Porcine Getavirus full-length infectious clone as well as construction method and application thereof

By constructing a full-length infectious clone of porcine GETV and transfecting it into host cells, the problem of low efficiency in the development of attenuated GETV vaccines was solved, and the stability and efficient preparation of genetic markers were achieved, supporting the virulence analysis and vaccine research of GETV.

CN121950853APending Publication Date: 2026-05-01SHANGHAI VETERINARY RESEARCH INSTITUTE CAAS (CHINESE ANIMAL HEALTH & EPIDEMIOLOGY CENTER SHANGHAI BRANCH)
View PDF 2 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
SHANGHAI VETERINARY RESEARCH INSTITUTE CAAS (CHINESE ANIMAL HEALTH & EPIDEMIOLOGY CENTER SHANGHAI BRANCH)
Filing Date
2026-02-25
Publication Date
2026-05-01

AI Technical Summary

Technical Problem

Existing technologies for GETV attenuated or inactivated vaccines suffer from low development efficiency, unclear virulence, and poor stability.

Method used

A full-length infectious clone of porcine gehtavirus was constructed, including fragments C, G1, G2, G3, G4, and G5. The clone was amplified using a primer set and ligated to a linearized empty vector to form a recombinant plasmid. The rescuing virus was obtained by transfecting host cells and culturing the cells. High-level expression and stability of the genetic markers were ensured using the T7 promoter and CMV promoter.

Benefits of technology

This method enables the efficient preparation of GETV genomes that are consistent with natural viruses, provides stable genetic markers, simplifies the operation process, improves experimental efficiency, and lays the foundation for virulence analysis of porcine GETV and research on novel vaccines.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121950853A_ABST
    Figure CN121950853A_ABST
Patent Text Reader

Abstract

The invention relates to a porcine Getavirus full-length infectious clone as well as a construction method and application thereof, and belongs to the technical field of molecular biology. The invention provides a porcine Getavirus full-length infectious clone. The porcine Getavirus full-length infectious clone comprises a segment C, a segment G1, a segment G2, a segment G3, a segment G4 and a segment G5. The invention provides two GETV HN2024 strain full-length infectious clones carrying stable genetic markers, rescue viruses can be successfully prepared through the full-length infectious clones, and an established swine Getavirus reverse genetic operating system can be used for research in the directions of swine Getavirus virulence analysis, cross-species transmission mechanism and the like. And meanwhile, a foundation is laid for researching a novel vaccine of the swine Getavirus.
Need to check novelty before this filing date? Find Prior Art

Description

A full-length infectious clone of porcine gaiter virus, its construction method and application Technical Field

[0001] This invention relates to the field of molecular biology, and in particular to a full-length infectious clone of porcine gehtavirus, its construction method, and its application. Background Technology

[0002] Getah virus (GETV) is a positive-sense, single-stranded RNA virus belonging to the genus Alphavirus in the family Togaviridae. First isolated from mosquitoes in Malaysia in 1955, it is an arbovirus with a very wide host range, infecting not only mosquitoes but also pigs, horses, cattle, and sheep. For a long time, GETV has been primarily associated with fever, rash, and lymph node lesions in equines. Infected piglets typically present with fever, diarrhea, tremors, and hind limb paralysis, and can be fatal. Infected pregnant sows result in high abortion rates and weak piglets. Furthermore, serological surveys have revealed the presence of GETV antibodies in human serum. Its significant transmissibility and pathological impact have attracted considerable public health attention.

[0003] The GETV genome is approximately 12,000 bp in length, with a methylated cap at the 5' end and a variable number of poly(A) tails at the 3' end. Its genome contains two ORFs: ORF1 (7407 bp) encodes four viral non-structural proteins (Nsp1, Nsp2, Nsp3, and Nsp4), responsible for GETV RNA transcription, replication, and host immune regulation. ORF2 (3759 bp) encodes several structural proteins, including Cap, E3, E2, 6K, and E1. The Cap protein plays a central role in GETV assembly, regulating the envelope assembly process; the E2 protein is an important component of GETV, forming the envelope together with the E1 protein; it also serves as an antigen recognition and neutralization site for GETV, inducing an immune response in the host; and the 6K protein participates in glycoprotein maturation and spike assembly, regulating host cell membrane permeability. Based on the characteristics of the GETV E2 gene sequence, it can be classified into four types: GⅠ, GⅡ, GⅢ, and GⅣ, with GⅢ being the most prevalent and posing the greatest threat to animal health.

[0004] GETV exhibits broad environmental and host adaptability; however, GETV vaccines are still in the preclinical research stage. Traditional research methods have significant shortcomings; classical forward genetics requires starting with phenotypic differences, which is highly unreliable, inefficient, and reliant on natural or random mutations. The attenuation pathways of the developed attenuated or inactivated vaccines are unclear, and their safety is uncertain. Summary of the Invention

[0005] The purpose of this invention is to provide a full-length infectious clone of porcine GETV, its construction method and application, in order to solve the problems of low development efficiency, unclear virulence and poor stability of existing GETV attenuated or inactivated vaccines.

[0006] To achieve the above-mentioned objectives, the present invention provides the following technical solution: The present invention provides a full-length infectious clone of porcine gehtavirus, comprising a C fragment, a G1 fragment, a G2 fragment, a G3 fragment, a G4 fragment, and a G5 fragment; the nucleotide sequence of the C fragment is shown in SEQ ID NO.16; the nucleotide sequence of the G1 fragment is shown in SEQ ID NO.17; the nucleotide sequence of the G2 fragment is shown in SEQ ID NO.18; the nucleotide sequence of the G3 fragment is shown in SEQ ID NO.19; the nucleotide sequence of the G4 fragment is shown in SEQ ID NO.20; and the nucleotide sequence of the G5 fragment is shown in SEQ ID NO.21.

[0007] The present invention also provides a primer set for amplifying the full-length infectious clone of the porcine gehtavirus, the nucleotide sequences of which are shown in SEQ ID NO. 5-15.

[0008] The present invention also provides a method for constructing the full-length infectious clone of porcine gaiter virus, comprising the following steps: (1) using porcine gaiter virus cDNA as a template, amplifying the C, G1, G2, G3, G4 and G5 fragments of the full-length infectious clone of porcine gaiter virus using the primer set, and performing synonymous mutation on the G1 or G5 fragment; (2) ligating the full-length infectious clone of porcine gaiter virus with a linearized empty vector to obtain recombinant plasmid pGETV-CMV and recombinant plasmid pGETV-T7; (3) transfecting recombinant plasmid pGETV-CMV and recombinant plasmid pGETV-T7 into host cells, and culturing to obtain rescue virus rHN2024-CMV and rescue virus rHN2024-T7.

[0009] Preferably, the synonymous mutation in step (1) is to mutate the A at the 2169th bp of the G1 or G5 fragment to G.

[0010] Preferably, the empty vector in step (2) is the pBluescript II SK(+) vector; the recombinant plasmid pGETV-CMV includes fragments C, G1, G2, G3, and G4; and the recombinant plasmid pGETV-T7 includes fragments G5, G2, G3, and G4.

[0011] Preferably, the host cell in step (3) is a BHK-21 cell.

[0012] The present invention also provides rescue viruses constructed by the aforementioned construction method, including rescue viruses rHN2024-CMV and rHN2024-T7.

[0013] The present invention also provides a primer pair for detecting and / or identifying the rescue virus, the nucleotide sequence of the primer pair being shown in SEQ ID NO. 3-4.

[0014] The present invention also provides a method for detecting and / or identifying the rescued virus, characterized in that, using the rescued virus cDNA as a template, the primer pair is used to amplify the amplification product, and the restriction enzyme EcoRI is added for digestion to obtain the digestion product. When the digestion product is a single band, it is the rescued virus.

[0015] The present invention also provides the use of the full-length infectious clone of the porcine gaiter virus or the rescued virus in the preparation of diagnostic reagents and / or vaccines for porcine gaiter virus.

[0016] This invention has the following technical effects and advantages: It provides two full-length infectious clones of the GETV HN2024 strain carrying stable genetic markers. These full-length infectious clones can be used to successfully prepare rescue viruses, and the genetic markers remain stable after passage, serving as reliable genetic markers for identifying wild-type strains and rescue viruses. This invention provides a method for introducing restriction enzyme sites as genetic markers through synonymous mutations without altering the original amino acid sequence. This invention utilizes the high-fidelity ends of the T7 promoter for in vitro transcription, ensuring the GETV genome is consistent with the natural virus and allowing for strict control of the transcription process. Utilizing the strong initiation activity of the CMV promoter, it can drive high-level expression of the GETV genome, eliminating the need for in vitro transcription and RNA manipulation steps, and directly transfecting plasmid DNA into host cells, simplifying the operation and increasing experimental efficiency in mammalian cells. The GETV reverse genetics operating system established by this invention can be applied to research on the virulence analysis and cross-species transmission mechanisms of porcine GETV, and also lays the foundation for research on novel vaccines against porcine gehtavirus. Attached Figure Description

[0017] Figure 1 is a schematic diagram of the strategy for constructing a full-length infectious clone of porcine gehtavirus strain HN2024; Figure 2 shows the electrophoresis results of the C, G1, G2, G3, G4, and G5 fragments of porcine gehtavirus, the CMV promoter, and the CMV enhancer, where lane M is the marker, lane 1 is the G1 fragment, lane 2 is the G2 fragment, lane 3 is the G3 fragment, lane 4 is the G4 fragment, lane 5 is the G5 fragment, and lane 6 is the C fragment; Figure 3 shows the recombinant... Electrophoresis results of plasmid pGETV-CMV and recombinant plasmid pGETV-T7, where lane M is the marker, lanes 1-5 are recombinant plasmid pGETV-CMV, and lanes 6-9 are recombinant plasmid pGETV-T7; Figure 4 shows the electrophoresis results of recombinant plasmid pGETV-T7 after SwaI linearization, where lane M is the marker, lane 1 is the unlinearized recombinant plasmid pGETV-T7, and lane 2 is the linearized pGETV-T7. Figure 5 shows the electrophoresis results of recombinant plasmid pGETV-T7 transcribed RNA in vitro; Figure 6 shows the cytopathic effects of BHK-21 cells transfected with rescue virus rHN2024-CMV, rescue virus rHN2024-T7, and wild-type parental strain HN2024, where A is untransfected BHK-21 cells, B is transfected with wild-type parental strain HN2024, C is transfected with rescue virus rHN2024-CMV, and D is transfected with rescue virus rHN2024-T7; Figure 7 shows the EcoRI analysis of F5 generation viral fluids of rescue virus rHN2024-CMV and rescue virus rHN2024-T7. Figure 1 shows the enzyme digestion identification results, where lane M is the marker, lane 1 is the DNA fragment amplified from the wild-type parental strain HN2024, lane 2 is the DNA fragment amplified from the rescued virus rHN2024-T7, lane 3 is the DNA fragment amplified from the rescued virus rHN2024-CMV, lane 4 is the enzyme digestion result of the wild-type parental strain HN2024, lane 5 is the enzyme digestion result of the rescued virus rHN2024-CMV, and lane 6 is the enzyme digestion result of the rescued virus rHN2024-T7; Figure 8 shows the titer determination results of the F5 generation virus solutions of the wild-type parental strain HN2024, the rescued virus rHN2024-CMV, and the rescued virus rHN2024-T7; Figure 9 shows the indirect immunofluorescence identification results of the F5 generation virus solutions of the rescued virus rHN2024-CMV and the rescued virus rHN2024-T7, where Mock is the negative control;Figure 10 shows the genetic stability identification results of rescued viruses rHN2024-CMV and rHN2024-T7. Lane M is the marker, lane 1 is the enzyme digestion result of the wild-type parent strain HN2024, lanes 2-5 are the enzyme digestion results of the F3, F6, F9, and F12 generations of rescued virus rHN2024-CMV, and lanes 6-9 are the enzyme digestion results of the F5, F10, F15, and F20 generations of rescued virus rHN2024-T7. Detailed Implementation

[0018] This invention provides a full-length infectious clone of porcine gehtavirus, comprising a C fragment, a G1 fragment, a G2 fragment, a G3 fragment, a G4 fragment, and a G5 fragment; the nucleotide sequence of the C fragment is shown in SEQ ID NO.16; the nucleotide sequence of the G1 fragment is shown in SEQ ID NO.17; the nucleotide sequence of the G2 fragment is shown in SEQ ID NO.18; the nucleotide sequence of the G3 fragment is shown in SEQ ID NO.19; the nucleotide sequence of the G4 fragment is shown in SEQ ID NO.20; and the nucleotide sequence of the G5 fragment is shown in SEQ ID NO.21.

[0019] The present invention also provides a primer set for amplifying the full-length infectious clone of the porcine gehtavirus, the nucleotide sequences of which are shown in SEQ ID NO. 5-15.

[0020] The present invention also provides a method for constructing the full-length infectious clone of porcine gaiter virus, comprising the following steps: (1) using porcine gaiter virus cDNA as a template, amplifying the C, G1, G2, G3, G4 and G5 fragments of the full-length infectious clone of porcine gaiter virus using the primer set, and performing synonymous mutation on the G1 or G5 fragment; (2) ligating the full-length infectious clone of porcine gaiter virus with a linearized empty vector to obtain recombinant plasmid pGETV-CMV and recombinant plasmid pGETV-T7; (3) transfecting recombinant plasmid pGETV-CMV and recombinant plasmid pGETV-T7 into host cells, and culturing to obtain rescue virus rHN2024-CMV and rescue virus rHN2024-T7.

[0021] In this invention, the porcine gaiter virus mentioned in step (1) is preferably porcine gaiter virus strain HN2024; the synonymous mutation is to mutate A to G at the 2169th bp of the G1 or G5 fragment; the synonymous mutation method is point mutation technology.

[0022] In this invention, the empty vector in step (2) is the pBluescript II SK(+) vector; the ligation method is seamless cloning technology; the recombinant plasmid pGETV-CMV includes fragments C, G1, G2, G3, and G4; and the recombinant plasmid pGETV-T7 includes fragments G5, G2, G3, and G4.

[0023] In this invention, the host cell in step (3) is a BHK-21 cell.

[0024] The present invention also provides rescue viruses constructed by the aforementioned construction method, including rescue viruses rHN2024-CMV and rHN2024-T7.

[0025] The present invention also provides a primer pair for detecting and / or identifying the rescue virus, the nucleotide sequence of the primer pair being shown in SEQ ID NO. 3-4.

[0026] The present invention also provides a method for detecting and / or identifying the rescued virus, characterized in that, using the rescued virus cDNA as a template, the primer pair is used to amplify the amplification product, and the restriction enzyme EcoRI is added for digestion to obtain the digestion product. When the digestion product is a single band, it is the rescued virus.

[0027] The present invention also provides the use of the full-length infectious clone of the porcine gaiter virus or the rescued virus in the preparation of diagnostic reagents and / or vaccines for porcine gaiter virus.

[0028] The technical solutions provided by the present invention will be described in detail below with reference to the embodiments, but they should not be construed as limiting the scope of protection of the present invention.

[0029] In the test materials of this invention, pBlueScript II SK(+) vector was purchased from Invitrogen, USA; Stbl 3 competent cells were purchased from Shanghai Weidi Biotechnology Co., Ltd.; BHK-21 cell line of suckling hamster kidney cells was purchased from ATCC Biostandard Resource Center, USA; and ST cell line of porcine testis cells was obtained from the Swine Disease Prevention and Control Technology Team of Shanghai Veterinary Research Institute. In the reagents of this invention, QIAamp Viral RNA Mini Kit was purchased from QIAGENE, Germany; pfu II DNA Polymerase was purchased from Stratogene, USA; T7 mMESSAGE High Yield Capped RNA Transcription Kit was purchased from Ambion, USA; and TransScript... ®The One-Step gDNA Removal and cDNA Synthesis SuperMix kit was purchased from Beijing TransGen Biotech Co., Ltd.; the gel extraction kit and Quant Reverse Transcriptase were purchased from Tiangen Biotech (Beijing) Co., Ltd.; rTaq DNA polymerase, dNTPs, and restriction endonucleases were purchased from TaKaRa Corporation, Japan; the plasmid extraction kit was purchased from Beijing Bodatech Biotechnology Co., Ltd.; the DMRIE-C transfection reagent and Opti-MEM were purchased from Invitrogen, USA; and the ClonExpressUltra One Step Cloning Kit V3 was purchased from Nanjing Novizan Biotechnology Co., Ltd.

[0030] Example 1: Construction of a full-length infectious clone of porcine GETV HN2024 strain. The primers required were designed according to the genome sequence of GETV HN2024 strain (GenBank ID: OR487192) as shown in Table 1, and were synthesized by Sangon Biotech (Shanghai) Co., Ltd.

[0031] Table 1 Primer Sequences Total RNA was extracted from GETV HN2024 strain and reverse transcribed to obtain porcine gettavirus cDNA. PCR amplification was performed using cDNA and pCMV-Myc plasmid as templates, employing the primer sequences described in Table 1. The amplification volume was 50 μL, including Q5... ® The amplification program consisted of 25 μL of High-Fidelity 2×Master Mix, 5 μL of cDNA, 2.5 μL each of forward and reverse primers, and the remainder ddH2O. The amplification program was as follows: 95℃ pre-denaturation for 3 min → (95℃ denaturation for 30 s → 55℃ annealing for 30 s → 72℃ extension for 5 min) × 35 cycles → 72℃ final extension for 10 min, yielding C fragments, G1 fragments, G2 fragments, G3 fragments, G4 fragments, G5 fragments, a CMV promoter, and a CMV enhancer. The G1 fragment had a 20 bp homologous arm at the 5' end of the CMV enhancer, the G4 fragment had a pBluescript IISK(+)XbaI restriction site and a 20 bp homologous arm at the 3' end, and the G5 fragment had a pBluescript IISK(+)ApaI restriction site and a 20 bp homologous arm at the front. A synonymous mutation was achieved by changing A to G at 2169 bp in the G1 and G5 fragments using point mutation technology. The results are shown in Figures 1 and 2.

[0032] After linearizing the pBluescript II SK(+) vector with ApaI / XbaI, the amplified product was ligated to the linearized pBluescript II SK(+) using the ClonExpress UltraOne Step Cloning Kit V3 for homologous recombination ligation. The homologous recombination ligation system for the recombinant plasmid pGETV-CMV(C+G1+G2+G3+G4) was as follows: 1 μL linearized pBluescript II SK(+), 0.6 μL C fragment, 0.8 μL G1 fragment, 1 μL G2 fragment, 0.8 μL G3 fragment, 0.8 μL G4 fragment, and 5 μL ligase. The homologous recombination ligation system for the recombinant plasmid pGETV-T7 (G5+G2+G3+G4) was as follows: [Insert homologous recombination system here]. 1 μL of G5 fragment, 1 μL of G2 fragment, 1 μL of G3 fragment, 1 μL of G4 fragment, and 5 μL of ligase were used. After transformation into E. coli Stbl3 competent cells, plasmids were extracted using a plasmid extraction kit. PCR identification was performed using primers M1-F / R as described in Table 1, and sequencing was performed by Sangon Biotech (Shanghai) Co., Ltd. The results are shown in Figure 3.

[0033] The nucleotide sequence of fragment C is shown in SEQ ID NO.16.

[0034] SEQ ID NO.16: TAAGTTGGGTAACGCCAGGGCGTTACATAACTTACGGTAAATGGCCCGCCTGGCTGACCGCCCAACGACCCCCGCCCATTGACGTCAATAATGACGTATGTTCCCATAGTAACGCCAATAGGGACTTTCCATTGACGTCAATGGGTGGAGTATTTACGGTAAACTGCCCACTTGGCAGTACATCAAGTGTATCATATGCCAAGTACGCCCCCTATTGACGTCAATGACGGTAAATGGCCCGCCTGGCATTATGCCCAGTACATGACCTTATGGGACTTTCCTACTTGGCAGTACATCTACGTATTAGTCATCGCTATTACCATGGTGATGCGGTTTTGGCAGTACATCAATGGGCGTGGATAGCGGTTTGACTCACGGGGATTTCCAAGTCTCCACCCCATTGACGTCAATGGGAGTTTGTTTTGGCACCAAAATCAACGGGACTTTCCAAAATGTCGTAACAACTCCGCCCCATTGACGCAAATGGGCGGTAGGCGTGTACGGTGGGAGGTCTATATAAGCAGAGCTAATTGGGTACCGGGCCCG The nucleotide sequence of the 1 fragment is shown in SEQ ID NO.17.

[0035]

[0036]

[0037]

[0038]

[0039]

[0040] BHK-21 cells were seeded in 6-well plates and cultured until the cell confluence reached 70%–80%. Following the instructions of the Lipofectamine 3000 transfection kit, recombinant plasmid pGETV-CMV:lip3000:p3000 = 2 μg:5 μL:5 μL was mixed in each well and transfected into BHK-21 cells. After incubation at 37°C and 5% CO2 for 6 h, the culture medium was replaced with DMEM containing 2% FBS. The rescued virus rHN2024-CMV was obtained. The cytopathic effect of BHK-21 cells was observed daily, and the results are shown in Figure 6.

[0041] When BHK-21 cells transfected with recombinant plasmids pGETV-CMV and pGETV-T7 exhibited rounding and shrinkage, the diseased cells were collected and lysed by repeated freeze-thaw cycles three times. After centrifugation, the supernatant was collected to obtain the rescued viruses rHN2024-CMV and rHN2024-T7, respectively. These were then passaged into normal BHK-21 cells until the F5 generation of each rescued virus was collected. RNA was extracted and reverse transcribed. The GETVNsp2 gene, containing the genetic marker, was amplified using primers M2-F / R as described in Table 1. The gene was identified by EcoRI digestion, with the wild-type parental strain HN2024 as a control. The results are shown in Figure 7.

[0042] Since both recombinant plasmids pGETV-CMV and pGETV-T7 have eliminated an EcoRI restriction site at the Nsp2 gene, the virus is identified as a rescue virus when the digestion product is a single band. The results showed that the wild-type parent strain HN2024, after EcoRI digestion, produced two bands of approximately 1900 bp and 500 bp, while the rescue viruses rHN2024-CMV and rHN2024-T7 produced only one band of approximately 2400 bp. This indicates that both recombinant plasmids pGETV-CMV and pGETV-T7 can produce infectious GETV virus, and the prepared rescue viruses rHN2024-CMV and rHN2024-T7 can be distinguished from the virus produced by infection with the wild-type parent strain.

[0043] Experimental Example 1: Determination of Virus Rescue Titer. ST cells that had grown to a dense monolayer were digested and adjusted to 2 × 10⁻⁶. 5 / mL, seeded into 96-well plates at 100μL / well, and cultured at 5% CO2, 37℃ until ST cells grow into a monolayer. The F5 generation viral solutions of rescued virus rHN2024-CMV and rescued virus rHN2024-T7 prepared in Example 2, as well as the wild-type parental strain HN2024 viral solution, were serially diluted 10-fold with DMEM medium, and 100μL was seeded into each well. The plates were then cultured at 5% CO2, 37℃ for 4–7 days to observe cytopathic effects. TCID was calculated using the Reed-Muench method. 50 The results are shown in Figure 8.

[0044] Experiment 2: Indirect immunofluorescence identification of rescued viruses. Take 4 μL of F5 generation virus solution of each rescued virus and inoculate it into monolayer ST cells cultured in Experiment 1 with maintenance medium (DMEM containing 2% FBS) at a ratio of 1:1000. After 36 h, discard the culture medium, fix with ice-cold methanol for 10 min, block with 5% BSA at room temperature for 1 h, add GETV E2 protein polyclonal antibody (1:500) and incubate at room temperature for 2 h, then add FITC-labeled goat anti-rabbit secondary antibody and incubate at room temperature for 1 h. After washing with PBS several times, observe under a fluorescence microscope. The results are shown in Figure 9.

[0045] The results showed that green fluorescent signals could be detected in the rescued virus rHN2024-CMV, the rescued virus rHN2024-T7, and the wild parent strain HN2024, indicating that the virus rescue was successful.

[0046] Experiment 3: Identification of the genetic stability of rescued viruses. Rescue viruses rHN2024-CMV and rHN2024-T7 were inoculated into normal ST cells, and blind passage was performed every 72 hours for 15 consecutive generations. RNA from each of the F5, F10, F15 and F20 generations of rescued viruses was extracted and identified by enzyme digestion using the method described in Example 2. The wild parent strain HN2024 was used as a control. The results are shown in Figure 10.

[0047] The results showed that the F3, F6, F9 and F12 infection groups of rescue virus rHN2024-CMV and rescue virus rHN2024-T7 all had a band of about 2400 bp, while the wild parent strain HN2024 showed a band of about 1900 bp and a band of about 500 bp, indicating that the genetic markers can be stably inherited for at least 12 generations in each rescue virus.

[0048] As can be seen from the above embodiments, this invention provides a full-length infectious clone of porcine gaiter virus, its construction method, and its application. This invention provides two full-length infectious clones of the GETV HN2024 strain carrying stable genetic markers. Using these full-length infectious clones, rescued viruses can be successfully prepared. The established porcine gaiter virus reverse genetics system can be used for research in areas such as virulence analysis and cross-species transmission mechanisms of porcine gaiter virus, and also lays the foundation for research on novel vaccines against porcine gaiter virus.

[0049] The above description is only a preferred embodiment of the present invention. It should be noted that for those skilled in the art, several improvements and modifications can be made without departing from the principle of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.

Claims

1. A full-length infectious clone of porcine gaiter virus, characterized in that, It includes fragments C, G1, G2, G3, G4, and G5; the nucleotide sequence of fragment C is shown in SEQ ID NO.16; the nucleotide sequence of fragment G1 is shown in SEQ ID NO.17; the nucleotide sequence of fragment G2 is shown in SEQ ID NO.18; the nucleotide sequence of fragment G3 is shown in SEQ ID NO.19; the nucleotide sequence of fragment G4 is shown in SEQ ID NO.20; and the nucleotide sequence of fragment G5 is shown in SEQ ID NO.

21.

2. The primer set for amplifying the full-length infectious clone of porcine gaiter virus as described in claim 1, characterized in that, The nucleotide sequences of the primer set are shown in SEQ ID NO.5-15.

3. The method for constructing a full-length infectious clone of porcine gaiter virus as described in claim 1, characterized in that, The procedure includes the following steps: (1) using porcine gaiter virus cDNA as a template, amplifying the C, G1, G2, G3, G4 and G5 fragments of the full-length infectious clone of porcine gaiter virus using the primer set described in claim 2, and performing synonymous mutations on the G1 or G5 fragments; (2) ligating the full-length infectious clone of porcine gaiter virus with a linearized empty vector to obtain recombinant plasmid pGETV-CMV and recombinant plasmid pGETV-T7; (3) transfecting recombinant plasmid pGETV-CMV and recombinant plasmid pGETV-T7 into host cells and culturing to obtain rescue virus rHN2024-CMV and rescue virus rHN2024-T7.

4. The construction method according to claim 3, characterized in that, The synonymous mutation mentioned in step (1) is to mutate the A in the 2169th bp of the G1 or G5 fragment to G.

5. The construction method according to claim 4, characterized in that, The empty vector mentioned in step (2) is the pBluescriptII SK(+) vector; the recombinant plasmid pGETV-CMV includes fragments C, G1, G2, G3, and G4; the recombinant plasmid pGETV-T7 includes fragments G5, G2, G3, and G4.

6. The construction method according to claim 5, characterized in that, The host cell mentioned in step (3) is BHK-21 cell.

7. The rescued virus constructed by the construction method according to any one of claims 3 to 6, characterized in that, This includes rescuing viruses rHN2024-CMV and rHN2024-T7.

8. A primer pair for detecting and / or identifying the rescued virus as described in claim 7, characterized in that, The nucleotide sequences of the primer pairs are shown in SEQ ID NO.3-4.

9. A method for detecting and / or identifying the rescue virus of claim 7, characterized in that, Using the rescued viral cDNA as a template, the primer pair described in claim 8 is used to amplify the amplified product. The restriction enzyme EcoRI is added for digestion to obtain the digested product. When the digested product is a single band, it is considered a rescued virus.

10. The use of the full-length infectious clone of porcine gaiter virus as described in claim 1 or the rescued virus as described in claim 7 in the preparation of porcine gaiter virus diagnostic reagents and / or vaccines.

Citation Information

Patent Citations

  • Full-length infectious clone of getah virus, replication subsystem of getah virus, and preparation and application of full-length infectious clone and replication subsystem

    CN112458064A

  • Infectious cDNA clones of porcine reproductive and respiratory syndrome virus and expression vectors thereof

    US20030138916A1