Multi-drug-resistant salmonella virulent phage and application thereof

Abstract

The invention relates to the technical field of microorganisms, in particular to a multi-drug-resistant salmonella virulent phage and application thereof. The phage is named as vB-Sal-TmvP009 and is sent to the general microbiological center of the China Committee for Culture Collection of Microorganisms, the preservation number is CGMCC No.46177, and the preservation date is September 2, 2024. The bacteriophage provided by the invention is separated from sewage of a livestock farm, belongs to a tailed virus, and is expressed by genomics, belongs to Jerseyvirus, has no virulence gene and no drug-resistant gene, and is high in safety. The biological characteristic result of the bacteriophage shows that at least 10 salmonella serotypes can be split, the temperature (-20 DEG C to 60 DEG C) stability and the acid-base (pH = 3-12) stability of the bacteriophage are good, the average splitting quantity reaches 9.77 * 10 < 4 >, and the bacteriophage can be massively proliferated in a short time and can be used for preventing and controlling drug-resistant salmonella.

Description

Technical Field

[0001] The invention relates to the technical field of microorganisms, and in particular to a multi-drug resistant Salmonella virulent phage and application thereof. Background Art

[0002] Foodborne pathogens are important factors that endanger food safety and public health. Salmonella is one of the most common pathogens of bacterial foodborne diseases worldwide. It is mainly spread through contaminated meat, eggs, milk, fruits and vegetables, causing food poisoning in people, manifested as diarrhea, fever, vomiting and other clinical symptoms. According to statistics, more than 2,600 serotypes of Salmonella have been identified, and Salmonella Enteritidis and Salmonella Typhimurium are common serotypes. In recent years, a new dominant Salmonella serotype, Salmonella enterica serovar 4,[5],12:i:-, has become popular both at home and abroad. The main feature of this serotype that is different from Salmonella Typhimurium is that it does not express phase II flagella antigen. Currently, the detection rate of this dominant type in food and clinical cases has increased dramatically. In many areas of my country, Salmonella Typhimurium monophasic variants occupies the first place in Salmonella diarrhea cases, becoming an important threat to food safety and public health.

[0003] With the widespread use and abuse of antibiotics, multidrug resistance of Salmonella has become increasingly serious, becoming one of the major global public health issues and also posing challenges to food safety. Monophasic variants of Salmonella typhimurium from both food and clinical sources show varying degrees of drug resistance, and multidrug-resistant strains account for a high proportion. Therefore, it is urgent to find new prevention and control measures to prevent and control multidrug-resistant strains.

[0004] Bacteriophages are viruses that can infect bacteria. Compared with antibiotics, bacteriophages have the advantages of wide distribution, strong specificity, easy separation, green environmental protection and safety. Before the invention of antibiotics, bacteriophages have been used in the treatment of bacterial diseases, but with the emergence of antibiotics and the limitations of knowledge about bacteriophages, research on bacteriophages has gradually decreased. In recent years, with the emergence of drug-resistant bacteria, research on bacteriophages has been re-emphasized.

[0005] At present, there are related phage preparations invented and used in animal feed, clinical treatment and food safety prevention and control, but phages have a narrow antibacterial spectrum and lack phages for drug-resistant bacteria. Therefore, mining efficient and broad-spectrum phages for drug-resistant bacteria can provide important materials and foundations for the research and development of food safety prevention and control preparations. Summary of the invention

[0006] Based on the problems in the background art that the existing bacteriophages have a narrow antibacterial spectrum and lack bacteriophages targeting drug-resistant bacteria, the object of the present invention is to provide a multi-drug resistant Salmonella virulent bacteriophage and application thereof.

[0007] The multidrug-resistant Salmonella virulent phage is a broad-spectrum multidrug-resistant Salmonella phage vB_Sal_TmvP009 (Salmonella enterica serovar 4, [5], 12: i: -vB-Sal-TmvP009, belonging to the Jerseyvirus genus, with a deposit number of CGMCC No. 46177), which has been sent to the General Microbiology Center of the China National Microbiological Culture Collection Administration, with a deposit number of CGMCC No. 46177 and a deposit date of September 2, 2024, and can be used for the prevention and control of drug-resistant Salmonella in food, medicine, and the environment.

[0008] The purpose of the present invention can be achieved by the following technical solutions:

[0009] One of the technical solutions of the present invention provides a multi-drug resistant Salmonella virulent phage.

[0010] Furthermore, the phage is a broad-spectrum multidrug-resistant Salmonella phage vB-Sal-TmvP009, and the phage Salmonella typhimurium monophasic variant phage was deposited in the General Microbiology Center of the China Culture Collection of Microorganisms on September 2, 2024, with the deposit number CGMCC No.46177, and the deposit address is: Institute of Microbiology, Chinese Academy of Sciences, No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing, China.

[0011] Furthermore, the phage vB-Sal-TmvP009 has a hexahedral head with a diameter of 49.49 nm and a tail length of 122.67 nm, and morphologically belongs to the order Caudovirales;

[0012] Furthermore, according to genomic analysis, the phage vB-Sal-TmvP009 belongs to the Jerseyvirus genus, with a total genome length of 44,327 bp and a G+C content of 49.77%; the total number of encodable genes is 68, including lysin and putative spanin proteins with lytic function, among which the gene sequence of lysin is shown in SEQ.ID.No.1, and the gene sequence of putative spanin protein is shown in SEQ.ID.No.2. It has no tRNA, no virulence genes, no drug resistance genes, and is safe.

[0013] Furthermore, the bacteriophage vB-Sal-TmvP009 can be stored for a long time at -80°C; the bacteriophage vB-Sal-TmvP009 has a stable titer at -20°C to 60°C, a stable titer at pH=3 to 12, and good thermal stability and acid-base stability.

[0014] A second technical solution of the present invention provides a microbial preparation comprising the above-mentioned bacteriophage vB-Sal-TmvP009.

[0015] The third technical solution of the present invention provides the application of the above-mentioned microbial preparation.

[0016] Furthermore, in the application, the microbial preparation is used as an antibacterial agent, disinfectant, food additive, or feed additive; the antibacterial agent, disinfectant, food additive, or feed additive is used to inhibit Salmonella in food, medicine, or the environment.

[0017] Further, the Salmonella includes any one of the following Salmonella: Salmonella typhimurium, Salmonella Heidelberg, Salmonella Enteritidis, Salmonella Essen, Salmonella Derby, Salmonella Agona, Salmonella Indiana, Salmonella Moscow, Salmonella Manhattan or Salmonella typhimurium monophasic variant.

[0018] Further, the multiplicity of infection (MOI) of the bacteriophage vB-Sal-TmvP009 is 0.0001 to 10;

[0019] In some specific embodiments of the present invention, the optimal multiplicity of infection (MOI) of the bacteriophage vB-Sal-TmvP009 is 0.0001; the incubation period is 8 minutes, and the lysis period is 10 to 60 minutes.

[0020] Furthermore, the antibacterial agent and disinfectant need to further include pharmaceutically acceptable excipients or carriers; the form is tablet, spray, or powder;

[0021] The pharmaceutically acceptable excipients refer to ingredients used to convert active compounds / biological agents into dosage forms suitable for administration, and the pharmaceutically acceptable excipients include any one of binders, fillers, stabilizers and / or disintegrants.

[0022] Furthermore, the bacteriophage vB-Sal-TmvP009 can be added to the antibacterial agent and disinfectant at a multiplicity of infection MOI of 0.0001 to 0.01.

[0023] Furthermore, the food additives and feed additives need to further include auxiliary materials approved for food or feed; the auxiliary materials approved for food or feed are used to improve the flavor, taste, texture, appearance and nutritional value of food or feed; the auxiliary materials approved for food or feed include at least any one of starch and / or modified starch (commonly used as food thickeners), cellulose and cellulose derivatives, hydrophilic colloids, emulsifiers, anti-caking agents, sweeteners or colorants.

[0024] Furthermore, the bacteriophage vB-Sal-TmvP009 can be added to the food additive or feed additive at a multiplicity of infection (MOI) of 0.0001 to 0.01.

[0025] In some specific embodiments of the present invention, the antibacterial agent is a food antibacterial agent, and the bacteriophage in the food antibacterial agent can be used in a food matrix; the food matrix can be a liquid food matrix or a solid food matrix; the liquid food matrix is ​​any one of milk, fruit and vegetable juice, edible oil, alcoholic beverage, and honey; the solid food matrix is ​​any one of meat, eggs, or fruits and vegetables;

[0026] In some preferred embodiments of the present invention, the solid food matrix is ​​lettuce, and the liquid food matrix is ​​milk;

[0027] In some preferred embodiments of the present invention, when the food matrix is ​​lettuce, the bacteriophage can effectively control the concentration of Salmonella in the lettuce, and can reduce it by up to 3.399 log, indicating that the bacteriophage can be used to prevent and control Salmonella in solid food;

[0028] In some preferred embodiments of the present invention, when the food matrix is ​​milk, the bacteriophage can effectively control the concentration of Salmonella in the milk, which can be reduced by up to 3.719 log, indicating that the bacteriophage can be used to prevent and control Salmonella in liquid food.

[0029] The technical solution of the present invention has the following advantages / benefits:

[0030] (1) The bacteriophage vB-Sal-TmvP009 provided by the present invention has a hexahedral head with a diameter of 49.49 nm and a tail length of 122.67 nm. Morphologically, it belongs to the order Caudovirales. According to genomic analysis, the bacteriophage vB-Sal-TmvP009 belongs to the genus Jerseyvirus.

[0031] The phage vB-Sal-TmvP009 provided in the present application has a total genome length of 44327bp and a G+C content of 49.77%; the total number of codable genes is 68, including proteins with lytic function, lysin and putative spaninprotein, no tRNA, no virulence gene, no drug resistance gene, and is safe. The biological characteristics of the phage described in the present invention show that the phage has stable titer at -20℃~60℃, stable titer at pH=3~12, and good thermal stability and acid-base stability.

[0032] (2) The bacteriophage of the present invention is isolated from farm wastewater, and the separation cost is low. It has a lytic effect on 10 Salmonella serotypes (including Salmonella typhimurium, Salmonella Heidelberg, Salmonella Enteritidis, Salmonella Essen, Salmonella Derby, Salmonella Agona, Salmonella Indiana, Salmonella Moscow, Salmonella Manhattan, and Salmonella typhimurium monophasic variants), and has a broad spectrum.

[0033] (3) The present invention uses a lettuce model and a milk model to evaluate the application effect of the bacteriophage vB-Sal-TmvP009 in a food matrix. The results show that bacteriophage vB-Sal-TmvP009 can effectively reduce the number of Salmonella in food, and can be used as a potential means of food prevention and control, providing a theoretical basis for adding bacteriophages to food. BRIEF DESCRIPTION OF THE DRAWINGS

[0034] Figure 1 The plaque morphology of the purified phage vB-Sal-TmvP009 in Example 1;

[0035] Figure 2 The electron microscopic morphology of bacteriophage vB-Sal-TmvP009 in Example 3;

[0036] Figure 3 The temperature stability of bacteriophage vB-Sal-TmvP009 in Example 5;

[0037] Figure 4 The acid-base stability of the bacteriophage vB-Sal-TmvP009 in Example 6;

[0038] Figure 5 is the optimal infection multiplicity of bacteriophage vB-Sal-TmvP009 in Example 7

[0039] Figure 6 is the one-step growth curve of bacteriophage vB-Sal-TmvP009 in Example 8;

[0040] Figure 7 is the genome circle map of bacteriophage vB-Sal-TmvP009 in Example 9;

[0041] Figure 8 The inhibitory effect of bacteriophage vB-Sal-TmvP009 on the host bacteria at different MOIs in Example 10;

[0042] Fig. 9 The inhibitory effect of bacteriophage vB-Sal-TmvP009 on host bacteria on lettuce in Example 11;

[0043] Fig.10This is the inhibitory effect of bacteriophage vB-Sal-TmvP009 on host bacteria in milk in Example 12. DETAILED DESCRIPTION

[0044] In order to enable those skilled in the art to better understand the technical solution of the present invention, the present invention is described in detail below in conjunction with specific embodiments. It should be noted that the following embodiments will help those skilled in the art to further understand the present invention, but do not limit the present invention in any form. It should be noted that for those of ordinary skill in the art, several variations and improvements can also be made without departing from the concept of the present invention. These all belong to the protection scope of the present invention.

[0045] All raw materials of the present invention are not particularly limited in their sources, and can be purchased on the market or prepared according to conventional methods known to those skilled in the art. The LB medium used in the examples is prepared according to conventional methods in the art, and the ingredients include peptone (10g / L), sodium chloride (5g / L), yeast powder / paste (10g / L), and water. The LB semi-solid medium and solid medium are obtained by adding agar (0.2-0.7% and 1.5-2.0% respectively) to the LB liquid medium. All instruments used in the examples, such as culture dishes, coating rods, etc., need to be sterilized at high temperature and high pressure before use.

[0046] Example 1: Amplification, separation and purification of bacteriophage vB-Sal-TmvP009

[0047] (1) Treatment of water samples (farm wastewater samples used to isolate bacteriophages):

[0048] The wastewater from the farm was collected and centrifuged (5000×g, 5 min), and the water sample was obtained by filtering through a 0.22 μm filter membrane.

[0049] (2) Phage amplification culture:

[0050] The host bacteria used to isolate the phage is the multidrug-resistant Salmonella typhimurium monophasic variant MRL040009 preserved in the strain library (MRL040009 is the laboratory collection number, please refer to the published paper https: / / doi.org / 10.1016 / j.lwt.2023.115036).

[0051] A single colony of Salmonella typhimurium monophasic variant MRL040009 was selected and inoculated into 5 mL of sterile LB liquid medium, and cultured overnight at 37°C and 180 r / min. 100 μL of the overnight cultured bacterial solution was added to 5 mL of 0.5% LB semi-solid medium, mixed evenly, and poured into LB solid medium. After solidification, 10 μL of the sewage sample treated in step (1) was added dropwise, and cultured at 37°C for 6 h to observe whether transparent spots were formed.

[0052] (3) Purification of phage:

[0053] Select a large and transparent single spot on the plate, pick it up with an inoculation loop and add it to 1mL PBS buffer solution for 10-fold dilution, and take 100μL of phage solution at different dilution gradients and 100μL of bacterial solution and culture for 6h using the double-layer plate method (i.e., the lower layer of the plate culture medium is: LB solid culture medium; the upper layer is 0.5% LB semi-solid culture medium.). Select a large and transparent single spot for picking again, repeat the above steps for a total of 5 times until transparent spots of uniform size appear, and obtain the purified phage vB-Sal-TmvP009, which has been sent to the General Microbiology Center of the China Microbiological Culture Collection Administration, with a preservation number of CGMCC No.46177 and a preservation date of September 2, 2024. The phage vB-Sal-TmvP009 can be stored in a 4°C refrigerator in the laboratory.

[0054] Results: See Figure 1 A multidrug-resistant Salmonella typhimurium monophasic variant phage was isolated and named vB-Sal-TmvP009, which can form clear plaques on double-layer agar plates.

[0055] Example 2: Enrichment and storage of bacteriophage vB-Sal-TmvP009

[0056] (1) Enrichment of phages:

[0057] Take 100 μL of purified phage solution (phage vB-Sal-TmvP009) and 100 μL of overnight cultured host bacterial solution (Salmonella typhimurium monophasic variant MRL040009) and add them to 5 mL of 0.5% LB semi-solid medium, pour them on LB solid medium, wait for them to solidify, invert and culture them in a 37°C incubator for 6 hours until a transparent empty plate appears. Add 5 mL of PBS buffer to the transparent empty plate, place it in a 4°C refrigerator overnight, collect it, centrifuge the obtained phage solution (5000xg, 4min), and pass it through a 0.22 μm filter membrane to obtain a phage enrichment solution.

[0058] (2) Preservation of bacteriophages:

[0059] Add 600 μL of phage enrichment solution to the cryovial, add 600 μL of 50% glycerol, and store in a -80°C refrigerator.

[0060] Results: The titer of the isolated Salmonella phage was 2.6×10 9The calculation formula of phage titer is: N=Y·X·10, (N: titer value, Y: average number of plaques / dish, X: dilution degree). The titer calculation method in the following examples shall refer to this example unless otherwise specified.

[0061] Example 3: Electron microscopic morphology of bacteriophage vB-Sal-TmvP009

[0062] (1) Phage proliferation:

[0063] In order to facilitate the electron microscopic observation of bacteriophages, it is necessary to proliferate the bacteriophages and improve the titer of the bacteriophages. The bacteriophage enriched solution obtained in Example 2 (1) was diluted 10 times (here, the 10-fold dilution ratio is calculated by C1V1=C2V2, C1: titer before dilution, V1: volume before dilution, C2: titer after dilution, V2: volume after dilution, this experiment uses 20μL bacteriophage enriched solution + 180μL PBS buffer for 10-fold dilution), poured into a double-layer plate, select a plate with a little bacterial moss, add 5mL PBS buffer to the plate, place it at 4°C overnight, collect the bacteriophage solution and filter it through a 0.22μm filter membrane, use the double-layer plate method to measure the titer, and repeat 1-2 times.

[0064] (2) Electron microscopic observation of bacteriophages: Take the bacteriophage proliferation fluid and observe it under an electron microscope.

[0065] Results: See Figure 2 The electron microscopic morphology of the bacteriophage vB-Sal-TmvP009 showed that the head was hexahedral with a diameter of 49.49 nm and a tail length of 122.67 nm, and morphologically belonged to the order Caudovirales.

[0066] Example 4: Lysis spectrum of bacteriophage vB-Sal-TmvP009

[0067] (1) 28 strains of Salmonella were selected for activation. The activation operation is the process of restoring the Salmonella from a preserved state to a physiologically active state, which is a routine operation in the art.

[0068] (2) Take 100 μL of the activated Salmonella solution prepared in (1) and add it to 0.5% LB semi-solid medium, mix well, pour it onto LB solid medium, add phage sample solution after solidification, and culture in a 37°C incubator for 6 h to observe whether transparent spots appear.

[0069] Results: As shown in Table 1, among the 28 strains of Salmonella selected in the experiment, the bacteriophage vB-Sal-TmvP009 can lyse 20 strains of Salmonella (including 10 different serotypes), and the lysis rate of the tested strains is 71.43% (i.e. 20 strains / 28 strains), which has good broad-spectrum properties and is a broad-spectrum phage.

[0070] Table 1 Lysis effect of bacteriophage vB-Sal-TmvP009 on 28 strains of Salmonella preserved in the laboratory

[0071]

[0072]

[0073]

[0074]

[0075] In the table, the meanings of the cleavage effects + and - are: + means there is a cleavage effect, and - means there is no cleavage effect.

[0076] Example 5: Temperature stability of bacteriophage vB-Sal-TmvP009

[0077] Take 100 μL of phage liquid and add it to 900 μL PBS buffer, incubate it at different temperatures (-20℃, 4℃, 25℃, 37℃, 50℃, 60℃, 70℃, 80℃) for 1 h, perform 10-fold dilution, take 100 μL of phage liquid samples at different dilution gradients, mix them with 100 μL of host bacteria, add them to 5 mL 0.5% LB semi-solid culture medium, and measure the titer by the double-layer plate method, repeat 3 times.

[0078] Results: See Figure 3 The bacteriophage vB-Sal-TmvP009 provided in the present application has good temperature stability and can maintain activity at -20°C to 60°C.

[0079] Example 6: pH stability of bacteriophage vB-Sal-TmvP009

[0080] HCl and NaOH were added to the PBS buffer to adjust the pH to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, and 12, respectively. 900 μL of each aliquot was added with 100 μL of phage solution, and the mixture was incubated at 37°C for 1 h. A 10-fold gradient dilution was performed, and 100 μL of samples under different dilution gradients and 100 μL of host bacteria were added to 5 mL of 0.5% LB semi-solid culture medium and the titer was determined by the double-layer plate method. This was repeated 3 times.

[0081] Results: See Figure 4 The bacteriophage vB-Sal-TmvP009 provided in the present application has good pH stability and can maintain activity at pH=3-12.

[0082] Example 7: Optimal multiplicity of infection (MOI) of bacteriophage vB-Sal-TmvP009

[0083] (1) Adjust the host bacteria concentration to 1×10 7 CFU / mL.

[0084] (2) The phage solution was diluted and added in equal amounts according to the infection multiplicity with the host bacteria (phage titer: target bacteria concentration): 0.0001, 0.001, 0.01, 0.1, 1, 10, and added to 10 mL of LB liquid culture medium. The culture was incubated in a shaker at 37°C for 5 h. The sample was centrifuged (4000 r, 5 min) and filtered through a 0.22 μm filter to obtain pure phage solution.

[0085] (3) The obtained phage solution was diluted in a gradient manner. 100 μL of phage solution in different dilution gradients and 100 μL of host bacteria were added to 5 mL of 0.5% LB semi-solid culture medium and the titer was determined by double-layer plate method. The highest titer was the optimal infection multiplicity of the phage. The titer was repeated three times.

[0086] Results: See Figure 5 The optimal infection multiplicity of phage is 0.0001, at which point the phage proliferation reaches the highest titer.

[0087] Example 8: One-step growth curve of bacteriophage vB-Sal-TmvP009

[0088] (1) Adjust the host bacteria concentration to 1×10 8 CFU / mL.

[0089] (2) Take 1 mL of host bacteria and 1 mL of phage solution and mix them at the optimal infection multiplicity (0.0001), incubate in a 37°C incubator for 10 min, centrifuge (5000xg, 4 min), discard the supernatant, add 5 mL of LB liquid culture medium to resuspend, and place in a 37°C shaker for shaking culture. Take samples at regular intervals: take samples every 2 min for the first 10 min, every 5 min for 10-20 min, every 10 min for 20-100 min, and every 20 min for 100-160 min, and measure the titer. Repeat three times.

[0090] A one-step growth curve is drawn with time as the horizontal axis and phage titer as the vertical axis. Figure 5 .

[0091] The average lysis amount of phage was calculated using the formula: average lysis amount = average phage titer in the stable period (PFU / mL) / average phage titer in the latent period (PFU / mL).

[0092] Results: See Figure 6The phage incubation period is 8 minutes, the lysis period is 10 to 60 minutes, and the phage titer is stable after 60 minutes. The average lysis amount of the phage is calculated to be 9.77×10 4 .

[0093] Example 9: Genomic Analysis of Bacteriophage vB-Sal-TmvP009

[0094] The purified phage solution in Example 1 or 2 was sent to the company (Shanghai Weina Biotechnology Co., Ltd.) for detection.

[0095] Canu (https: / / github.com / marbl / canu), Flye (https: / / github.com / fendergla ss / Flye), and SPAdes (https: / / github.com / ablab / spades) were used for sequencing assembly; Bowtie2 (http: / / bowtie-bio.sourceforge.net / bowtie2 / index.shtml) was used for GC-dept h analysis of phage genes; Glimmer (http: / / ccb.jhu.edu / software / glimmer / index.shtml) was used for CDS prediction; barrnap (https: / / github.com / tseemann / barrnap / ) was used for rRNA prediction; tRNA-scan-SE (http: / / trna.ucsc.edu / software / ) was used for tRNA prediction; BLAST+ (ftp: / / ftp.ncbi.nlm.nih.gov / blast / executables / blast+ / 2.11.0 / ) was used for database annotation comparison analysis; NR Database (ftp: / / ftp.ncbi.nlm.nih.gov / blast / db / ), Swiss-prot (https: / / we b.expasy.org / docs / swiss-prot_guideline.html), eggNOG (http: / / eggnogdb.embl.de / # / app / home), KEGG (http: / / www.genome.jp / kegg / ), Blast2go (https: / / www.blast2go.com / ) and Pfam (http: / / pfam.xfam.org / ) were used for NR annotation, Swiss-prot annotation, COG annotation, KEGG annotation, GO annotation and Pfam annotation; VFDB (http: / / www.mgc.ac.cn / VFs / main.htm) was used for virulence gene prediction; TCDB (http: / / www.tcdb.org / ) was used for transporter prediction; CARD (http: / / arpcard.Mcmaster.ca) was used for resistance gene analysis.

[0096] Results: See Figure 7The total genome length of the bacteriophage is 44327bp, and the G+C content is 49.77%. The total number of encodable genes is 68, including lysin and putative spanin proteins with lytic functions, wherein the gene sequence of lysin is shown in SEQ.ID.No.1, and the gene sequence of putative spanin protein is shown in SEQ.ID.No.2; there is no tRNA, no virulence gene, no drug resistance gene, and it is safe.

[0097] Example 10: In vitro antibacterial effect of bacteriophage vB-Sal-TmvP009 at different optimal multiplicity of infection (MOI)

[0098] (1) Adjust the host bacteria concentration to 10 6 CFU / mL.

[0099] (2) 100 μL of phage solution and 100 μL of host bacterial solution were added to the honeycomb plate at different MOIs. 100 μL of LB liquid culture medium and 100 μL of host bacterial solution were added to the control group. The honeycomb plate was placed in the fully automatic microbial growth curve analyzer Bioscreen C to measure the absorbance value of each sample at 600 nm. The absorbance value was recorded every 30 minutes for a total of 12 hours and repeated three times.

[0100] Results: See Figure 8 Compared with the control group (WT group), when MOI = 0.0001-10, the phages can effectively inhibit the growth of Salmonella within 8 hours, and have a preventive and control effect on Salmonella.

[0101] Example 11: Antibacterial application of bacteriophage vB-Sal-TmvP009 in lettuce

[0102] (1) Lettuce processing: The lettuce was sterilized with alcohol and UV for 1 hour and cut into 1 cm × 1 cm pieces.

[0103] (2) Antibacterial effect of bacteriophage vB-Sal-TmvP009

[0104] Control group: 100 μL of logarithmic phase host bacteria was dripped onto the surface of the lettuce sample, allowed to stand for 10 min, and 100 μL of PBS buffer solution was then dripped.

[0105] Experimental group: 100 μL of logarithmic phase host bacteria was dripped onto the surface of the lettuce sample, left to stand for 10 min, and then 100 μL of phage dilution was dripped at the optimal multiplicity of infection (0.0001).

[0106] Cultivate at 25 °C, sample regularly for counting (0, 2, 6, 10, 24 h), place the sample in 1 mL of PBS buffer solution after sampling and vortex for 2 min, measure the concentration of Salmonella in the PBS buffer solution after vortexing, draw a bar chart, with 3 replicates in each group.

[0107] Results: See Fig. 9 . In the figure, *** indicates 0.0001 < p < 0.001, ** indicates 0.001 < p < 0.01, and ns indicates no significant difference. Calculate the Salmonella concentration by the nine-point method, and the formula is N = X·Y·50 (N: Salmonella concentration, X: average number of Salmonella colonies, Y: dilution factor). The results show that compared with the control group, the phage can effectively control the concentration of Salmonella in lettuce, with a maximum reduction of 3.399 log, indicating that this phage can be used for the prevention and control of Salmonella in solid foods.

[0108] Example 12: Bacteriostatic application of phage vB-Sal-TmvP009 in milk

[0109] (1) Treatment of milk. Irradiate the milk with ultraviolet light for 1 h.

[0110] (2) Bacteriostatic effect of phage vB-Sal-TmvP009

[0111] Control group: Add 2400 μL of sterile milk to a centrifuge tube, add 300 μL of logarithmic-phase bacterial solution, let it stand for 10 min, and add 300 μL of PBS buffer solution as a control.

[0112] Test group: Add 2400 μL of sterile milk to a centrifuge tube, add 300 μL of logarithmic-phase bacterial solution, let it stand for 10 min, and add 300 μL of phage dilution solution according to the optimal multiplicity of infection (0.0001).

[0113] Cultivate at 25 °C, sample regularly (0, 2, 6, 10, 24 h), calculate the Salmonella concentration by the nine-point counting method, with 3 replicates in each group.

[0114] Results: See Fig.10 . In the figure, *** indicates 0.0001 < p < 0.001, and ns indicates no significant difference. Calculate the Salmonella concentration by the nine-point counting method, and the formula is N = X·Y·50 (N: Salmonella concentration, X: average number of Salmonella colonies, Y: dilution factor). The results show that compared with the control group, the phage can effectively control the concentration of Salmonella in milk, with a maximum reduction of 3.719 log, indicating that this phage can be used for the prevention and control of Salmonella in liquid foods.

[0115] The above description of the embodiments is to facilitate the understanding and use of the invention by those skilled in the art. It is obvious that those skilled in the art can easily make various modifications to these embodiments and apply the general principles described herein to other embodiments without creative work. Therefore, the present invention is not limited to the above embodiments, and improvements and modifications made by those skilled in the art based on the disclosure of the present invention without departing from the scope of the present invention should be within the scope of protection of the present invention.

[0116] The sequences involved in this application are as follows:

[0117] SEQ.ID.No.1 (gene sequence of lysin) is:

[0118] ATGTCAAACCGAAACATCAGTGACAACGGATTACACTTCACCGCCGCGTTCGAGGGGTTCCGAGGAACCGCGTACAAGGCAACGAAGAACGAGAAGTACCTTACTATTGGTTATGGTCACTATGGTGCCGATGTGAAAGAAGGTCAGAAGATTACCGAAGGCCAGGGTCTTCTGCTGCTGCACAAGGATATGGCTAAGGCCGTAGCTGCGGTAGACACCGTTGCGCATCCGTCTCTAAATCAGTC ACAGTTCGACGCCGTGTGTGACCTTGTGTATAACGCTGGCGCCGGTGTAATTGCCGCTTCTACCGGAACAGGACAGGCCCTGCGAAAAGGCGATGCATCTACACTGCGTAATAAGTTAACTC AGTTCCATTATCAGAACGGCAAATCACTCCTCGGATTGCGGCGCCGAGCTGCTGGTCGTGTTGCACTGTTCGACGGTATGTTGTGGCAACAGGCCGAAGCTGTAGGGCGCGCTGCTAAGTAG.

[0119] SEQ.ID.No.1 (gene sequence of putative spanin protein) is:

[0120] ATGCAGCCACCGTGCAAAATGGTGCTACCGAGTAGTGATGCCGATGAA GACCTGGCCGTCGATGTGCAGAACGCGGAGTGCACACGGCAATTGCGTCTG AAAGTATTCCGGTTACAGGGATACATAAGGAATATTCTGGAATAG。

Claims

1. A multidrug-resistant Salmonella virulent phage vB-Sal-TmvP009, characterized in that: The bacteriophage was deposited in the General Microbiology Center of China Microorganism Culture Collection Administration on September 2, 2024, with the deposit number CGMCC No.46177.

2. A microbial preparation, characterized in that: It comprises the multi-drug resistant Salmonella virulent phage vB-Sal-TmvP009 as claimed in claim 1.

3. The use of a microbial preparation as claimed in claim 2, characterized in that: As antibacterial agent, disinfectant, food additive and feed additive.

4. The use of a microbial preparation according to claim 3, characterized in that: The antibacterial agent, disinfectant, food additive and feed additive are used for inhibiting salmonella in food, medicine and environment.

5. The use of a microbial preparation according to claim 4, characterized in that: The Salmonella includes any one of the following Salmonella: Salmonella typhimurium, Salmonella Heidelberg, Salmonella Enteritidis, Salmonella Essen, Salmonella Derby, Salmonella Agona, Salmonella Indiana, Salmonella Moscow, Salmonella Manhattan or Salmonella typhimurium monophasic variant.

6. The use of a microbial preparation according to claim 4, characterized in that: The antibacterial agent and disinfectant need to further include pharmaceutically acceptable excipients or carriers.

7. The use of a microbial preparation according to claim 4, characterized in that: The antibacterial agent and disinfectant are in the form of tablets, sprays or powders.

8. The use of a microbial preparation according to claim 4, characterized in that: The bacteriophages in the bacteriostatic agent and disinfectant can be added at MOI=0.0001-0.

01.

9. The use of a microbial preparation according to claim 4, characterized in that: The food additives and feed additives need to further include auxiliary materials approved for food or feed.

10. The use of a microbial preparation according to claim 4, characterized in that: The bacteriophages in the food additives and feed additives can be added at MOI=0.0001-0.01.

Images