Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Nucleic acid aptamer of aflatoxin B1 and application thereof

A technology of aflatoxin and nucleic acid aptamer, which is applied in the preparation of test samples, DNA/RNA fragments, recombinant DNA technology, etc., and can solve immunological detection such as cumbersome operation, high production cost, and restriction enzyme-linked immunosorbent assay Rapid technology development and other issues, to achieve high affinity and specificity, good repeatability and stability, and good application prospects

Inactive Publication Date: 2012-06-27
CHINA NAT ACAD NANOTECH & ENG
View PDF3 Cites 31 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0003] At present, the AF detection methods commonly used in various countries in the world are thin-layer chromatography, micro-column method, high-pressure liquid phase method, etc. These methods have the disadvantages of cumbersome operation, low efficiency, and high requirements for operators and operating environments to varying degrees. Enzyme-linked immunosorbent assay is an internationally recognized advanced method for the determination of AF, with high sensitivity, less interference, simple and fast determination steps, and safe operation
However, for AF, a toxic small molecule, the preparation cycle of the antibody is long, the production cost is high, the technical difficulty is large, the batch-to-batch variation is large, and the clone (cell) is difficult to effectively preserve, which greatly limits the ability of enzyme-linked immunosorbent assay, etc. The rapid development of immunological detection technology

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Nucleic acid aptamer of aflatoxin B1 and application thereof
  • Nucleic acid aptamer of aflatoxin B1 and application thereof
  • Nucleic acid aptamer of aflatoxin B1 and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment

[0047] Embodiment: a kind of aflatoxin B1 nucleic acid aptamer, it is characterized in that it is nucleotide sequence

[0048] A DNA molecule represented by GCATCACTACAGTCATTACGCATCGGGTAATCCTAAAGCGGAACTGAGGAGTGGGAGGTAAATCGTGTGAAGTGCTGTCCC or its complementary nucleotide sequence.

[0049] In the present invention, the single-stranded DNA random library and primers used for SELEX are synthesized by Takara Company. The two ends are fixed sequences, and the middle is a random sequence of 35 bases: 5'GCATCACTACAGTCATTACGCATCG-(N35)-ATCGTGTGAAGTGCTGTCCC 3', the library capacity is 10 14 Above, primer 1: 5'GCATCACTACAGTCATTACGCA 3', primer 2: 5'GGGACAGCACTTCACACGAT 3', primer 3: 5'GCGTAATGACAAAAAAAAAAAACAT-C6-NH2 3', primer 4: 5'Biot in-GGGACAGCACTTCACACGAT 3'. Aflatoxin B1 was purchased from ALEXIS Company, magnetic beads were purchased from Invitrogen Company, oligonucleotide purification reagents were purchased from Qiagen Company, and PCR kits and T vectors were purchased from ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a nucleic acid aptamer which is in high-specificity and high-affinity combination with aflatoxin B1 and application thereof. The nucleic acid aptamer can be used for detection analysis and separating enrichment of aflatoxin B1, and has the advantages of being good in specificity, high in affinity, homogeneous in quality, good in stability, short in development cycle, low in production cost and convenient to use. The invention further relates to derivation sequences of a nucleic acid aptamer sequence and comprises sequences after modification.

Description

(1) Technical field: [0001] The invention belongs to the field of biotechnology, and relates to the design and preparation of an aflatoxin B1 nucleic acid aptamer combined with aflatoxin B1 with high specificity and high affinity by using molecular biology technology - SELEX technology and its application. (two) background technology: [0002] Aflatoxin (AF) is a general term for a group of mycotoxins with similar chemical composition. It exists in the largest amount and has the strongest toxicity. The main producing bacteria are Aspergillus flavus and Aspergillus parasiticus, which are most commonly found in peanut products such as peanuts and grains and oils, corn, rice, cottonseed, some nut foods and feed, and dairy products. AF has strong toxicity, classified according to the toxicity level, which belongs to the super toxic level, and its toxicity is 10 times that of potassium cyanide and 68 times that of arsenic. The main target organ of its action is the liver. Acute ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/115C12Q1/68G01N1/34
Inventor 吴淑庆杨在明张良
Owner CHINA NAT ACAD NANOTECH & ENG
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com