HTT's CRISPR/Cas9-gRNA targeting sequence pair, plasmid and HD cell model

A cas9-gRNA and cell model technology, applied in the field of plasmids and HD cell models, can solve problems such as practical application limitations and achieve good gene editing activity

Active Publication Date: 2021-10-15
SOUTHWEST UNIV
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

And because HD is a serious neurological disease symptom that occurs after a large amount of chronic mutated protein accumulates, it takes a long time for the onset of mutated protein to accumulate and patients generally have a survival period of 15-20 years after the onset, so the HD of iPSCs and ESCs Practical applications of cell models are limited

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • HTT's CRISPR/Cas9-gRNA targeting sequence pair, plasmid and HD cell model
  • HTT's CRISPR/Cas9-gRNA targeting sequence pair, plasmid and HD cell model
  • HTT's CRISPR/Cas9-gRNA targeting sequence pair, plasmid and HD cell model

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0037] According to GenBank collection of mouse (C57BL / 6J) HTT gene information:

[0038] Description: huntingtin[Source:MGI Symbol; Acc:MGI:96067]

[0039] Synonyms: IT15,C430023I11Rik,Hdh,HD,htt,huntingtin

[0040] Location: Chromosome 5:34,761,740-34,912,534forward strand.

[0041] Gene ID: 15194

[0042] And comprehensively analyze the HTT genome structure and protein function conserved region, design CRISPR target (gRNA), the target sequence is as follows:

[0043] HTT-L7: tccgccggcatgacgtcacggg;

[0044] HTT-L8: ccgcgagggttgccgggacgg;

[0045] HTT-L9: caagatggctgagcgccttgg;

[0046] HTT-L10:cattgccttgctgctaagtgg;

[0047] HTT-R7: ttggccatgcccagcacgcagg;

[0048] reverse complement: cctgcgtgctgggcatggccaa;

[0049] HTT-R8: taccgcgaccctctggacaggg;

[0050] reverse complement: ccctgtccagagggtcgcggta;

[0051] HTT-R9: cgggaaagcctggcctcaggg;

[0052] reverse complement: ccctgaggccaggctttcccg;

[0053] HTT-R10: cggctctgtctcctctgaggg;

[0054] Reverse complement: c...

Embodiment 2

[0090] This example provides the CRISPR / Cas9-gRNA targeting plasmid of HTT and its construction method. The targeting plasmid is obtained by constructing a pair of targeting sequences into a carrier plasmid. The targeting sequence pair is composed of L sequence and R sequence, so that the sense strand and antisense strand of the target gene (dsDNA) can be cut at the same time, so that the target gene can be knocked into the target site by HR. According to the in vitro activity detection results in Example 1, the activities of the Htt-L9 and Htt-R9 targets are both about 95%, indicating that the targeting plasmid composed of the Htt-L9 and Htt-R9 target pairing has a relatively high in vivo gene editing activity , so in this example, Htt-L9 and Htt-R9 were selected to form a targeting sequence pair, and the targeting sequence pair was constructed into a vector plasmid. The carrier plasmid is a carrier plasmid suitable for mammals and / or mammalian cells. In order to facilitate t...

Embodiment 3

[0094] In this example, the NQ (150Q, 90Q, 50Q, 20Q) Donor plasmid was designed and constructed by Gibson cloning based on the nucleotide sequences and relative positions of the L and R targets of the Htt9 plasmid. Schematic diagram of Donor plasmid design and construction image 3 shown. image 3 In the figure, the restriction sites between PCR fragment 4 and PCR fragments 1 and 3 are Not1 restriction sites (represented in yellow in the original figure), and the restriction sites between PCR fragment 1 and PCR fragment 2 are EcoR1 and Xma1 restriction sites point (represented in red in the original figure), between PCR fragment 2 and PCR fragment 3 is the FRT (directed recombinase recognition site) site (represented in blue in the original figure).

[0095] 1. Extract CATH-a cell genomic DNA

[0096] CATH-a (ATCC CRL-11179) was purchased from Beijing Bena Chuanglian Biotechnology Research Institute and was frozen for this experiment. The cryopreserved cells were resuscitat...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a CRISPR / Cas9-gRNA targeting sequence pair of HTT, a plasmid and an HD cell model, and relates to the field of biotechnology. The targeting sequence pair of the present invention includes an L sequence and an R sequence, the base sequence of the L sequence is shown in SEQ ID NO.1, and the base sequence pair of the R sequence is shown in SEQ ID NO.2. The targeting plasmid of the present invention comprises a first carrier plasmid and the above-mentioned targeting sequence pair, and the targeting sequence pair is constructed into the first carrier plasmid. The HD cell model of the present invention is obtained by co-transfecting cells with the PolyQ Donor plasmid and the above-mentioned targeting plasmid. The present invention uses differentiated neuron cells as carriers to construct HD cell models, in order to explore the research of mHtt protein affecting or changing the internal environment of differentiated nerve cells, various signaling pathways and metabolism caused by mHtt protein in differentiated neuron cells. Changes in pathways and cellular homeostasis provide a platform for research.

Description

technical field [0001] The invention relates to the field of biotechnology, especially the CRISPR / Cas9-gRNA targeting sequence pair, plasmid and HD cell model of HTT. Background technique [0002] Huntington's disease (HD) is an autosomal dominant genetic disease, the main focus of which is in the brain, and its exact pathogenesis is unclear. Clinically, HD is mainly manifested as progressive motor, cognitive and mental disorders, but most of the final causes of death of patients are caused by complications. At present, there are no effective drugs and methods for treating HD, and the treatment for HD mainly focuses on relieving symptoms. In the early stage of the disease, when the symptoms are not enough to affect the patient's daily life, drug intervention is usually not needed. When a patient falls, drug intervention should be considered. The first choice is a dopamine-depleting drug: tetrabenazine, although it may completely inhibit excessive movement and can effective...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C12N15/11C12N5/10C12N15/85
CPCC12N5/0619C12N15/85C12N2510/00C12N2800/80C12N2810/10
Inventor付彬徐兴然彭怡王柏彬杨春丽吴惠杨丹
OwnerSOUTHWEST UNIV