A nucleic acid aptamer and its application in the detection of pathogenic Vibrio alginolyticus from pompano ovata

The technology of nucleic acid aptamer and Vibrio alginolyticus is applied in the directions of measuring devices, instruments, biochemical equipment and methods, etc., and can solve the problems of detection and diagnosis of pathogenic Vibrio alginolyticus derived from oval pomfret, and the like, Achieving good application prospects, high affinity and specificity, and small molecular weight

CN109161546BActive Publication Date: 2021-11-09GUANGXI ACAD OF SCI
8 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Publication Date
2021-11-09

Smart Images

  • Figure 1
    Figure 1
  • Figure 2
    Figure 2
  • Figure 3
    Figure 3
Patent Text Reader

Abstract

The present invention discloses a ssDNA nucleic acid aptamer and its application in pathogenic alginolyticus vibrio origin from oval pomfret. The nucleotide sequence of the ssDNA nucleic acid aptamer is 5'-GACGCTTACTCAGGTGTGACTCGTCGGTCGGGTGGTTGGGGTGGGTGGTCGGTTTTTAAGCTGTGTCATTGTCCGAAGGACGCAGATGAAGTCTC-3' (SEQ ID NO: 1). The ssDNA nucleic acid aptamer of the present invention has specificity and high sensitivity to pathogenic Vibrio alginolyticus derived from oval pomfret, and has no immunogenicity. The ssDNA nucleic acid aptamer has a stable structure, is easy to modify, is convenient for synthesis and storage, and can rapidly and accurately detect and diagnose pathogenic Vibrio alginolyticus derived from oval pomfret.
Need to check novelty before this filing date? Find Prior Art

Description

technical field

[0001] The invention relates to an ssDNA nucleic acid aptamer and its screening method, detection method and application, in particular to an ssDNA nucleic acid aptamer and its application in detecting pathogenic Vibrio alginolyticus derived from pomfret. Background technique

[0002] As a big country in aquaculture, my country's aquaculture volume accounts for 70% of the world's total aquatic product farming. However, the outbreak and prevalence of bacterial pathogens in recent years have caused huge economic losses to the aquaculture industry in my country. In Guangxi and other coastal areas of South China, Vibrio alginolyticus is one of the main pathogenic bacteria that cause bacterial fish diseases in seawater cultured fish. The fish diseases caused by it have rapid onset, high mortality and wide prevalence. Aquaculture development is seriously threatened. At present, the diagnosis of fish bacterial diseases in the world mainly adopts traditional observ...

Examples

Embodiment 1

[0035] The preparation method of embodiment 1ssDNA nucleic acid aptamer is as follows:

[0036] Step 1: Synthesize a random ssDNA library and primers shown in the sequence below

[0037] Random library Library50:

[0038] 5'-GACGCTTACTCAGGTGTGACTCG(50N)CGAAGGACGCAGATGAAGTCTC

[0039] 5' primer: 5'-FAM-GACGCTTACTCAGGTGTGACTCG-3';

[0040] 3' primer: 5'-Biotin-GAGACTTCATCTGCGTCCTTCG-3';

[0041]Step 2: Dissolve 10 nmol of the above random library in 500 μl PBS, place in a constant temperature water bath at 92°C for 5 minutes, then quickly insert it into ice, and place it in an ice bath for 10 minutes, and incubate the treated random library with Vibrio alginolyticus live bacteria on ice for 1 hour; incubate After the binding is completed, remove the supernatant by centrifugation, wash the Vibrio alginolyticus live bacteria with 10mL of PBS, bathe in a constant temperature water bath at 92°C for 10 minutes, and collect the supernatant by centrifugation at 12000g, which is the ...

Embodiment 2

[0052] According to the steps of Example 1, a rapid detection method (AFMP) for pathogenic Vibrio alginolyticus derived from pomfret pompano based on the nucleic acid aptamer of SEQ ID NO: 1 was constructed and 4 different strains of Vibrio alginolyticus were detected.

[0053] like image 3 As shown, the above-mentioned rapid detection method (AFMP) can specifically identify four different strains of Vibrio alginolyticus (TOQZ01, TOQZ02, TOQZ03, TOQZ04), but no obvious identification of Vibrio harveyi in the control group occurred.

Embodiment 3

[0055] The secondary structure of the nucleic acid aptamer was predicted online by MFOLD software.

[0056] The secondary structure prediction results of the nucleic acid aptamer of SEQ ID NO:1 are as follows Figure 4 As shown, the nucleic acid aptamer forms a special stem-loop structure and hairpin structure.