Nucleic acid aptamer of aflatoxin B1 and application thereof
A technology of aflatoxin and nucleic acid aptamer, which is applied in the preparation of test samples, DNA/RNA fragments, recombinant DNA technology, etc., and can solve immunological detection such as cumbersome operation, high production cost, and restriction enzyme-linked immunosorbent assay Rapid technology development and other issues, to achieve high affinity and specificity, good repeatability and stability, and good application prospects
Patent Information
- Authority / Receiving Office
- CN · China
- Current Assignee / Owner
- Publication Date
- 2012-06-27
- Estimated Expiration
- Not applicable · inactive patent
Smart Images
Figure 1 Figure 2 Figure 3
Abstract
Description
(1) Technical field:
[0001] The invention belongs to the field of biotechnology, and relates to the design and preparation of an aflatoxin B1 nucleic acid aptamer combined with aflatoxin B1 with high specificity and high affinity by using molecular biology technology - SELEX technology and its application. (two) background technology:
[0002] Aflatoxin (AF) is a general term for a group of mycotoxins with similar chemical composition. It exists in the largest amount and has the strongest toxicity. The main producing bacteria are Aspergillus flavus and Aspergillus parasiticus, which are most commonly found in peanut products such as peanuts and grains and oils, corn, rice, cottonseed, some nut foods and feed, and dairy products. AF has strong toxicity, classified according to the toxicity level, which belongs to the super toxic level, and its toxicity is 10 times that of potassium cyanide and 68 times that of arsenic. The main target organ of its action is the liver. Acute ...
Examples
Embodiment
[0047] Embodiment: a kind of aflatoxin B1 nucleic acid aptamer, it is characterized in that it is nucleotide sequence
[0048] A DNA molecule represented by GCATCACTACAGTCATTACGCATCGGGTAATCCTAAAGCGGAACTGAGGAGTGGGAGGTAAATCGTGTGAAGTGCTGTCCC or its complementary nucleotide sequence.
[0049] In the present invention, the single-stranded DNA random library and primers used for SELEX are synthesized by Takara Company. The two ends are fixed sequences, and the middle is a random sequence of 35 bases: 5'GCATCACTACAGTCATTACGCATCG-(N35)-ATCGTGTGAAGTGCTGTCCC 3', the library capacity is 10 14 Above, primer 1: 5'GCATCACTACAGTCATTACGCA 3', primer 2: 5'GGGACAGCACTTCACACGAT 3', primer 3: 5'GCGTAATGACAAAAAAAAAAAACAT-C6-NH2 3', primer 4: 5'Biot in-GGGACAGCACTTCACACGAT 3'. Aflatoxin B1 was purchased from ALEXIS Company, magnetic beads were purchased from Invitrogen Company, oligonucleotide purification reagents were purchased from Qiagen Company, and PCR kits and T vectors were purchased from ...