Check patentability & draft patents in minutes with Patsnap Eureka AI!

Species identification kit for old animal sample and preparation method of species identification kit

An animal sample, obsolete technology, applied in biochemical equipment and methods, microbial determination/inspection, etc., can solve the problems of improper DNA extraction, non-human, cumbersome detection process, etc., to solve multi-primer interference, promote progress, effect simple effect

Inactive Publication Date: 2015-01-07
JILIN UNIV
View PDF2 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0003]The common deficiencies of traditional species identification methods are as follows: 1. Some detection systems lack necessary internal controls
The coding genes of mtDNA, such as cytb gene, 12SrRNA gene, 5SrRNA gene, etc., are amplified separately and lack the necessary internal control for species identification. The material has been destroyed, or the DNA is not extracted properly, etc., it is possible to get false negative results in the process of species identification
2. Amplify and sequence the coding gene of mtDNA, the detection process is cumbersome and the sequencing cost is expensive
3. Most of the methods used are based on fresh or well-preserved tissue samples. The amplified fragments are generally 300-1200bp, which is not applicable to most old biological samples and all archaeological samples.
4. Multiple experimental reactions will cause excessive consumption of templates, making it impossible to complete the detection of trace and highly degraded old biological samples
5. Samples with close species relationship cannot be identified
However, there are many old biological samples left in the on-site inspection materials, which have not been effectively used. The reason is that there is no DNA identification method for old biological samples.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Species identification kit for old animal sample and preparation method of species identification kit
  • Species identification kit for old animal sample and preparation method of species identification kit
  • Species identification kit for old animal sample and preparation method of species identification kit

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0062] Preparation and use of old animal sample species identification kit 1

[0063] 1. Utilize the hypervariable I region sequence of the mammalian mitochondrial genome in Genebank to design two pairs of PCR primers, the sequence of the primers is:

[0064] Primer A: ACGAAACAGGATCCAACAAC

[0065] Primer B: GGTGTAGTTGTCTGGGTCTCC

[0066] Utilize the hypervariable I region sequence of mammalian mitochondrial genome in Genebank to design two pairs of PCR primers, the sequence of described primers is:

[0067] Primer C: CCATCAACACCCAAAGCTG

[0068] Primer D: CATTTAATGCACGACGTACAT

[0069] Primer E: CCCATGCATAATAAGCACGTAC

[0070] Primer F: GAGGCATGGTGATTAAGCTC

[0071] 2. Prepare a kit including the following components: 1 tube of Master mix reaction solution (1ml / tube), 1 tube of P-mix-1 reaction solution and 1 tube of P-mix-2 reaction solution (0.1ml / tube), DNA molecular weight 1 tube of standard (0.5ml / tube).

[0072] 3. Use process:

[0073] ⑴ Sample DNA:

[0074]...

Embodiment 2

[0087] Preparation and use of old animal sample species identification kit 2

[0088] 1. Utilize the hypervariable I region sequence of the mammalian mitochondrial genome in Genebank to design two pairs of PCR primers, the sequence of the primers is:

[0089] Primer A: ACGAAACAGGATCCAACAAC

[0090] Primer B: GGTGTAGTTGTCTGGGTCTCC

[0091] Utilize the hypervariable I region sequence of mammalian mitochondrial genome in Genebank to design two pairs of PCR primers, the sequence of described primers is:

[0092] Primer C: CCATCAACACCCAAAGCTG

[0093] Primer D: CATTTAATGCACGACGTACAT

[0094] Primer E: CCCATGCATAATAAGCACGTAC

[0095] Primer F: GAGGCATGGTGATTAAGCTC

[0096] 2. Prepare a kit including the following components: 1 tube of Master mix reaction solution (1ml / tube), 1 tube of P-mix-1 reaction solution and 1 tube of P-mix-2 reaction solution (0.1ml / tube), DNA molecular weight 1 tube of standard (0.125ml / tube).

[0097] 3. Specimen collection, preservation and recordin...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a species identification kit for an old animal sample and a preparation method of the species identification kit. The species identification kit comprises the following reagents: a Mastermix reaction solution, a P-mix-1 reaction solution, a P-mix-2 reaction solution and a DNA (deoxyribonucleic acid) molecular weight standard substance. The species identification kit provided by the invention solves the species identification problem of the old biological sample, can be directly applied to the detective work of criminal cases, and can maintain social stability and reveal the choice of ancient people for foods, hunting, livestock breeding and other important economic and cultural backgrounds by excavating animal archaeological information in archaeological remains. The species identification kit can also help customs combat wildlife smuggling activities and protect wildlife resources; in addition, the species identification kit can also be used for identifying the quality of traditional Chinese medicines in animals, thereby fighting against counterfeit and shoddy medicines.

Description

technical field [0001] The invention provides an old animal sample species identification kit, and the invention also provides a preparation method of the old animal sample species identification kit, which belongs to the technical field of species identification of biological samples. Background technique [0002] In the practice of forensic evidence identification, the species identification of biological samples from unknown sources is an important identification link. The identification of old biological samples has become a difficult problem in forensic DNA testing at the present stage, and it also restricts the value of many important physical evidence. At the same time, in the process of archaeological analysis, customs inspection and quality identification of traditional Chinese medicinal materials, the need for species identification of old biological samples is often encountered. [0003] The common deficiencies of traditional species identification methods are as...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/68
CPCC12Q1/686C12Q2545/101
Inventor 崔银秋赵洪玉张雪梅宁超
Owner JILIN UNIV
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More