Application of OsMYB26 or mutant thereof to improvement of plant drought stress tolerance
A drought stress and mutant technology is applied in the application field of OsMYB26 or its mutants to improve the drought stress tolerance of plants, which can solve the problems that cannot be directly used to improve the drought stress tolerance of plants, and achieve significant economic benefits. Effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0038] Embodiment 1 Cloning OsMYB26 Gene Nucleotide Sequence
[0039]RNA was extracted from rice using Omega Plant Extraction Kit. Then, using 1 μg of RNA as a template, the first-strand cDNA was synthesized according to the instructions of the cDNA synthesis kit (Yeasen). Obtain the complete ORF of OsMYB26 according to the (http: / / rice.plantbiology.msu.edu / expression.shtml) website, and design specific primers: the 5' end primer is ATGGGGCACCACTCCTGCTGCAAC (SEQ ID No.11); the 3' end primer is TCAGGGAATCCAGTGAGGTTGC ( SEQ ID No. 12). PCR reaction system: 2×PhantaMax MasterMix 25μL, forward / reverse primer 10μM each 1μL, template (cDNA) 5μL, sterilized water to make up to 50μL, the reaction program is as follows: 95°C pre-denaturation for 3min, 95°C denaturation for 30s, Tm annealing 30s, 72°C extension 2kb / min, 35-40cycles, 72°C extension 5min. The final amplified 924bp (including stop codon) full-length cDNA sequence of OsMYB26 (as shown in SEQ ID No.1), encoding 308 amino ...
Embodiment 2
[0040] The construction of embodiment 2 OsMYB26 gene mutant
[0041] Based on CRISPR-Cas9 technology, construct the vector pCAMBIA1300-CAS9-Os-OsMYB26 of two OsMYB26 gene mutants:
[0042] 2.1 Select positions 39-58 of the CDS sequence of the OsMYB26 gene (GAGGGGCCTGTGGTCACCAG AGG , as shown in SEQ ID No.13, wherein the underlined part is the PAM sequence conforming to NGG) the sequence is the target site 1 (named as Cas9-1), the synthetic sgRNA-1, the nucleotide sequence is GAGGGGCCTGTGGTCACCAG (such as SEQ ID No. 14), digest the gene editing vector psgR-CAS9-Os with BbsI, first anneal the primers, the annealing reaction system includes, 10 μL forward primer F: TGTGTGAGGGGCCTGTGGTCACCAG (as shown in SEQ ID No.15), 10 μL reverse primer R: AAACCTGGTGACCACAGGCCCCTCA (as shown in SEQ ID No.16) and 80μM 10x T4 buffer, mix the reaction system, anneal at 95°C for 10min, and then ligate with the digested carrier psgR-CAS9-Os, the ligation system includes 2μL of annealed product , ...
Embodiment 3
[0044] The acquisition and identification of embodiment 3 OsMYB26 gene mutant
[0045] The rice (Nipponbare) callus was used as the experimental material. The OsMYB26 gene mutant vector obtained in Example 2 was transformed into Agrobacterium EHA105 by a freeze-thaw method. Pick a single clone of Agrobacterium (containing the OsMYB26 gene mutant carrier) and place it in 2 mL of Rif+Spe LB liquid medium at 28°C at 200 rpm for overnight shaking, then take 1 mL of the bacterial liquid into 10 mL of resistant LB for 5 h, centrifuge at room temperature for 10 min at 4000 rpm, Discard the supernatant, and resuspend the cells with 50mL of AAM-As resuspension; pick out a certain size of rice callus, put it into the Agrobacterium suspension and soak it for 30min, and place a layer of AAM-soaked AAM-free on the medium in advance. Bacteria filter paper, spread the callus on the medium with a spoon, and culture in the dark at 28°C for 2 days. After 2 days, wash the callus with sterile w...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More