.

[0189] The second selection marker is at least one selected from the group consisting of a dihydrofolate reductase gene, a glutamine synthetase gene, and an antibiotic resistance gene.

[0190] <45-1> According to <32> The vector group, wherein

[0191] The heteromultimeric protein is a bispecific antibody composed of a first H chain, a second H chain, and an L chain common to the first H chain and the second H chain.

[0192] Subunit X is the L chain, subunit Y is the first H chain and the second H chain,

[0193] Both the first expression vector and the second expression vector contain an expression cassette for the L chain,

[0194] One of the first expression vector and the second expression vector comprises an expression cassette for the first H chain,

[0195] One of the first expression vector and the second expression vector contains an expression cassette for the second H chain.

[0196] <45-2> A vector set for expressing a bispecific antibody composed of a first H chain, a second H chain, and an L chain common to the first H chain and the second H chain,

[0197] is a set of a first expression vector and a second expression vector,

[0198] Both the first expression vector and the second expression vector contain an expression cassette for the L chain,

[0199] One of the first expression vector and the second expression vector comprises an expression cassette for the first H chain,

[0200] One of the first expression vector and the second expression vector contains an expression cassette for the second H chain.

[0201] <45-3> The vector set according to <45-1> and <45-2>, wherein one of the first expression vector and the second expression vector comprises an expression cassette for the first H chain and an expression cassette for the second H chain.

[0202] <45-4> The vector set according to any one of <45-1> to <45-3>, wherein

[0203] The first expression vector comprises an expression cassette for the L chain, an expression cassette for the first H chain, and an expression cassette for the second H chain,

[0204] The second expression vector contains an L chain expression cassette.

[0205] <45-5> The vector set according to any one of <45-1> to <45-4>, wherein the bispecific antibody is a tetramer consisting of one first H chain, one second H chain, and two L chains.

[0206] <46-1> The vector set according to any one of <45-1> to <45-5>, wherein

[0207] The first expression vector and the second expression vector each contain one L chain expression cassette,

[0208] One of the first expression vector and the second expression vector comprises an expression cassette for the first H chain,

[0209] One of the first expression vector and the second expression vector contains one expression cassette for the second H chain.

[0210] <46-2> According to <32> The vector group, wherein

[0211] The heteromultimeric protein is a bispecific antibody composed of H chain, L chain and scFv-Fc.

[0212] Subunit X is L chain and scFv-Fc, subunit Y is H chain,

[0213] Both the first expression vector and the second expression vector contain an expression cassette for the L chain and an expression cassette for scFv-Fc,

[0214] One of the first expression vector and the second expression vector contains an expression cassette for the H chain.

[0215] <46-3> According to <32> The vector group, wherein

[0216] The heteromultimeric protein is a bispecific antibody composed of H chain, L chain and scFv-Fc.

[0217] Subunit X is scFv-Fc, subunit Y is H chain and L chain,

[0218] Both the first expression vector and the second expression vector contain an expression cassette for scFv-Fc,

[0219] One of the first expression vector and the second expression vector comprises an expression cassette for the H chain,

[0220] One of the first expression vector and the second expression vector contains an expression cassette for the L chain.

[0221] <46-4> A vector set for expressing a bispecific antibody composed of an H chain, an L chain, and scFv-Fc,

[0222] is a set of a first expression vector and a second expression vector,

[0223] Both the first expression vector and the second expression vector contain an expression cassette for the L chain and an expression cassette for scFv-Fc,

[0224] One of the first expression vector and the second expression vector contains an expression cassette for the H chain.

[0225] <46-5> A vector set for expressing a bispecific antibody composed of an H chain, an L chain, and scFv-Fc,

[0226] is a set of a first expression vector and a second expression vector,

[0227] Both the first expression vector and the second expression vector contain an expression cassette for scFv-Fc,

[0228] One of the first expression vector and the second expression vector comprises an expression cassette for the H chain,

[0229] One of the first expression vector and the second expression vector contains an expression cassette for the L chain.

[0230] <46-6> The vector set according to any one of <46-2> to <46-5>, wherein the bispecific antibody is a trimer consisting of an H chain, an L chain, and scFv-Fc.

[0231] <47> The vector set according to any one of <45-1> to <45-5> and <46-1> to <46-6>, wherein the expression cassettes for the subunits constituting the bispecific antibody all contain the same type of promoter.

[0232] <48> according to <47> The vector set, wherein the promoter is the hEF-1α promoter.

[0233] <49> According to <45-1>~<45-5>, <46-1>~<46-6>, <47> and <48> The vector set described in any one of the above items, wherein

[0234] At least one of the expression cassettes constituting the subunits of the bispecific antibody comprises a coding sequence for a fibronectin secretion leader,

[0235] In the expression cassette comprising the coding sequence of the fibronectin secretion leader, the coding sequences of the subunits constituting the bispecific antibody are arranged downstream of the coding sequence of the fibronectin secretion leader in the same reading frame.

[0236] <50> According to <45-1>~<45-5>, <46-1>~<46-6>, <47> and <48> The vector set described in any one of the above items, wherein

[0237] The expression cassettes of the subunits constituting the bispecific antibody all contain the coding sequence of the fibronectin secretion leader,

[0238] The coding sequences of the subunits constituting the bispecific antibody are arranged downstream of the coding sequence of the fibronectin secretion leader in the same reading frame.

[0239] <51> According to <45-1>~<45-5>, <46-1>~<46-6> and <47> ~ <50> The vector set described in any one of the above items, wherein

[0240] The first expression vector further comprises an expression cassette for a first selection marker,

[0241] The second expression vector further comprises an expression cassette for a second selection marker.

[0242] <52> according to <51> The vector group, wherein

[0243] The first expression vector comprises an expression cassette for the L chain, an expression cassette for the first H chain, an expression cassette for the second H chain, and an expression cassette for the first selection marker,

[0244] The second expression vector contains an expression cassette for the L chain and an expression cassette for the second selection marker.

[0245] <53> according to <52> The vector group, wherein

[0246] The first selection marker and the second selection marker are selection markers of different types from each other,

[0247] The first selection marker is the dihydrofolate reductase gene or the glutamine synthetase gene.

[0248] <54> according to <52> The vector group, wherein

[0249] The first selection marker is a dihydrofolate reductase gene or a glutamine synthetase gene,

[0250] The second selectable marker is an antibiotic resistance gene.

[0251] <55> Use according to <32> ~ <44> , <45-1>~<45-5>, <46-1>~<46-6> and <47> ~ <54> Mammalian cells transfected with the vector set described in any one of the items.

[0252] <56> Use according to <32> ~ <44> , <45-1>~<45-5>, <46-1>~<46-6> and <47> ~ <54> CHO cells (Chinese hamster ovary cells) transfected with the vector set described in any one of the above.

[0253] <57> Mammalian cells, which are used according to <45-1> to <45-5>, <46-1> to <46-6> and <47> ~ <54> A mammalian cell transfected with the vector set described in any one of the above items,

[0254] When the amount of mRNA of the first H chain is set to 1, the amount of mRNA of the second H chain is 0.5 to 2, and the amount of mRNA of the L chain is 2 to 10.

[0255] <58> Mammalian cells, which are used according to <45-1> to <45-5>, <46-1> to <46-6> and <47> ~ <54> A mammalian cell transfected with the vector set described in any one of the above items,

[0256] When the amount of mRNA of the first H chain is set to 1, the amount of mRNA of the second H chain is 0.625 to 1.6, and the amount of mRNA of the L chain is 3 to 8.

[0257] <59> CHO cells prepared according to <45-1> to <45-5>, <46-1> to <46-6> and <47> ~ <54> CHO cells transfected with the vector set described in any one of the above items,

[0258] When the amount of mRNA of the first H chain is set to 1, the amount of mRNA of the second H chain is 0.5 to 2, and the amount of mRNA of the L chain is 2 to 10.

[0259] <60> CHO cells prepared according to <45-1> to <45-5>, <46-1> to <46-6> and <47> ~ <54> CHO cells transfected with the vector set described in any one of the above items,

[0260] When the amount of mRNA of the first H chain is set to 1, the amount of mRNA of the second H chain is 0.625 to 1.6, and the amount of mRNA of the L chain is 3 to 8.

[0261] <61> A method for preparing a cell pool, comprising:

[0262] Will be based on <32> ~ <44> , <45-1>~<45-5>, <46-1>~<46-6> and <47> ~ <54> The vector set described in any one of items is introduced into a host cell.

[0263] <62> according to <61> In the method for preparing the cell pool, the host cells are mammalian cells.

[0264] <63> according to <61> In the method for preparing the cell pool, the host cell is a CHO cell (Chinese hamster ovary cell).

[0265] <64> according to <61> The preparation method of the cell pool, wherein the host cell is CHO-DG44 cell, CHO-K1 cell, CHO-DXB11 cell, CHOpro3 - Cells or cell lines derived from these cells.

[0266] Effects of the Invention

[0267] According to one embodiment (mode) of the present disclosure, a method for producing a cell having excellent productivity of a heteromultimeric protein or a bispecific antibody is provided.

[0268] According to one embodiment of the present disclosure, a method for producing a heteromultimeric protein or a bispecific antibody with excellent productivity is provided.

[0269] According to one embodiment of the present disclosure, a vector set used in the preparation of cells producing a heteromultimeric protein or a bispecific antibody is provided.

[0270] According to one embodiment of the present disclosure, mammalian cells and CHO cells that produce heteromultimeric proteins or bispecific antibodies are provided.

[0271] According to one embodiment of the present disclosure, a method for preparing a cell pool used in screening cells producing heteromultimeric proteins or bispecific antibodies is provided. BRIEF DESCRIPTION OF THE DRAWINGS

[0272] [ Figure 1 ] is a vector map of the expression vector 1 constructed in the example.

[0273] [ Figure 2 ] is a vector map of the expression vector 2 constructed in the example.

[0274] [ Figure 3 ] is a vector map of the expression vector 3 constructed in the example.

[0275] [ Figure 4 ] is a vector map of the expression vector 4 constructed in the example.

[0276] [ Figure 5 ] is a conceptual diagram showing the structure of the bispecific antibodies (BiAb1 and BiAb2) prepared in the examples. DETAILED DESCRIPTION

[0277] The following describes embodiments of the present disclosure. These descriptions and examples are illustrative of the embodiments and are not intended to limit the scope of the embodiments. The mechanisms of action described in the present disclosure include speculations, the correctness of which is not intended to limit the scope of the embodiments.

[0278] In the present disclosure, a numerical range expressed using "to" indicates a range including the numerical values ​​described before and after "to" as the minimum value and the maximum value, respectively.

[0279] In the numerical range recorded in stages in the present disclosure, the upper limit or lower limit recorded in one numerical range can be replaced by the upper limit or lower limit of the numerical range recorded in other stages. In addition, in the numerical range recorded in the present disclosure, the upper limit or lower limit of the numerical range can be replaced by the value shown in the embodiment.

[0280] In the present disclosure, each component may contain multiple corresponding substances. In the present disclosure, when the amount of each component in the composition is mentioned, if there are multiple substances corresponding to each component in the composition, unless otherwise specified, it means the total amount of the multiple substances present in the composition.

[0281] In the present disclosure, nucleic acid is a term that includes all nucleic acids (e.g., DNA, RNA, their analogs, natural products, artificial products) and all nucleic acids to which low molecular weight compounds, groups (e.g., methyl groups), molecules other than nucleic acids, constructs, etc. are linked. Nucleic acids may be single-stranded or double-stranded.

[0282] In the present disclosure, a vector is a substance that has the function of transporting exogenous nucleic acid into cells, and is itself a nucleic acid. An expression vector means a vector that expresses a polypeptide based on its nucleic acid sequence. There is no limitation on the size and base sequence of the vector and expression vector. The vector and expression vector are preferably double-stranded DNA.

[0283] In the present disclosure, polypeptide refers to a molecule in which amino acids are linked by peptide bonds. There is no limitation on the number of amino acid residues in a polypeptide, and polypeptide is a term that includes proteins. It is expected that the number of amino acid residues in a polypeptide in the present disclosure is 6 or more. The polypeptide includes a polypeptide in which amino acids are post-translationally modified. Examples of post-translational modifications of amino acids include phosphorylation, methylation, acetylation, and the like.

[0284] In the present disclosure, the three-letter notation and the one-letter notation prescribed by IUPAC-IUBMB JCBN (IUPAC-IUBMB Joint Commission on Biochemical Nomenclature) are used for the notation of amino acids. Unless otherwise specified, the amino acids mentioned in the present disclosure are L-amino acids.

[0285] In the present disclosure, a heteromultimeric protein refers to a protein formed by the aggregation of at least two subunits. One subunit refers to a single polypeptide constituting a multimeric protein. As a polypeptide constituting a multimeric protein, one polypeptide in which multiple polypeptides are connected by one or more peptide linkers is equivalent to one subunit. In other words, a heteromultimeric protein refers to a protein produced by at least two coding sequences expressed independently of each other. A heteromultimeric protein composed of n subunits is expressed by n coding sequences expressed independently of each other (n is an integer greater than 2).

[0286] Examples of heteromultimeric proteins include antibodies, Fc fusion proteins, enzymes, interleukins, cytokines, chemokines, peptide hormones, growth factors, transcription factors, receptors, receptor fragments, therapeutic proteins, viruses, virus-like particles, and vaccines.

[0287] In the present disclosure, antibody is not limited to immunoglobulin, as long as it is a molecule that binds to an antigen. In the present disclosure, antibody is a term that includes antibody fragments and antigen-binding molecules. Antibodies include any one of monovalent antibodies and multivalent antibodies. Antibodies include any one of immunoglobulin molecules themselves (intact immunoglobulin), Fab antibodies, Fab' antibodies, F(ab')2 antibodies, single-chain antibodies (scFv), double-chain antibodies and their variants. Antibodies have an antigen recognition site called an antibody binding cluster (paratope), and the antibody binding cluster binds to the antigen.

[0288] A general IgG comprises two heavy chains (HC) having the same amino acid sequence and two light chains (LC) having the same amino acid sequence, and has a structure in which the HCs are linked to each other by disulfide bonds and the HCs and LCs are linked to each other by disulfide bonds. The HCs comprise a variable region (VH) and a constant region (CH1, CH2, and CH3), and the LCs comprise a variable region (VL) and a constant region (CL).

[0289] Examples of antibodies include human antibodies having human variable regions and human constant regions; mouse antibodies having mouse variable regions and mouse constant regions; chimeric antibodies combining regions derived from multiple animals; humanized antibodies having mouse variable regions and human constant regions; humanized antibodies having camelid heavy chain variable regions and human Fc regions, etc.

[0290] As examples of antibodies, bispecific antibodies and multispecific antibodies can be cited. Bispecific antibodies refer to antibodies that can bind to two epitopes simultaneously. Multispecific antibodies refer to antibodies that can bind to three or more epitopes simultaneously. The structure of bispecific antibodies and the number of epitope binding sites are not limited. The structure of multispecific antibodies and the number of epitope binding sites are not limited.

[0291] As an example of a bispecific antibody, a bispecific antibody consisting of a first H chain, a second H chain, and an L chain common to the first H chain and the second H chain can be cited. It should be noted that in the present disclosure, an L chain common to two H chains means one L chain paired with two H chains. An example of the bispecific antibody is a 4-mer connected by a disulfide bond by one first H chain, one second H chain, and two L chains. Each of the first H chain, the second H chain, and the L chain may include at least a region for recognizing an antigen and a region for forming an antibody.

[0292] As a further example of a bispecific antibody, a bispecific antibody composed of an H chain, an L chain and scFv-Fc can be cited. scFv is a fusion protein of the heavy chain variable region and the light chain variable region of an immunoglobulin, and scFv-Fc is a fusion protein of scFv and Fc region. An example of the bispecific antibody is a trimer in which one H chain, one L chain and one scFv-Fc are linked by a disulfide bond.

[0293] Bispecific antibodies are not limited to antigens and structures as long as they have an arm that recognizes a first antigen and an arm that recognizes a second antigen. Examples of bispecific antibodies include Emicizumab, Blinatumomab, Vanucizumab, Istiratumab, Pasotuxizumab, Duligotuzumab, Duvortuxizumab, and Faricimab.

[0294] One embodiment of the present disclosure is a method for preparing a cell that produces a heteromultimeric protein. The method for preparing a cell comprises introducing a vector set of a first expression vector and a second expression vector into a host cell, and selecting a cell that produces the heteromultimeric protein from the host cell introduced with the vector set.

[0295] In the present disclosure, the "vector set" means a set of a first expression vector and a second expression vector.

[0296] In the present disclosure, when describing matters common to the first expression vector and the second expression vector, the first expression vector and the second expression vector are collectively referred to as “expression vector”.

[0297] The host cell may be a prokaryotic cell or a eukaryotic cell. Examples of prokaryotic cells include bacterial cells. Examples of eukaryotic cells include yeast, insect cells, and mammalian cells. As the host cell, a eukaryotic cell is preferred, and a mammalian cell is more preferred.

[0298] Examples of bacterial cells include Gram-negative bacterial cells such as Escherichia coli, Salmonella typhimurium, Serratia marcescens, Pseudomonas putida, Pseudomonas aeruginosa, and Gram-positive bacterial cells such as Bacillus subtilis. Preferred bacterial cells are Enterobacteriaceae, more preferably Escherichia coli, particularly strain B or K12.

[0299] As examples of yeast, there can be mentioned Saccharomyces cerevisiae, Pichia pastoris and Hansenula polymorpha.

[0300] Examples of insect cells include BmN cells derived from Bombyx mori, Sf9 cells and Sf21 cells derived from Spodoptera frugiperda, S2 cells derived from Drosophila melanogaster, and Pv11 cells derived from Polypedilum vanderplanki.

[0301] Examples of mammalian cells include Chinese hamster ovary cells (CHO cells), baby hamster kidney cells (BHK cells), human embryonic kidney cell lines (e.g., HEK293 cells), human retinoblastoma-derived cell lines (e.g., PER.C6 cells), and mouse myeloma cell lines (e.g., NS0 cells and SP2 / 0 cells).

[0302] The host cell is preferably a Chinese hamster ovary cell (CHO cell). Examples of CHO cells include CHO-DG44 cells, CHO-K1 cells, CHO-DXB11 cells, CHOpro3 - Cells and cell lines derived from these cells.

[0303] As examples of means for introducing expression vectors into host cells, electroporation, lipofection, microinjection, and cell infection with viral vectors can be cited. Electroporation is preferred from the viewpoints of high safety, high introduction efficiency, and low cytotoxicity. In addition, electroporation is preferred from the viewpoint of introducing multiple expression vectors into cells without deviation due to the type of expression vectors and introducing them into cells and chromosomes with high uniformity.

[0304] There is no limitation on the order of introducing the first expression vector and the second expression vector into the host cell. The first expression vector and the second expression vector may be introduced into the host cell together or separately. From the viewpoint of shortening the steps and time required for the preparation of the target cell, it is preferred to introduce the first expression vector and the second expression vector into the host cell together.

[0305] When the first expression vector and the second expression vector are introduced into the host cell together, a vector solution containing the two expression vectors is prepared. In the vector solution, the molar concentration ratio of the first expression vector to the second expression vector is, for example, 1:5 to 5:1, 1:2 to 2:1, or 1:1.

[0306] When the first expression vector and the second expression vector are introduced into the host cell separately, a vector solution containing the first expression vector and a vector solution containing the second expression vector are prepared. The molar concentration ratio of the expression vectors in the two vector solutions is, for example, 1:5 to 5:1, 1:2 to 2:1, or 1:1. When the two vector solutions are contacted with the host cell separately to introduce the two vectors, the molar ratio of the first expression vector and the second expression vector contacted with the host cell is preferably, for example, 1:5 to 5:1, 1:2 to 2:1, or 1:1.

[0307] The sizes of the first expression vector and the second expression vector are not limited.

[0308] The size of the first expression vector is, for example, 400 bp to 50,000 bp (base pair), 600 bp to 20,000 bp, or 800 bp to 10,000 bp.

[0309] The size of the second expression vector is, for example, 400 bp to 50,000 bp (base pairs), 600 bp to 20,000 bp, or 800 bp to 10,000 bp.

[0310] The expression vector introduced into the host cell may be integrated into the host cell genome, may be integrated into an extrachromosomal factor such as a plasmid, or may be contained in the cell as an independent extrachromosomal factor. From the perspective of allowing the target heteromultimeric protein to be expressed for a long period of time, it is preferred that the expression vector be integrated into the host cell genome.

[0311] The selection of cells producing heteromultimeric proteins from the host cells into which the vector set has been introduced is carried out, for example, by setting a standard for the expression level and / or purity of the heteromultimeric protein and selecting cells that meet the standard; or selecting cells with a relatively high expression level and / or purity of the heteromultimeric protein. Specifically, for example, the following (a) to (d) are performed.

[0312] (a) Adding a selective agent to the culture medium of the host cells.

[0313] (b) The host cells are isolated into single cells.

[0314] (c) A portion of the culture medium of the single-cellized cells is collected to measure the expression level and / or purity of the heteromultimeric protein.

[0315] (d) selecting cells whose expression level and / or purity of the heteromultimeric protein is greater than a standard value, and / or selecting cells whose expression level and / or purity of the heteromultimeric protein is relatively high.

[0316] The expression level of a heteromultimeric protein is the amount of the heteromultimeric protein itself.

[0317] The purity of a heteromultimeric protein means the proportion of the target heteromultimeric protein in the total amount of multiple proteins. The expression level and / or purity of a protein can be measured by a known method. For example, the amount of protein separated by electrophoresis or the like can be detected by known methods such as fluorescence, absorbance measurement, etc. A measuring machine such as icIEF analysis device Maurice (Protein Simple) can be used. In the expression of a heteromultimeric protein, a multimeric protein that is not in its original shape is sometimes produced (e.g., a multimeric protein lacking a part of a subunit, a multimeric protein in which a subunit is replaced by another subunit), and it is desirable that the proportion of multimeric proteins that are not in their original shape is low.

[0318] The cell producing the heteromultimeric protein may be a transient expression cell or a stable expression cell, preferably a stable expression cell.

[0319] One embodiment of the present disclosure is a vector set used in the preparation of a cell producing a heteromultimeric protein. The vector set is a set of a first expression vector and a second expression vector, and these two expression vectors contain all expression cassettes of subunits constituting the heteromultimeric protein. The heteromultimeric protein composed of n subunits is expressed from n expression cassettes whose coding sequences of the subunits are different from each other. The vector set contains n expression cassettes whose coding sequences of the subunits are different from each other.

[0320] The expression cassette of a subunit contains all nucleic acids required for the expression of the subunit. The size and base sequence of the expression cassette of a subunit are not limited. The size of one subunit expression cassette is, for example, 400 bp to 4000 bp (base pairs), 600 bp to 3000 bp, or 800 bp to 2000 bp.

[0321] In the construction of the vector set, the subunits constituting the heteromultimeric protein are divided into two groups, subunit X and subunit Y.

[0322] Subunit X is a part of the subunits constituting the heteromultimeric protein, for example, a subunit whose expression is to be enhanced. Subunit X is a part of the subunits constituting the heteromultimeric protein, but not all of them. Subunit X may be one or more than two. The number of subunits X in a heteromultimeric protein composed of n subunits is an integer of 1 or more and (n-1) or less.

[0323] Subunit Y is a subunit remaining after subunit X is removed from the subunits constituting the heteromultimeric protein. Subunit Y may be one type or two or more types.

[0324] The expression cassette of subunit X is contained in both the first expression vector and the second expression vector. In other words, both the first expression vector and the second expression vector contain the expression cassette of subunit X. Subunit X is expressed from both the first expression vector and the second expression vector.

[0325] For example, when subunit X is three types, X1, X2 and X3, the first expression vector comprises an expression cassette of X1, an expression cassette of X2 and an expression cassette of X3, and the second expression vector comprises an expression cassette of X1, an expression cassette of X2 and an expression cassette of X3.

[0326] The first expression vector may contain one or more expression cassettes for at least one subunit X, depending on the type of the subunit. When there are two or more subunits X, the number of expression cassettes for subunit X contained in the first expression vector may be the same or different between the types of subunits.

[0327] For example, when subunit X is three types, namely, X1, X2 and X3, the number of expression cassettes of X1, the number of expression cassettes of X2 and the number of expression cassettes of X3 contained in the first expression vector are independent of each other and may all be the same number or different numbers.

[0328] The second expression vector may contain one or more expression cassettes for at least one subunit X, depending on the type of the subunit. When there are two or more subunits X, the number of expression cassettes for subunit X contained in the second expression vector may be the same or different between the types of subunits.

[0329] For example, when subunit X is three types, namely, X1, X2 and X3, the number of expression cassettes of X1, the number of expression cassettes of X2 and the number of expression cassettes of X3 contained in the second expression vector are independent of each other and may all be the same number or different numbers.

[0330] As an example of an embodiment, the following embodiment can be mentioned: the first expression vector comprises an expression cassette of at least one subunit X of each type, and the second expression vector comprises an expression cassette of at least one subunit X of each type.

[0331] The expression cassette of at least one subunit Y is contained in one of the first expression vector and the second expression vector according to the type. The at least one subunit Y is expressed from one of the first expression vector and the second expression vector according to the type.

[0332] When there are two or more subunit Ys, one of the first expression vector and the second expression vector may contain expression cassettes for all subunit Ys, or the first expression vector and the second expression vector may contain expression cassettes for subunit Y separately according to the subunit type.

[0333] For example, when subunit Y is three types, namely, Y1, Y2 and Y3, it can be any of the following:

[0334] A solution in which only the first expression vector contains the expression cassette of Y1, the expression cassette of Y2, and the expression cassette of Y3;

[0335] A scheme in which the first expression vector comprises an expression cassette of Y1, and the second expression vector comprises an expression cassette of Y2 and an expression cassette of Y3;

[0336] A scheme in which the first expression vector comprises an expression cassette of Y2, and the second expression vector comprises an expression cassette of Y1 and an expression cassette of Y3;

[0337] A scheme in which the first expression vector contains the expression cassette of Y3, and the second expression vector contains the expression cassette of Y1 and the expression cassette of Y2.

[0338] When the first expression vector contains an expression cassette for subunit Y, the number of at least one expression cassette for subunit Y contained in the first expression vector may be one or two or more depending on the type of subunit. When the first expression vector contains two or more expression cassettes for subunit Y, the number of the expression cassettes for subunit Y contained in the first expression vector may be the same or different between the types of subunits.

[0339] For example, when the first expression vector contains three types of subunit Y, namely, Y1, Y2 and Y3, the number of expression cassettes of Y1, the number of expression cassettes of Y2 and the number of expression cassettes of Y3 contained in the first expression vector are independent of each other and can all be the same number or different numbers.

[0340] When the second expression vector contains an expression cassette for subunit Y, the number of at least one expression cassette for subunit Y contained in the second expression vector may be one or two or more depending on the type of subunit. When the second expression vector contains two or more expression cassettes for subunit Y, the number of the expression cassettes for subunit Y contained in the second expression vector may be the same or different between the types of subunits.

[0341] For example, when the second expression vector contains three types of subunit Y, namely, Y1, Y2 and Y3, the number of expression cassettes of Y1, the number of expression cassettes of Y2 and the number of expression cassettes of Y3 contained in the second expression vector are independent of each other and can all be the same number or different numbers.

[0342] As an example of an embodiment, one of the first expression vector and the second expression vector contains one expression cassette each for all types of subunit Y.

[0343] As another example of the embodiment, there can be mentioned an embodiment in which the first expression vector and the second expression vector separately contain expression cassettes of one of each type of subunit Y.

[0344] As an example of an embodiment of the vector set, there can be mentioned a vector set in which the expression cassette of at least one subunit X is contained in both the first expression vector and the second expression vector, and the expression cassette of at least one subunit Y is contained in one of the first expression vector and the second expression vector.

[0345] In other words, the above-mentioned vector set is a set in which both the first expression vector and the second expression vector contain the expression cassette of subunit X, and one of the first expression vector and the second expression vector contains the expression cassette of subunit Y.

[0346] As an example of an embodiment of a vector set, there can be cited a vector set in which the first expression vector contains one expression cassette for each type of subunit X, the second expression vector contains one expression cassette for each type of subunit X, and one of the first expression vector and the second expression vector contains one expression cassette for each type of subunit Y.

[0347] A preferred embodiment of using the vector set is an embodiment in which the heteromultimeric protein is an antibody. A more preferred embodiment of using the vector set is an embodiment in which the heteromultimeric protein is a bispecific antibody.

[0348] As a preferred embodiment of using the vector group, there can be mentioned an embodiment in which the heteromultimeric protein is composed of 2 or more and 6 or less subunits, and the subunit X is 1, 2 or 3. This embodiment, for example, includes:

[0349] The heteromultimeric protein is composed of 2 subunits, and subunit X is 1;

[0350] The heteromultimeric protein is composed of three subunits, and subunit X is one:

[0351] The heteromultimeric protein is composed of three subunits, and the subunit X is two;

[0352] The heteromultimeric protein is composed of 4 subunits, and subunit X is 1;

[0353] The heteromultimeric protein is composed of 4 subunits, and the subunit X is 2;

[0354] The heteromultimeric protein is composed of 5 subunits, and subunit X is 1;

[0355] The heteromultimeric protein is composed of 6 subunits, and the subunit X is 2;

[0356] The heteromultimeric protein is composed of 6 subunits, and there are 3 subunits X.

[0357] As a more preferred embodiment using a vector set, there can be mentioned an embodiment in which the heteromultimeric protein is composed of 3, 4 or 5 subunits, and the subunit X is 1 or 2. This embodiment, for example, includes:

[0358] The heteromultimeric protein is composed of three subunits, and subunit X is one;

[0359] The heteromultimeric protein is composed of three subunits, and the subunit X is two;

[0360] The heteromultimeric protein is composed of 4 subunits, and subunit X is 1;

[0361] The heteromultimeric protein is composed of 4 subunits, and the subunit X is 2;

[0362] A scheme in which a heteromultimeric protein is composed of five subunits and subunit X is one type, etc.

[0363] As a further preferred embodiment using the vector set, there can be mentioned an embodiment in which the heteromultimeric protein is composed of 3 or 4 subunits, and the subunit X is 1, 2 or 3. This embodiment, for example, includes:

[0364] The heteromultimeric protein is composed of three subunits, and subunit X is one:

[0365] The heteromultimeric protein is composed of three subunits, and the subunit X is two;

[0366] The heteromultimeric protein is composed of 4 subunits, and subunit X is 1;

[0367] The heteromultimeric protein is composed of four subunits, and there are two subunits X.

[0368] As a particularly preferred embodiment using the vector set, there is an embodiment in which the heteromultimeric protein is composed of three subunits and the subunit X is one or two.

[0369] As an example of a scheme utilizing a vector group, a scheme in which a heteromultimeric protein is a bispecific antibody consisting of a first H chain, a second H chain, and an L chain common to the first H chain and the second H chain can be cited. In this scheme, the expression level of the L chain is preferably equal to or greater than the total expression level of the first H chain and the second H chain. In addition, in this scheme, the mRNA amount of the L chain is preferably equal to or greater than the total mRNA amount of the first H chain and the second H chain. The mRNA amount is obtained by quantitative PCR as described below. As an example of an embodiment of a vector group involved in the bispecific antibody, the following vector groups can be cited.

[0370] A vector set, wherein both the first expression vector and the second expression vector comprise an expression cassette for an L chain, one of the first expression vector and the second expression vector comprises an expression cassette for a first H chain, and one of the first expression vector and the second expression vector comprises an expression cassette for a second H chain.

[0371] An example of the above-mentioned vector set is that one of the first expression vector and the second expression vector comprises an expression cassette for the first H chain and an expression cassette for the second H chain.

[0372] Another example of the above-mentioned vector set is that one of the first expression vector and the second expression vector comprises an expression cassette for the first H chain, and the other comprises an expression cassette for the second H chain.

[0373] In order to make the expression level of the first H chain and the expression level of the second H chain equivalent, it is preferred that one of the first expression vector and the second expression vector contain the expression cassette of the first H chain and the expression cassette of the second H chain at a ratio of 1:1.

[0374] From the viewpoint of reducing the size of the expression vector, the vector set involved in the above-mentioned bispecific antibody preferably comprises a first expression vector and a second expression vector each comprising an expression cassette for the L chain, one of the first expression vector and the second expression vector comprises a first H chain expression cassette, and one of the first expression vector and the second expression vector comprises a second H chain expression cassette.

[0375] As a preferred embodiment of the vector set involving a bispecific antibody composed of a first H chain, a second H chain, and an L chain common to the first and second H chains, there is an embodiment in which the first expression vector comprises an expression cassette for the L chain, one expression cassette for the first H chain, and one expression cassette for the second H chain, and the second expression vector comprises one expression cassette for the L chain.

[0376] An example of a bispecific antibody composed of a first H chain, a second H chain, and an L chain common to the first and second H chains is a tetramer in which one first H chain, one second H chain, and two L chains are aggregated.

[0377] As a further example of a scheme utilizing a vector group, a scheme in which a heteromultimeric protein is a bispecific antibody consisting of an H chain, an L chain and scFv-Fc can be cited. In this scheme, the expression amount of scFv-Fc is preferably 0.3 times or more relative to the expression amount of the H chain, and more preferably 0.5 times or more. In addition, in this scheme, the mRNA amount of scFv-Fc is preferably 0.3 times or more of the mRNA amount of the H chain, and more preferably 0.5 times or more. The mRNA amount is obtained by quantitative PCR as described below. As an example of an embodiment of the vector group involved in the bispecific antibody, the following vector groups A and B can be cited.

[0378] Vector set A: a vector set in which both the first expression vector and the second expression vector comprise an expression cassette for the L chain and an expression cassette for scFv-Fc, and one of the first expression vector and the second expression vector comprises an expression cassette for the H chain.

[0379] Vector group B: a vector group in which both the first expression vector and the second expression vector contain an expression cassette for scFv-Fc, one of the first expression vector and the second expression vector contains an expression cassette for the H chain, and one of the first expression vector and the second expression vector contains an expression cassette for the L chain.

[0380] An example of the vector set B is that one of the first expression vector and the second expression vector contains an expression cassette for the H chain and an expression cassette for the L chain.

[0381] Another example of the above-mentioned vector set B is that one of the first expression vector and the second expression vector contains an expression cassette for the H chain, and the other contains an expression cassette for the L chain.

[0382] As a preferred embodiment of the vector set involving the bispecific antibody composed of the H chain, the L chain and the scFv-Fc, there is an embodiment in which the first expression vector contains one expression cassette for the H chain, one expression cassette for the L chain and one expression cassette for the scFv-Fc, and the second expression vector contains one expression cassette for the L chain and one expression cassette for the scFv-Fc.

[0383] As another preferred embodiment of the vector set involving the bispecific antibody composed of the H chain, the L chain and the scFv-Fc, there is an embodiment in which the first expression vector contains one expression cassette for the H chain, one expression cassette for the L chain and one expression cassette for the scFv-Fc, and the second expression vector contains one expression cassette for the scFv-Fc.

[0384] One example of a bispecific antibody composed of an H chain, an L chain, and scFv-Fc is a trimer in which one H chain, one L chain, and one scFv-Fc are aggregated.

[0385] There is no limitation on the basic nucleic acid and base sequence for constructing the expression vector. As the basic nucleic acid for constructing the expression vector, for example, nucleic acid derived from a viral vector, nucleic acid derived from a non-viral vector, and artificial nucleic acid can be listed. The basic nucleic acid can be a circular nucleic acid or a linear nucleic acid.

[0386] Examples of viral vector-derived nucleic acids include nucleic acids derived from adenovirus, adeno-associated virus, retrovirus, vaccinia virus, poxvirus, lentivirus, herpes virus, baculovirus, or bacteriophage.

[0387] Examples of nucleic acids not derived from viral vectors include plasmids.

[0388] Expression vectors and expression cassettes contain the elements necessary for polypeptide expression depending on the type of host cell.

[0389] When the host cell is a prokaryotic cell, the expression vector may contain, for example, a replication origin, a restriction enzyme site, a transcription terminator, and a plasmid stability locus such as a cer stability sequence.

[0390] When the host cell is yeast, the expression vector may contain, for example, a promoter, a transcription terminator, a selectable marker and an origin of replication.

[0391] When the host cell is an insect cell, the expression vector may contain, for example, a promoter, a transcription terminator and a selectable marker.

[0392] When the host cell is a mammalian cell, the expression vector may, for example, contain a promoter, a polyadenylation sequence (e.g., human β-globin poly A sequence, bovine growth hormone poly A sequence, SV40 early poly A sequence (SV40early polyA), SV40 late poly A sequence (SV40late polyA)) and a selection marker.

[0393] Among the promoters that can be used for prokaryotes are those disclosed in J. Mol. Biol. 1986; 189(1): 113-30, bacteriophage polymerase promoters, and E. coli polymerase promoters. Specific examples include T7A1, T7A2, T7A3, λpL, λpR, lac, lacUV5, trp, tac, trc, phoA, and rrnB.

[0394] As examples of promoters that can be used in yeast cells, gal promoter, AOX1 promoter, AOX2 promoter, GAP promoter, GAL1 promoter, and GAL10 promoter can be cited.

[0395] Examples of promoters that can be used in insect cells include polyhedrin promoter, P10 promoter, virus infection early expressed protein (IE-1) promoter, MT promoter, COPIA promoter, CMV promoter, RSV promoter, SV40 promoter, heat shock protein promoter, OPIE2 promoter and actin 5C promoter.

[0396] As examples of promoters that can be used in mammalian cells, promoters derived from viruses and promoters derived from housekeeping genes can be cited. As examples of promoters derived from viruses, human CMV promoter, rat CMV promoter, SV40 promoter, RSR-LTR promoter and HSK-TK promoter can be cited. As examples of promoters derived from housekeeping genes, hEF-1α promoter, Chinese hamster EF-1α promoter, β-actin promoter and mouse phosphoglycerate kinase (mPGK) promoter can be cited. A preferred example of a promoter that can be used in mammalian cells is EF-1α promoter, more preferably hEF-1α promoter.

[0397] The promoters contained in the expression cassettes of the subunits may be the same or different in their kind. One example of an embodiment is that the expression cassettes of the subunits constituting the heteromultimeric protein all contain promoters of the same kind. A preferred example of an embodiment is that the expression cassettes of the subunits constituting the heteromultimeric protein all contain the hEF-1α promoter.

[0398] In order to promote the transport or secretion of the expressed polypeptide to the extracellular space, the expression cassette of the subunit preferably contains a coding sequence for a secretion leader. A secretion leader is a type of signal peptide that induces the transport or secretion of a polypeptide to the extracellular space.

[0399] In the case where the expression cassette of the subunit comprises a coding sequence for a secretion leader, the coding sequence for the secretion leader and the coding sequence for the subunit are arranged in the same reading frame. Here, "arranged in the same reading frame" means that the two coding sequences are arranged so that the secretion leader and the subunit can be expressed as one polypeptide. In the expression cassette of the subunit, there may or may not be a coding sequence for a linker or a spacer between the coding sequence for the secretion leader and the coding sequence for the subunit.

[0400] A preferred embodiment is a embodiment in which the coding sequence of the subunit is arranged downstream of the coding sequence of the secretion leader in the same reading frame. The recombinant polypeptide of the secretion leader arranged on the N-terminal side of the subunit is expressed from the expression cassette of this embodiment. A more preferred embodiment is a embodiment in which the coding sequence of the subunit is continuously arranged downstream of the coding sequence of the secretion leader in the same reading frame. The recombinant polypeptide of the secretion leader bound to the N-terminus of the subunit is expressed from the expression cassette of this embodiment. Here, "downstream" means the arrangement order of two coding sequences. When the two coding sequences are arranged so that the coding sequence B is transcribed after the coding sequence A is transcribed, it is said that the coding sequence B is arranged downstream of the coding sequence A.

[0401] The secretory leader of a recombinant polypeptide is generally cleaved from the recombinant polypeptide during the trafficking or secretion process of the recombinant polypeptide.

[0402] Examples of secretion leaders include fibronectin secretion leaders, collagen secretion leaders, and albumin secretion leaders. From the viewpoint of high secretion rate of the recombinant polypeptide to the outside of cells, fibronectin secretion leaders are preferred.

[0403] As examples of fibronectin secretion leaders, fibronectin secretion leaders of amphibians and fibronectin secretion leaders of mammals can be cited. As examples of fibronectin secretion leaders of amphibians, fibronectin secretion leaders of African clawed frogs can be cited. As examples of fibronectin secretion leaders of mammals, fibronectin secretion leaders of humans, rats, mice, cattle, pigs, dogs, cats and Chinese hamsters and their functional equivalents can be cited. Functional equivalents of fibronectin secretion leaders have an identity of more than 70% in the amino acid sequence, preferably an identity of more than 75%, more preferably an identity of more than 80%, further preferably an identity of more than 90%, and most preferably an identity of more than 95%, and have the function of secreting the recombinant polypeptide outside the cell. The sequence identity of the amino acid sequence is calculated, for example, using BLAST (Basic Local Alignment Search Tool) (https: / / blast.ncbi.nlm.nih.gov / Blast.cgi).

[0404] It is preferred to select the source organism of the fibronectin secretion leader according to the type of host cell. When the host cell is a human cell, it is preferred to use a human fibronectin secretion leader for the expression cassette. When the host cell is a rat cell, it is preferred to use a rat fibronectin secretion leader for the expression cassette. When the host cell is a CHO cell, it is preferred to use a Chinese hamster fibronectin secretion leader for the expression cassette.

[0405] As examples of embodiments of the fibronectin secretion leader, there can be cited a human fibronectin secretion leader having an amino acid sequence of SEQ ID NO. 1 and a Chinese hamster fibronectin secretion leader having an amino acid sequence of SEQ ID NO. 2. An example of the coding sequence of SEQ ID NO. 1 is SEQ ID NO. 3. An example of the coding sequence of SEQ ID NO. 2 is SEQ ID NO. 4.

[0406] SEQ ID NO.1:MLRGPGPGLLLLAVQCLGTAVPSTGA

[0407] SEQ ID NO.2:MLRGPGPGLLLLAVLCLGTAVRCTEA

[0408] SEQ ID NO.3:ATGCTGAGAGGCCCTGGACCTGGACTGCTGCTGCTGGCTGTGCAGTGTCTGGGAACCGCCGTGCCTTCTACCGGCGCC

[0409] SEQ ID NO.4:ATGCTCAGGGGTCCGGGACCCGGGCTGCTGCTGGCCGTCCTGTGCCTGGGGACAGCGGTGCGCTGTACCGAAGCC

[0410] As an example of an embodiment, at least one of the expression cassettes constituting the subunits of the heteromultimeric protein contains a coding sequence for a fibronectin secretion leader.

[0411] When the host cell is a human cell, it is preferred that at least one of the expression cassettes constituting the subunits of the heteromultimeric protein contains a coding sequence for a human fibronectin secretion leader.

[0412] When the host cell is a CHO cell, it is preferred that at least one of the expression cassettes constituting the subunits of the heteromultimeric protein contains a coding sequence for a Chinese hamster fibronectin secretion leader.

[0413] As an example of an embodiment, there can be cited an embodiment in which all expression cassettes of subunits constituting a heteromultimeric protein contain a coding sequence for a fibronectin secretion leader.

[0414] When the host cell is a human cell, it is preferred that all expression cassettes of the subunits constituting the heteromultimeric protein contain the coding sequence of the human fibronectin secretion leader.

[0415] When the host cell is a CHO cell, it is preferred that all expression cassettes of the subunits constituting the heteromultimeric protein contain the coding sequence of the Chinese hamster fibronectin secretion leader.

[0416] In a preferred example of the embodiment, the expression cassette of the subunit of the heteromultimeric protein comprises an hEF-1α promoter, a coding sequence of a fibronectin secretion leader, a coding sequence of the subunit and a poly A sequence operably linked to each other.

[0417] For the purpose of confirming the introduction of the expression vector into host cells or preparing stable expressing cells, the expression vector preferably contains an expression cassette for a selectable marker.

[0418] In the present disclosure, the selectable marker is a marker that functions to select cells into which an expression vector has been introduced, and means a gene incorporated into the expression vector and a protein encoded by the gene.

[0419] The expression cassette of the selection marker contains all nucleic acids required for the expression of the selection marker. The size and base sequence of the expression cassette of the selection marker are not limited.

[0420] Examples of selection markers include proteins and genes thereof that show resistance to selection agents. Examples of selection agents include enzyme inhibitors and antibiotics.

[0421] As an example of an enzyme inhibitor, there is a DHFR-MTX system. The selection agent of the DHFR-MTX system is methotrexate (MTX), and the selection marker is dihydrofolate reductase (DHFR) and its gene. The DHFR-MTX system is an effective system in a host cell (e.g., CHO-DG44 cell) lacking a DHFR gene.

[0422] As an example of an enzyme inhibitor as a selection agent, there is a GS-MSX system. The selection agent of the GS-MSX system is methionine sulfoximine (MSX), and the selection marker is glutamine synthetase (GS) and its gene. The GS-MSX system is an effective system in host cells lacking the GS gene (e.g., GS knockout CHO cells).

[0423] When the selection agent is an antibiotic, the antibiotic degrading enzyme and the antibiotic resistance gene as its gene are selected markers. For example, hygromycin resistance gene, neomycin resistance gene, puromycin resistance gene, chloramphenicol resistance gene, tetracycline resistance gene, erythromycin resistance gene, spectinomycin resistance gene, kanamycin resistance gene, G418 resistance gene, blasticidin resistance gene, zeocin resistance gene, phleomycin resistance gene and ampicillin resistance gene can be mentioned.

[0424] An example of an embodiment of a vector set is: the first expression vector comprises an expression cassette of a first selection marker, the second expression vector comprises an expression cassette of a second selection marker, and the first selection marker and the second selection marker are selection markers of different types from each other. The first selection marker is, for example, at least one selected from the group consisting of a dihydrofolate reductase gene, a glutamine synthetase gene, and an antibiotic resistance gene. The second selection marker is, for example, at least one selected from the group consisting of a dihydrofolate reductase gene, a glutamine synthetase gene, and an antibiotic resistance gene.

[0425] An example of an embodiment of a vector set is: one of the first expression vector and the second expression vector comprises an expression cassette of a dihydrofolate reductase gene or a glutamine synthetase gene, and the other comprises an expression cassette of an antibiotic resistance gene. A preferred example of the expression cassette of the dihydrofolate reductase gene comprises an mPGK promoter. A preferred example of the expression cassette of the glutamine synthetase gene comprises an mPGK promoter. A preferred example of the expression cassette of the antibiotic resistance gene comprises a promoter derived from a virus.

[0426] As an example of an embodiment of a vector set for a bispecific antibody composed of a first H chain, a second H chain, and an L chain common to the first and second H chains, the following vector sets can be mentioned.

[0427] A vector set, wherein the first expression vector comprises an expression cassette for the L chain, an expression cassette for the first H chain, an expression cassette for the second H chain, and an expression cassette for the first selection marker, and the second expression vector comprises an expression cassette for the L chain and an expression cassette for the second selection marker.

[0428] From the viewpoint of making the amount of subunits expressed from the first expression vector greater than the amount of subunits expressed from the second expression vector, it is preferred that the first selection marker and the second selection marker of the vector set of the above embodiment are selection markers of different types, and the first selection marker is a dihydrofolate reductase gene or a glutamine synthetase gene. A more preferred embodiment is that the first selection marker is a dihydrofolate reductase gene or a glutamine synthetase gene, and the second selection marker is an antibiotic resistance gene. An expression vector containing a dihydrofolate reductase gene or a glutamine synthetase gene tends to have an increased copy number in a host cell compared to an expression vector containing an antibiotic resistance gene.

[0429] As an example of an embodiment of a vector set related to a bispecific antibody composed of an H chain, an L chain, and scFv-Fc, the following vector sets can be mentioned.

[0430] A vector set, wherein the first expression vector comprises an expression cassette for the H chain, an expression cassette for the L chain, an expression cassette for the scFv-Fc, and an expression cassette for the first selection marker, and the second expression vector comprises an expression cassette for the L chain, an expression cassette for the scFv-Fc, and an expression cassette for the second selection marker.

[0431] A vector set, wherein the first expression vector comprises an expression cassette for the H chain, an expression cassette for the L chain, an expression cassette for scFv-Fc and an expression cassette for a first selection marker, and the second expression vector comprises an expression cassette for scFv-Fc and an expression cassette for a second selection marker.

[0432] A vector set, wherein the first expression vector comprises an expression cassette for the H chain, an expression cassette for scFv-Fc and an expression cassette for a first expression marker, and the second expression vector comprises an expression cassette for the L chain, an expression cassette for scFv-Fc and an expression cassette for a second selection marker.

[0433] Preferred embodiments of the first and second selection markers in the vector set of the above embodiment are the same as those of the vector set for the bispecific antibody composed of the first H chain, the second H chain, and the L chain common to the first and second H chains.

[0434] The embodiments of the present disclosure do not exclude the use of a third expression vector other than the vector set (i.e., the first expression vector and the second expression vector). The third expression vector can be used, for example, to express a polypeptide required for the growth, development or metabolism of the host cell.

[0435] One embodiment of the present disclosure is a mammalian cell transfected with a vector set. The mammalian cell transfected with a vector set can be a transient expression cell or a stable expression cell of a heteromultimeric protein, preferably a stable expression cell.

[0436] One embodiment of the present disclosure is a CHO cell transfected with a vector set. As specific examples, CHO-DG44 cells, CHO-K1 cells, CHO-DXB11 cells, CHOpro3 - Cells and cell lines derived from these cells. The CHO cells transfected with the vector set may be transiently expressing cells or stably expressing cells of the heteromultimeric protein, preferably stably expressing cells.

[0437] When the heteromultimeric protein is a bispecific antibody composed of a first H chain, a second H chain, and an L chain common to the first and second H chains, the mammalian cells and CHO cells transfected with the vector set are preferably cells in which the number of copies of the L chain expression cassette is greater than the total number of copies of the first H chain expression cassette and the second H chain expression cassette. Thereby, the expression amount and / or purity of the bispecific antibody is improved.

[0438] The amount of mRNA measured by quantitative PCR (quantitative polymerase chain reaction) helps predict the number of copies of the expression cassette present in the cell. In mammalian cells and CHO cells transfected with the vector set involved in the above-mentioned bispecific antibody, the amount of mRNA measured by quantitative PCR is preferably 0.5 to 2 for the mRNA amount of the second H chain, and 2 to 10 for the mRNA amount of the L chain when the mRNA amount of the first H chain is set to 1. In mammalian cells and CHO cells transfected with the vector set involved in the above-mentioned bispecific antibody, the amount of mRNA measured by quantitative PCR is more preferably 0.625 to 1.6 for the mRNA amount of the second H chain, and 3 to 8 for the mRNA amount of the L chain when the mRNA amount of the first H chain is set to 1.

[0439] Mammalian cells and CHO cells transfected with the vector set are cells expressing heteromultimeric proteins and can be used to produce heteromultimeric proteins. Mammalian cells and CHO cells transfected with the vector set can also be used by administration, infusion or transplantation into mammals.

[0440] One embodiment of the present disclosure is a method for producing a heteromultimeric protein. The method for producing a heteromultimeric protein comprises culturing cells that produce the heteromultimeric protein. The heteromultimeric protein is produced in the cells by culturing the cells, and the heteromultimeric protein is accumulated in the culture medium and / or the cells.

[0441] The cells used in the method for producing a heteromultimeric protein are cells prepared by the method for preparing a cell as one embodiment of the present disclosure. The cells are selected according to the evaluation criteria and / or relative production performance related to the heteromultimeric protein, and therefore have excellent productivity of the heteromultimeric protein.

[0442] The culture method and medium composition of cells used to produce heteromultimeric proteins can be selected according to the type of host cells. The culture conditions (such as culture scale, cell density, temperature and CO2 concentration) can also be selected according to the type of host cells.

[0443] One example of an embodiment of a method for producing a heteromultimeric protein includes recovering the heteromultimeric protein from a culture medium. Examples of methods for recovering the heteromultimeric protein from a culture medium include centrifugation, filtration, diafiltration, ion exchange chromatography, affinity chromatography, hydrophobic interaction chromatography, gel filtration chromatography, and high-performance liquid chromatography (HPLC). The recovered heteromultimeric protein is used, for example, in the production of a pharmaceutical composition.

[0444] One example of an embodiment of a method for producing a heteromultimeric protein includes recovering cells that have accumulated the heteromultimeric protein from a culture medium. Examples of methods for recovering cells from a culture medium include centrifugation and filtration. The heteromultimeric protein accumulates inside or on the surface of cells depending on its properties. The recovered cells are, for example, administered, infused, or transplanted into a mammal.

[0445] One embodiment of the present disclosure is a method for preparing a cell pool. The method for preparing a cell pool comprises introducing a vector set into a host cell. The prepared cell pool is provided for screening cells that produce heteromultimeric proteins. In the present disclosure, a cell pool refers to a cell population with diversity in the copy number of the expression cassette of each subunit.

[0446] The scale of the cell pool is not limited, but may include, for example, 10 to 10,000 clones.

[0447] As the host cell used in the method for preparing the cell pool, eukaryotic cells are preferred, mammalian cells are more preferred, and CHO cells are further preferred. Examples of CHO cells include CHO-DG44 cells, CHO-K1 cells, CHO-DXB11 cells, CHOpro3 - Cells and cell lines derived from these cells.

[0448] The cells contained in the cell pool may be transiently expressing cells or stably expressing cells of the heteromultimeric protein, preferably stably expressing cells.

[0449] Cell pools can be maintained by culturing cells or frozen for preservation.

[0450] Example

[0451] The following specific examples are given to more specifically illustrate the preparation method of cells producing heteromultimeric proteins and the vector set. The materials, processing sequence, etc. shown in the following specific examples can be appropriately changed as long as they do not deviate from the main purpose of the present disclosure. The scope of the vector set, etc. disclosed in the present disclosure should not be interpreted as being limited by the specific examples shown below.

[0452] It should be noted that the compositions of the bispecific antibodies (BiAb1 and BiAb2) prepared in Examples 1 and 2 are shown in Figure 5 .

[0453] 《Example 1》

[0454] <Construction of expression vector>

[0455] Expression vector 1 and expression vector 2 were constructed to express a tetrameric bispecific antibody composed of two types of H chains having amino acid sequences different from each other and one type of L chain common to the two types of H chains.

[0456] Hereinafter, the above bispecific antibody is referred to as "BiAb1", the two H chains are respectively referred to as "HC1" and "HC2", and one L chain is referred to as "common LC". HC1, HC2 and common LC are collectively referred to as "antibody subunits".

[0457] Figure 1 It is the vector map of expression vector 1. Expression vector 1 is a vector containing an expression cassette for 1 HC1, an expression cassette for 1 HC2, an expression cassette for 1 common LC, and an expression cassette for 1 DHFR gene. The expression cassettes of the antibody subunits each contain an hEF-1α promoter, a coding sequence of a fibronectin secretion leader, a coding sequence of the antibody subunit, and a polyA sequence, and the coding sequences of the antibody subunits are continuously arranged downstream of the coding sequence of the fibronectin secretion leader in the same reading frame.

[0458] Figure 2 It is the vector map of expression vector 2. Expression vector 2 is a vector containing an expression cassette for 1 common LC and an expression cassette for a hygromycin resistance gene. The expression cassette of common LC contains an hEF-1α promoter, a coding sequence of a fibronectin secretion leader, a common LC coding sequence, and a polyA sequence, and the common LC coding sequence is continuously arranged downstream of the coding sequence of the fibronectin secretion leader in the same reading frame.

[0459] <Introduction of expression vector into CHO cells>

[0460] Expression vector 1 alone, or expression vectors 1 and 2 are introduced into CHO-DG44 cells by electroporation.

[0461] The CHO-DG44 cells into which the expression vector has been introduced are inoculated into 10 mL of OptiCHO medium (Lifetechnologies, 12681011) and statically cultured in an atmosphere at a temperature of 37°C and CO2 of 5% (v / v).

[0462] One day after introducing the expression vector, methotrexate is added as a selection agent to the CHO-DG44 cells into which only expression vector 1 has been introduced, and methotrexate and hygromycin B are simultaneously added as selection agents to the CHO-DG44 cells into which expression vectors 1 and 2 have been introduced.

[0463] Fourteen days after introducing the expression vector, the culture volume is expanded to 20 mL, transferred to a 125 mL flask for shaking culture, and shaking culture is carried out.

[0464] <Selection of BiAb1-producing cells>

[0465] The cells cultured with shaking were dispensed into each well of a 96-well plate at a rate of one cell per well using a droplet cell sorter, and statically cultured in an atmosphere at 37 °C and 10% (v / v) CO₂. After 14 days of culture, the culture supernatant was recovered, and the antibody concentration was measured using an intermolecular interaction analysis device, Octet Qke (Sartorius). Clones with high antibody concentrations were selected, cultured in 24-well plates, and then cultured in bioreactor tubes for scale-up. In this way, cells producing BiAb1 were prepared.

[0466] The BiAb1-producing cells prepared by introducing only expression vector 1 are called BiAb1-TGV cells. The BiAb1-producing cells prepared by introducing expression vector 1 and expression vector 2 are called BiAb1-TGV / SGV cells.

[0467] <Production of BiAb1>

[0468] The BiAb1-TGV cells and BiAb1-TGV / SGV cells were respectively suspended in 40 mL of basal medium, transferred to a 125 mL flask for shaking culture, and cultured with shaking and fed at a speed of 140 rpm in an atmosphere at 37 °C and 5% (v / v) CO₂. A certain amount of feeding medium was added every day from the 3rd day to the 13th day of the start of culture. Sampling was performed every 1 - 3 days to measure cell density, culture medium components, and antibody concentration. On the 14th day of the start of culture, the culture broth was recovered, and cells and cell debris were removed using a depth filter (pore size 0.22 μm) to obtain the culture supernatant.

[0469] The antibody concentration in the culture supernatant was measured by liquid chromatography using a protein A column. The antibody was purified from the culture supernatant using a protein A column, and the BiAb1 was quantified and the mismatched antibodies (antibodies with only HC1 for the heavy chain and antibodies with only HC2 for the heavy chain) were quantified using an icIEF analysis device, Maurice (Protein Simple), to obtain the purity of BiAb1. Here, the purity refers to BiAb1 / (BiAb1 + mismatched antibodies) × 100 (%). The measurement results of the clone with the highest antibody concentration are shown in Table 1.

[0470] The mRNA amounts of the antibody subunits in each clone were measured by quantitative PCR. The measurement results of the clone with the highest antibody concentration are shown in Table 2. The values shown in Table 2 are relative values with the mRNA amount of HC1 in BiAb1-TGV cells set to 1.

[0471] [Table 1]

[0472]

[0473] [Table 2]

[0474]

[0475] As shown in Table 1, the purity of BiAb1 in both cells exceeded 75% (3 / 4). Expression vector 1 contains one expression cassette for HC1 and one expression cassette for HC2, so it is believed that BiAb1-TGV cells and BiAb1-TGV / SGV cells have expression cassettes for HC1 and HC2 at a ratio of 1:1. The expression levels of HC1 and HC2 in BiAb1-TGV cells and BiAb1-TGV / SGV cells are similar, and it is speculated that mismatched antibodies are less likely to be produced.

[0476] The amount of BiAb1 in BiAb1-TGV cells was 2.6 g / L and in BiAb1-TGV / SGV cells was 4.7 g / L. The amount of BiAb1 in BiAb1-TGV / SGV cells was 1.8 times that of BiAb1-TGV cells.

[0477] As shown in Table 2, in BiAb1-TGV cells, the mRNA amount of common LC was 2.1 times that of HC1 and 2.6 times that of HC2.

[0478] Expression vector 1 contains one expression cassette for HC1, one expression cassette for HC2, and one expression cassette for common LC, so it is believed that BiAb1-TGV cells have the expression cassettes for HC1, HC2, and common LC at a ratio of 1:1:1. The difference in the amount of mRNA between the subunits is presumably due to the difference in the transcription efficiency of each expression cassette.

[0479] In BiAb1-TGV / SGV cells, the amount of common LC mRNA is 5.6 times that of HC1 and 8.9 times that of HC2. BiAb1-TGV / SGV cells are thought to have more common LC expression cassettes than HC1 and HC2 expression cassettes. This is thought to be the result of the introduction of both expression vector 1 and expression vector 2 into the host cells.

[0480] In BiAb1-TGV / SGV cells, the amount of common LC mRNA is 3.4 times the total amount of HC1 and HC2 mRNA. In simple terms, the expression of common LC is sufficient to be the total expression of HC1 and HC2, so it can be said that the expression of common LC in BiAb1-TGV / SGV cells is excessive (more than 3 times the theoretically required amount). It is speculated that the excessive expression of common LC contributes to the increase of BiAb1 in BiAb1-TGV / SGV cells (1.8 times that of BiAb1-TGV cells).

[0481] By selecting CHO cells with high expression levels and purity of BiAb1 from CHO cells transfected with the vector set of expression vector 1 and expression vector 2, CHO cells with excellent productivity of BiAb1 can be prepared.

[0482] 《Example 2》

[0483] <Construction of expression vector>

[0484] Expression vector 3 and expression vector 4 were constructed to express a trimer bispecific antibody composed of one H chain, one L chain paired with the H chain, and one single-chain antibody scFv-Fc.

[0485] Hereinafter, the bispecific antibody is referred to as "BiAb2", one H chain is referred to as "HC", one L chain is referred to as "LC", and one single-chain antibody is referred to as "scFv-Fc". HC, LC, and scFv-Fc are collectively referred to as "antibody subunit".

[0486] Figure 3 : is the vector map of expression vector 3. Expression vector 3 is a vector containing an expression cassette of 1 HC, an expression cassette of 1 LC, an expression cassette of 1 scFv-Fc and an expression cassette of 1 DHFR gene. The expression cassettes of the antibody subunits each contain the hEF-1α promoter, the coding sequence of the fibronectin secretion leader, the coding sequence of the antibody subunit and the poly A sequence, and the coding sequence of the antibody subunit is continuously arranged downstream of the coding sequence of the fibronectin secretion leader in the same reading frame.

[0487] Figure 4 : is the vector map of expression vector 4. Expression vector 4 is a vector containing an expression cassette of LC, an expression cassette of scFv-Fc and an expression cassette of hygromycin resistance gene. The expression cassette of LC contains hEF-1α promoter, the coding sequence of fibronectin secretion leader, LC coding sequence and poly A sequence, and the LC coding sequence is continuously arranged downstream of the coding sequence of fibronectin secretion leader in the same reading frame. The expression cassette of scFv-Fc contains hEF-1α promoter, the coding sequence of fibronectin secretion leader, scFv-Fc coding sequence and poly A sequence, and the scFv-Fc coding sequence is continuously arranged downstream of the coding sequence of fibronectin secretion leader in the same reading frame.

[0488] <Introduction of expression vector into CHO cells>

[0489] Expression vector 3 alone, or expression vector 3 and expression vector 4 were introduced into CHO-DG44 cells by electroporation.

[0490] CHO-DG44 cells transfected with the expression vector were inoculated into 10 mL of OptiCHO medium (Lifetechnologies, 12681011) and statically cultured in an atmosphere of 37 °C and 5% (v / v) CO₂.

[0491] One day after transfection with the expression vector, methotrexate and hygromycin B were simultaneously added as selection agents to the CHO-DG44 cells transfected with expression vectors 3 and 4.

[0492] Fourteen days after transfection with the expression vector, the culture volume was expanded to 20 mL, transferred to a 125 mL flask for shaking culture, and shaking culture was carried out.

[0493] The BiAb2-producing cells prepared by transfecting only with expression vector 3 were designated as BiAb2-TGV cells. The BiAb2-producing cells prepared by transfecting with expression vectors 3 and 4 were designated as BiAb2-TGV / DGV cells.

[0494] <Production of BiAb2>

[0495] BiAb2-TGV cells and BiAb2-TGV / DGV cells were respectively suspended in 40 mL of basal medium, transferred to a 125 mL flask for shaking culture, and shaking culture and feeding were carried out at a speed of 140 rpm in an atmosphere of 37 °C and 5% (v / v) CO₂. A certain amount of feeding medium was added every day from the 3rd day to the 13th day of the start of culture. Sampling was carried out every 1 - 3 days to measure cell density, culture solution components, and antibody concentration. On the 14th day of the start of culture, the culture solution was recovered, and cells and cell debris were removed using a depth filter (pore size 0.22 μm) to obtain the culture supernatant.

[0496] The antibody concentration in the culture supernatant was measured by liquid chromatography using a protein A column. The antibody was purified from the culture supernatant using a protein A column, and a capillary electrophoresis analysis device PA800plus (AB SCIEX) was used to quantify BiAb2 and the mismatched antibody (the antibody with non-paired HC and scFv-Fc), and the purity of BiAb2 was determined. Here, the purity refers to BiAb2 / (BiAb2 + mismatched antibody) × 100 (%). The productivity of each cell is shown in Table 3.

[0497] [Table 3]

[0498]

[0499] The mRNA amount of the antibody subunit in each BiAb2-producing cell was measured by quantitative PCR. The measurement results of each cell are shown in Table 4. The numerical values ​​shown in Table 4 are relative values ​​when the mRNA amount of the HC gene in the BiAb2-TGV cell is set to 1.

[0500] [Table 4]

[0501]

[0502] As shown in Table 3, the purity of BiAb2 in BiAb2-TGV cells was 51%, while in BiAb2-TGV / DGV cells, the purity was 95%, which was greatly improved. Expression vector 3 contains one expression cassette for HC and one expression cassette for scFv-Fc, so it is believed that BiAb2-TGV cells and BiAb2-TGV / DGV cells have the expression cassette for HC and the expression cassette for scFv-Fc in a 1:1 ratio. However, it is speculated that since the purity of BiAb2-TGV / DGV cells is greatly improved compared with BiAb2-TGV cells, the expression amount per copy number of HC and scFv-Fc is different, and thus the purity of BiAb2 generated in BiAb2-TGV cells is reduced.

[0503] In BiAb2-TGV cells, the concentration of the target BiAb was 1.0 g / L, whereas in BiAb2-TGV / DGV cells, the concentration of the target BiAb was 1.7 g / L.

[0504] As shown in Table 4, in BiAb2-TGV, the mRNA amount of LC was 2.1 times that of HC, and the mRNA amount of scFv-Fc was 0.2 times that of HC.

[0505] Expression vector 1 contains one expression cassette for HC, one expression cassette for LC, and one expression cassette for scFv-Fc, so it is believed that BiAb2-TGV cells have the expression cassettes for HC, LC, and scFv-Fc at a ratio of 1:1:1. The difference in mRNA amounts between subunits is presumed to be due to differences in the transcription efficiency of each expression cassette, and in particular, it was found that the transcription efficiency of scFv-Fc was significantly lower than that of HC or LC.

[0506] In BiAb2-TGV / DGV cells, the amount of LC mRNA is 4 times that of HC mRNA, and the amount of scFv-Fc mRNA is about 0.5 times that of HC mRNA. BiAb2-TGV / DGV cells are thought to have more LC and scFv-Fc expression cassettes than HC expression cassettes. This is thought to be the result of the introduction of both expression vector 3 and expression vector 4 into the host cells.

[0507] In BiAb2-TGV / DGV cells, the production of the target BiAb2 increased, although the expression level of HC was 0.7 times that of BiAb2-TGV cells. This is believed to be because the expression level of scFv-Fc was improved, which reduced the amount of HC-LC homodimers and formed correctly paired BiAb2.

[0508] Based on these results, by additionally introducing a vector containing a gene with relatively low transcription efficiency and insufficient expression level, the expression balance can be improved and the productivity and purity of BiAb can be increased.

[0509] By selecting CHO cells with high BiAb2 expression levels and purity from CHO cells transfected with the vector set of expression vector 3 and expression vector 4, CHO cells with excellent BiAb2 productivity can be prepared.

[0510] The disclosure of Japanese Patent Application No. 2022-094577 filed on June 10, 2022 is incorporated herein by reference in its entirety. All documents, patent applications, and technical specifications described in this specification are incorporated herein by reference to the same extent as if each individual document, patent application, and technical specification was specifically and individually described as being incorporated by reference.

Claims

1. A method for preparing a cell, which is a method for preparing a cell that produces a heteromultimeric protein composed of n subunits (n is an integer greater than or equal to 2), the method comprising: The following vector groups are introduced into host cells, and selecting cells producing heteromultimeric proteins from host cells into which the above-mentioned vector group has been introduced; Vector set: a vector set consisting of a first expression vector and a second expression vector, An expression cassette for at least one subunit X that is a part of the n subunits is contained in both the first expression vector and the second expression vector, The expression cassette for the subunit Y remaining after removing the subunit X from the n types of subunits is contained in one of the first expression vector and the second expression vector according to the type.

2. The method for preparing cells according to claim 1, wherein The above-mentioned vector group is the following vector group; Vector set: a vector set consisting of a first expression vector and a second expression vector, An expression cassette for at least one subunit X that is a part of the n subunits is contained in both the first expression vector and the second expression vector, All expression cassettes for subunit Y remaining after removing the subunit X from the n subunits are contained in one of the first expression vector and the second expression vector.

3. The method for preparing cells according to claim 1, wherein The heteromultimeric protein composed of n subunits is a heteromultimeric protein composed of 2 or more and 6 or less subunits. The at least one subunit X is one, two or three subunit Xs.

4. The method for preparing cells according to claim 1, wherein The above-mentioned heteromultimeric protein composed of n subunits is a heteromultimeric protein composed of 3 or 4 subunits, The at least one subunit X is one, two or three subunit Xs.

5. The method for preparing cells according to claim 1, wherein The above-mentioned heteromultimeric protein composed of n subunits is a heteromultimeric protein composed of 3 subunits, The at least one subunit X is one or two subunit Xs. The method for preparing cells according to claim 1 , wherein the heteromultimeric protein is an antibody.

7. The method for preparing cells according to claim 1, wherein the heteromultimeric protein is a bispecific antibody.

8. The method for preparing a cell according to claim 1, wherein the expression cassettes for the subunits constituting the heteromultimeric protein all contain the same type of promoter.

9. The method for preparing cells according to claim 8, wherein the promoter is hEF-1α promoter.

10. The method for preparing cells according to claim 1, wherein At least one of the expression cassettes constituting the subunits of the heteromultimeric protein comprises a coding sequence for a fibronectin secretion leader, In the expression cassette comprising the coding sequence of the fibronectin secretion leader, the coding sequences of the subunits constituting the heteromultimeric protein are arranged downstream of the coding sequence of the fibronectin secretion leader in the same reading frame.

11. The method for preparing cells according to claim 1, wherein The expression cassettes constituting the subunits of the above-mentioned heteromultimeric protein all contain the coding sequence of the fibronectin secretion leader, The coding sequences of the subunits constituting the heteromultimeric protein are arranged downstream of the coding sequence of the fibronectin secretion leader in the same reading frame.

12. The method for preparing cells according to claim 1, wherein The first expression vector further comprises an expression cassette for a first selection marker, The second expression vector further comprises an expression cassette for a second selection marker.

13. The method for preparing cells according to claim 12, wherein The first selection marker and the second selection marker are selection markers of different types from each other, The first selection marker is at least one selected from the group consisting of a dihydrofolate reductase gene, a glutamine synthetase gene, and an antibiotic resistance gene, The second selection marker is at least one selected from the group consisting of a dihydrofolate reductase gene, a glutamine synthetase gene, and an antibiotic resistance gene. The method for preparing cells according to claim 1 , wherein the host cell is a mammalian cell. The method for preparing cells according to claim 1 , wherein the host cell is a CHO cell.

16. The method for preparing cells according to claim 1, wherein the host cell is CHO-DG44 cell, CHO-K1 cell, CHO-DXB11 cell, CHOpro3 - Cells or cell lines derived from these cells.

17. A method for preparing a cell that produces a bispecific antibody composed of a first H chain, a second H chain, and an L chain common to the first H chain and the second H chain, the method comprising: The following vector groups are introduced into host cells, and Selecting cells producing bispecific antibodies from host cells into which the above-mentioned vector group has been introduced; Vector set: a vector set consisting of a first expression vector and a second expression vector, The first expression vector and the second expression vector both contain the L chain expression cassette, One of the first expression vector and the second expression vector comprises an expression cassette for the first H chain, One of the first expression vector and the second expression vector comprises an expression cassette for the second H chain.

18. The method for preparing cells according to claim 17, wherein The first expression vector and the second expression vector each contain one expression cassette for the L chain. One of the first expression vector and the second expression vector comprises one expression cassette of the first H chain, One of the first expression vector and the second expression vector comprises one expression cassette for the second H chain.

19. The method for preparing a cell according to claim 17, wherein the expression cassettes for the subunits constituting the bispecific antibody all contain the same type of promoter.

20. The method for preparing cells according to claim 19, wherein the promoter is hEF-1α promoter.

21. The method for preparing cells according to claim 17, wherein At least one of the expression cassettes constituting the subunits of the bispecific antibody comprises a coding sequence for a fibronectin secretion leader, In the expression cassette comprising the coding sequence of the fibronectin secretion leader, the coding sequences of the subunits constituting the bispecific antibody are arranged downstream of the coding sequence of the fibronectin secretion leader in the same reading frame.

22. The method for preparing cells according to claim 17, wherein The expression cassettes constituting the subunits of the above-mentioned bispecific antibody all contain the coding sequence of the fibronectin secretion leader, The coding sequences of the subunits constituting the bispecific antibody are arranged downstream of the coding sequence of the fibronectin secretion leader in the same reading frame.

23. The method for preparing cells according to claim 17, wherein The first expression vector further comprises an expression cassette for a first selection marker, The second expression vector further comprises an expression cassette for a second selection marker.

24. The method for preparing cells according to claim 23, wherein The first expression vector comprises an expression cassette for the L chain, an expression cassette for the first H chain, an expression cassette for the second H chain, and an expression cassette for the first selection marker, The second expression vector comprises the L chain expression cassette and the second selection marker expression cassette.

25. The method for preparing cells according to claim 24, wherein The first selection marker and the second selection marker are selection markers of different types from each other, The first selection marker is a dihydrofolate reductase gene or a glutamine synthetase gene.

26. The method for preparing cells according to claim 24, wherein The first selection marker is a dihydrofolate reductase gene or a glutamine synthetase gene, The second selection marker is an antibiotic resistance gene.

27. The method for preparing cells according to claim 17, wherein the host cell is a mammalian cell. The method for preparing cells according to claim 17 , wherein the host cell is a CHO cell.

29. The method for preparing cells according to claim 17, wherein the host cell is CHO-DG44 cell, CHO-K1 cell, CHO-DXB11 cell, CHOpro3 - Cells or cell lines derived from these cells.

30. A method for producing a heteromultimeric protein, comprising culturing cells produced by the method for producing cells according to any one of claims 1 to 16.

31. A method for producing a bispecific antibody, comprising culturing cells produced by the method for producing cells according to any one of claims 17 to 29.

32. A vector set for expressing a heteromultimeric protein composed of n subunits (n is an integer greater than or equal to 2), is a set of a first expression vector and a second expression vector, An expression cassette for at least one subunit X that is a part of the n subunits is contained in both the first expression vector and the second expression vector, The expression cassette for the subunit Y remaining after removing the subunit X from the n types of subunits is contained in one of the first expression vector and the second expression vector according to the type.

33. The vector set according to claim 32, which is a set of the first expression vector and the second expression vector, An expression cassette for at least one subunit X that is a part of the n subunits is contained in both the first expression vector and the second expression vector, All expression cassettes for subunit Y remaining after removing the subunit X from the n subunits are contained in one of the first expression vector and the second expression vector.

34. The vector set according to claim 32, wherein The heteromultimeric protein composed of n subunits is a heteromultimeric protein composed of 2 or more and 6 or less subunits. The at least one subunit X is one, two or three subunit Xs.

35. The vector set according to claim 32, wherein The above-mentioned heteromultimeric protein composed of n subunits is a heteromultimeric protein composed of 3 or 4 subunits, The at least one subunit X is one, two or three subunit Xs.

36. The vector set according to claim 32, wherein The above-mentioned heteromultimeric protein composed of n subunits is a heteromultimeric protein composed of 3 subunits, The at least one subunit X is one or two subunit Xs.

37. The vector set according to claim 32, wherein the heteromultimeric protein is an antibody.

38. The vector set according to claim 32, wherein the heteromultimeric protein is a bispecific antibody.

39. The vector set according to claim 32, wherein the expression cassettes of the subunits constituting the heteromultimeric protein all contain the same type of promoter.

40. The vector set according to claim 39, wherein the promoter is hEF-1α promoter.

41. The vector set according to claim 32, wherein At least one of the expression cassettes constituting the subunits of the heteromultimeric protein comprises a coding sequence for a fibronectin secretion leader, In the expression cassette comprising the coding sequence of the fibronectin secretion leader, the coding sequences of the subunits constituting the heteromultimeric protein are arranged downstream of the coding sequence of the fibronectin secretion leader in the same reading frame.

42. The vector set according to claim 32, wherein The expression cassettes constituting the subunits of the above-mentioned heteromultimeric protein all contain the coding sequence of the fibronectin secretion leader, The coding sequences of the subunits constituting the heteromultimeric protein are arranged downstream of the coding sequence of the fibronectin secretion leader in the same reading frame.

43. The vector set according to claim 32, wherein The first expression vector further comprises an expression cassette for a first selection marker, The second expression vector further comprises an expression cassette for a second selection marker.

44. The vector set according to claim 43, wherein The first selection marker and the second selection marker are selection markers of different types from each other, The first selection marker is at least one selected from the group consisting of a dihydrofolate reductase gene, a glutamine synthetase gene, and an antibiotic resistance gene, The second selection marker is at least one selected from the group consisting of a dihydrofolate reductase gene, a glutamine synthetase gene, and an antibiotic resistance gene.

45. A vector set for expressing a bispecific antibody composed of a first H chain, a second H chain, and an L chain common to the first H chain and the second H chain, is a set of a first expression vector and a second expression vector, The first expression vector and the second expression vector both contain the L chain expression cassette, One of the first expression vector and the second expression vector comprises an expression cassette for the first H chain, One of the first expression vector and the second expression vector comprises an expression cassette for the second H chain.

46. ​​The vector set according to claim 45, wherein The first expression vector and the second expression vector each contain one expression cassette for the L chain. One of the first expression vector and the second expression vector comprises one expression cassette of the first H chain, One of the first expression vector and the second expression vector comprises one expression cassette for the second H chain. The vector set according to claim 45 , wherein the expression cassettes of the subunits constituting the bispecific antibody all contain the same type of promoter. The vector set according to claim 47, wherein the promoter is the hEF-1α promoter.

49. The vector set according to claim 45, wherein At least one of the expression cassettes constituting the subunits of the bispecific antibody comprises a coding sequence for a fibronectin secretion leader, In the expression cassette comprising the coding sequence of the fibronectin secretion leader, the coding sequences of the subunits constituting the bispecific antibody are arranged downstream of the coding sequence of the fibronectin secretion leader in the same reading frame.

50. The vector set according to claim 45, wherein The expression cassettes constituting the subunits of the above-mentioned bispecific antibody all contain the coding sequence of the fibronectin secretion leader, The coding sequences of the subunits constituting the bispecific antibody are arranged downstream of the coding sequence of the fibronectin secretion leader in the same reading frame.

51. The vector set according to claim 45, wherein The first expression vector further comprises an expression cassette for a first selection marker, The second expression vector further comprises an expression cassette for a second selection marker.

52. The vector set according to claim 51, wherein The first expression vector comprises an expression cassette for the L chain, an expression cassette for the first H chain, an expression cassette for the second H chain, and an expression cassette for the first selection marker, The second expression vector comprises the L chain expression cassette and the second selection marker expression cassette.

53. The vector set according to claim 52, wherein The first selection marker and the second selection marker are selection markers of different types from each other, The first selection marker is a dihydrofolate reductase gene or a glutamine synthetase gene.

54. The vector set according to claim 52, wherein The first selection marker is a dihydrofolate reductase gene or a glutamine synthetase gene, The second selection marker is an antibiotic resistance gene.

55. A mammalian cell transfected with the vector set according to any one of claims 32 to 54.

56. A CHO cell transfected with the vector set according to any one of claims 32 to 54.

57. A mammalian cell transfected with the vector set according to any one of claims 45 to 54, When the amount of the mRNA of the first H chain is set to 1, the amount of the mRNA of the second H chain is 0.5 to 2, and the amount of the mRNA of the L chain is 2 to 10.

58. A mammalian cell transfected with the vector set according to any one of claims 45 to 54, When the amount of the mRNA of the first H chain is set to 1, the amount of the mRNA of the second H chain is 0.625 to 1.6, and the amount of the mRNA of the L chain is 3 to 8.

59. CHO cells, which are CHO cells transfected with the vector set according to any one of claims 45 to 54, When the amount of the mRNA of the first H chain is set to 1, the amount of the mRNA of the second H chain is 0.5 to 2, and the amount of the mRNA of the L chain is 2 to 10.

60. CHO cells, which are CHO cells transfected with the vector set according to any one of claims 45 to 54, When the amount of the mRNA of the first H chain is set to 1, the amount of the mRNA of the second H chain is 0.625 to 1.6, and the amount of the mRNA of the L chain is 3 to 8.

61. A method for preparing a cell pool, comprising introducing the vector set according to any one of claims 32 to 54 into a host cell.

62. The method for preparing a cell pool according to claim 61, wherein the host cells are mammalian cells.

63. The method for preparing a cell pool according to claim 61, wherein the host cell is a CHO cell.

64. The method for preparing a cell pool according to claim 61, wherein the host cell is CHO-DG44 cell, CHO-K1 cell, CHO-DXB11 cell, CHOpro3 - Cells or cell lines derived from these cells.

Images