Method for controlling brown planthopper based on gene fragment nlug009443.1 and application thereof

Abstract

The present application relates to the technical field of agricultural pest control, and particularly relates to a method for controlling brown planthopper based on a gene fragment Nlug009443.1 and application. The present application screens a gene fragment Nlug009443.1 (as shown in SEQ ID NO. 1) which can cause death of brown planthopper after interference, and uses dsRNA (as shown in SEQ ID NO. 4) of the gene fragment to inject brown planthopper, so as to effectively kill the brown planthopper. The present application has good safety in environmental ecology and food, and provides a new way for controlling brown planthopper by using RNA interference technology.

Description

Technical Field

[0001] This invention relates to the field of agricultural pest control technology, and in particular to a method and application for controlling brown planthoppers based on the gene fragment Nlug009443.1. Background Technology

[0002] Brown planthopper Nilaparvata lugens The brown planthopper (C. brevicornu) belongs to the order Hemiptera, suborder Cicadomorpha, superfamily Fulgoroidea, and family Delphacidae. It has a single diet, feeding and reproducing only on rice plants. It is a common rice planthopper and is currently the leading pest of rice in many Asian countries. Outbreaks of brown planthoppers can cause severe losses to rice production.

[0003] For a long time, chemical pesticides have been the primary means of controlling brown planthoppers. However, with the overuse of chemical pesticides, problems such as pesticide resistance, environmental pollution, and harm to non-target organisms have become increasingly prominent, seriously affecting the sustainability of the agricultural ecological environment. Therefore, finding more efficient, safe, and environmentally friendly pest control technologies has become a key focus of current agricultural research. To address this issue, developing targeted and sustainable biological control strategies has become an urgent task in combating brown planthoppers.

[0004] RNA interference (RNAi) technology, as an emerging molecular biology tool, has shown significant potential in agricultural pest control due to its high specificity, low toxicity, and broad application prospects. RNAi targets and degrades the mRNA of pest genes through specific short double-stranded RNA (dsRNA), thereby inhibiting the expression of specific genes and interfering with the physiological functions of pests to achieve pest control. Compared with traditional chemical control methods, RNAi has high targeting specificity and can reduce negative impacts on the environment and non-target organisms.

[0005] In view of this, the present invention is hereby proposed. Summary of the Invention

[0006] To address the aforementioned technical problems, this invention provides a method and application for controlling brown planthoppers based on the gene fragment Nlug009443.1.

[0007] Specifically, the technical solution provided by this invention is as follows:

[0008] In a first aspect, the present invention provides a method for controlling brown planthoppers, which kills brown planthoppers by interfering with a lethal gene fragment of brown planthoppers, wherein the lethal gene fragment of brown planthoppers is Nlug009443.1, and its nucleotide sequence is shown in SEQ ID NO.1.

[0009] Preferably, the present invention utilizes dsRNA to interfere with the lethal gene fragment of the brown planthopper.

[0010] Preferably, the nucleotide sequence of the dsRNA of the present invention is shown in SEQ ID NO.4.

[0011] Preferably, the dsRNA of the present invention is used for interference via microinjection.

[0012] Preferably, the concentration of dsRNA injected by microinjection in this invention is 150-350 μg / mL.

[0013] In a second aspect, the present invention provides a biological material containing dsRNA or its encoding gene as described in SEQ ID NO.4.

[0014] Preferably, the biomaterials of the present invention are nucleic acid sequences, recombinant vectors, or host cells.

[0015] Thirdly, the present invention provides the application of the biological material in the control of brown planthoppers.

[0016] Fourthly, the present invention provides the application of the biomaterial in the preparation of products for controlling brown planthoppers.

[0017] Fifthly, the present invention provides an agent for controlling brown planthoppers, which contains the aforementioned nucleic acid sequence, recombinant vector or host cell and other biological materials, and can effectively kill brown planthoppers by injection. Beneficial effects

[0018] This invention provides a method and application for controlling brown planthoppers based on the gene fragment Nlug009443.1. The invention screens out the gene fragment Nlug009443.1 (as shown in SEQ ID NO.1), which can cause the death of brown planthoppers after interference. Injecting brown planthoppers with the dsRNA of this gene fragment (as shown in SEQ ID NO.4) can effectively kill the planthoppers. This invention demonstrates good safety in terms of environmental ecology and food, providing a new approach for controlling brown planthoppers using RNA interference technology. Detailed Implementation

[0019] Gene co-expression networks have become an indispensable tool in entomology, helping to systematically understand the biological characteristics and functions of insects, as well as their interaction mechanisms with the environment and other organisms in ecosystems. They also provide new perspectives and methods for exploring the important roles of insects in agriculture, medicine, and ecology. This invention utilizes the transcriptome of the brown planthopper and screens target genes through gene co-expression network analysis, discovering an important target gene (the lethal gene fragment Nlug009443.1) that can cause death in brown planthoppers after interference. The invention also provides the dsRNA of this lethal gene fragment Nlug009443.1 and its synthesis method, providing a sequence and data foundation for establishing new strategies for controlling pests using RNA interference technology.

[0020] To make the objectives, technical solutions, and advantages of this invention clearer, the technical solutions of this invention are described clearly and completely below. Obviously, the described embodiments are only some, not all, of the embodiments of this invention. All other embodiments obtained by those skilled in the art based on the embodiments of this invention without creative effort are within the scope of protection of this invention.

[0021] The endpoints and any values ​​of the ranges disclosed in this specification are not limited to the precise ranges or values, and these ranges or values ​​should be understood to include values ​​close to these ranges or values. For numerical ranges, the endpoint values ​​of the various ranges, the endpoint values ​​of the various ranges and individual point values, and individual point values ​​can be combined with each other to obtain one or more new numerical ranges, which should be considered as specifically disclosed herein.

[0022] In the description of this specification, the references to terms such as "one embodiment," "some embodiments," "specific implementation," or "some specific implementations," etc., refer to specific features, structures, materials, or characteristics described in connection with that embodiment or example, which are included in at least one embodiment or example of the present invention. In this specification, the illustrative expressions of the above terms do not necessarily refer to the same embodiment or example. Furthermore, the specific features, structures, materials, or characteristics described may be combined in any suitable manner in one or more embodiments or examples. Moreover, without contradiction, those skilled in the art can combine and integrate the different embodiments or examples described in this specification, as well as the features of different embodiments or examples.

[0023] Unless otherwise specified, all materials and reagents used in the following examples are commercially available. Experimental methods not specifically described in the examples are generally performed under standard conditions or as recommended by the manufacturer.

[0024] The sequences involved in the following embodiments include:

[0025] SEQ ID NO.1:

[0026]

[0027] SEQ ID NO.2:

[0028] GTAAGCCCATCGACAAAGGA。

[0029] SEQ ID NO.3:

[0030] CAGGTTCAAGAACAGGCACA。

[0031] SEQ ID NO.4:

[0032] ACCGGTGATATCCTTCGGACGCCAGTATCAGAAGATATGCTTGGTCGTGTATTCAACGGAAGTGGTAAGCCCATCGACAAAGGACCTCCCATTCTTGCCGAGGATTATCTCGACATTCAAGGTCAACCCATCAATCCTTGGTCGCGTATCTATCCCGAGGAAATGATCCAGACTGGAATTTCAGCCATCGACGTCATGAACTCGATTGCTCGTGGCCAGAAAATTCCCATCTTTTCAGCTGCCGGTCTACCTCACAACGAAATTGCTGCTCAAATCTGTAGACAGGCTGGTCTTGTCAAACTGCCAGGAAAGTCAGTTCTCGATGACTCTGAGGACAACTTTGCTATTGTATTCGCAGCCATGGGAGTCAACATGGAAACTGCTCGATTCTTCAAACAGGATTTCGAGGAGAATGGTTCTATGGAGAACGTGTGCCTGTTCTTGAACCTGGCGAACGACCCGACGATCGAGCGTATCATCACACCACGCCTGGCGCTGACGGCC。

[0033] SEQ ID NO.5:

[0034] TAATACGACTCACTATAGGGGTAAGCCCATCGACAAAGGA。

[0035] SEQ ID NO.6:

[0036] TAATACGACTCACTATAGGGCAGGTTCAAGAACAGGCACA。 Example 1

[0037] Cloning of the Nlug009443.1 gene fragment:

[0038] Total RNA was extracted from brown planthoppers using the Trizol method.

[0039] RNA reverse transcription was performed using the Vazyme HiScript II Q Select RT SuperMix for qPCR kit.

[0040] The cDNA obtained by reverse transcription was diluted 10-fold with RNase-free H2O and used for subsequent PCR reactions. The PCR primer sequences are shown in SEQ ID NO.2 and SEQ ID NO.3.

[0041] DNA fragments were recovered using the FastPure Gel DNA Extraction Mini Kit manufactured by Vazyme.

[0042] DNA clones were obtained by ligation using the pMD™19-T Vector Cloning Kit manufactured by Takara and by ligation transformation of competent E.coli DH5α Competent Cells. Example 2

[0043] dsRNA synthesis of the Nlug009443.1 gene fragment:

[0044] On the website https: / / www.flyrnai.org / cgi-bin / RNAi_find_primers.pl, input the target gene sequence to design primers, keep the product length to around 500 bp, and add a T7 promoter sequence to its 5' end: 5'-TAATACGACTCACTATAGGG-3'. The primer sequences are shown in SEQ ID NO.5 and SEQ ID NO.6.

[0045] This example uses the Novizan T7 RNAi Transcription Kit. Example 3

[0046] Brown planthopper microinjection of dsRNA experiment:

[0047] (1) Preparation of the microinjection platform: Prepare a 2% agarose gel and melt it completely at high temperature. Then, pour the melted agarose gel into a sterile petri dish, ensuring that its thickness is uniform and sufficient to cover the toothpicks and capillaries placed therein, so as to form grooves adapted to the specific instar of brown planthopper. After the agarose has completely cooled and solidified, gently remove the toothpicks and capillaries, leaving grooves on the platform that match the shape of the insect, providing stable support for subsequent microinjection.

[0048] (2) Drawing capillary needles for injection: The P-97 Micropipette Puller was used for drawing. The material used was a microelectrode glass capillary (B10024F) produced by Chengdu Weitan Scientific Instruments. The drawing program parameters were set according to the experimental requirements: heating temperature (Heat) was set to 650, tensile force (Pull) was set to 300, tensile speed (Vel) was set to 150, and heating time (Time) was set to 150ms.

[0049] (3) Microinjection: The dsRNA liquid is injected into a capillary needle and fixed on a microinjector. The needle tip is cut to an appropriate thickness and length according to the brown planthopper's instar. The robotic arm of the injector is operated with a joystick to insert the capillary needle into the ventral side of the brown planthopper's thorax between the hind legs, and then the dsRNA is injected. During the injection, the brown planthopper's abdomen will be seen to swell slightly. In addition to injecting the target gene dsRNA, dsGFP is also injected as a control group. Each group is repeated with 50 plants. The concentration of dsRNA injected is approximately 150–350 μg / ml.

[0050] (4) Phenotypic observation: The injected brown planthopper nymphs were immediately transferred to glass test tubes containing fresh rice plants for rearing, and the mortality rate within 8 days was counted. The results are shown in Table 1.

[0051] Table 1

[0052]

[0053] As shown in Table 1, injection of Nlug009443.1 dsRNA has a significant lethal effect on brown planthoppers.

[0054] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, and not to limit them; although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art should understand that modifications can still be made to the technical solutions described in the foregoing embodiments, or equivalent substitutions can be made to some of the technical features; and these modifications or substitutions do not cause the essence of the corresponding technical solutions to deviate from the spirit and scope of the technical solutions of the embodiments of the present invention.

Claims

1. A method for controlling the brown planthopper by killing the brown planthopper by interfering with a lethal gene fragment of the brown planthopper, characterized by, The dsRNA is used to interfere with the lethal gene fragment of the brown planthopper, wherein the lethal gene fragment of the brown planthopper is Nlug009443.1, the nucleotide sequence of which is shown as SEQ ID NO. 1, the nucleotide sequence of the dsRNA is shown as SEQ ID NO. 4, and the dsRNA is interfered by microinjection.

2. The method of claim 1, wherein the method is for controlling the brown planthopper, Nilaparvata lugens (Stal). The concentration of the microinjected dsRNA is 150-350 μg / mL.

3. Use of a biomaterial for the control of Nilaparvata lugens or for the preparation of a product for the control of Nilaparvata lugens, characterized in that, The biological material contains the dsRNA shown as SEQ ID NO. 4 or a gene encoding the same, and the biological material is a nucleic acid sequence, a recombinant vector or a host cell.

Images