Method for constructing CAR-T targeting liver cancer-related antigen DLK1

Abstract

The present invention discloses a method for constructing CAR-T targeting liver cancer-related antigen DLK1. The present invention selects a single-chain antibody of liver cancer-related antigen DLK1 to be recombined in T cells, and the T cells after genetic engineering are further activated, thereby enhancing the killing power of T cells against liver cancer cells; the single-chain antibody of DLK1 is obtained by obtaining RNA from a hybridoma cell line that secretes DLK1 monoclonal antibody, and obtaining cDNA after reverse transcription; designing PCR primers for heavy chain variable region and light chain variable region; using the cDNA as a template, amplifying and splicing the heavy chain and light chain variable regions to obtain. The detection method of the present invention has relative sensitivity and specificity, and can reduce the side effects of T cell recognition of normal cells. The present invention provides a certain research basis for CAR-T cell immunotherapy in liver cancer immunotherapy.

Description

Technical Field

[0001] The present invention relates to the field of emerging biotherapy technology, and in particular to a method for constructing CAR-T cells targeting liver cancer-related antigen DLK1. Background Art

[0002] Primary liver cancer is one of the common malignant tumors, most of which are hepatocellular carcinoma (HCC). It ranks sixth in the incidence of malignant tumors and third in the mortality rate. In my country, the incidence and mortality of liver cancer rank second among cancers. Due to the lack of early prevention and treatment measures, and because of its high malignancy and rapid progression, the current treatment methods for hepatocellular carcinoma are mainly chemotherapy and surgical resection, and the efficacy is not obvious, especially for patients with advanced liver cancer, who generally have a survival period of only a few months. The occurrence and development of liver cancer is a multi-stage, multi-factor cumulative effect, as well as the result of multiple gene participation and mutation. Its specific cause and pathogenesis are not yet clear. The known possible external factors involved in primary liver cancer include viral hepatitis, cirrhosis, aflatoxin, drinking water pollution and some chemical carcinogens such as nitrosamines. In addition, gene mutations, chromosome rearrangements, epigenetic modifications, etc. in the body are all involved in the occurrence and development of liver cancer. Therefore, finding possible genes related to the occurrence and development of liver cancer and exploring corresponding possible diagnosis and treatment methods have become the common goals of medical workers in various countries.

[0003] With the development of tumor immunotherapy in recent decades, especially adoptive immunotherapy CAR-T (chimericantigen receptor T cell) has shown promising therapeutic effects in the application of hematological tumors, especially for patients with relapsed and refractory B lymphocyte leukemia, the remission rate has reached more than 90%. However, in the application of solid tumors, due to the lack of tumor-specific antigens and the more complex tumor heterogeneity and tumor microenvironment of solid tumors themselves, CAR-T has not yet achieved good clinical efficacy in the treatment of solid tumors.

[0004] Currently, three CAR-T therapies targeting CD19 have been approved for marketing by the US FDA, namely Novartis' Kymriah, Kite's Yescarta and Tecartus, which are used to treat refractory or relapsed acute lymphoblastic leukemia, aggressive non-Hodgkin's lymphoma and relapsed or refractory mantle cell lymphoma, respectively. The method of CAR-T treatment is to extract T cells from human peripheral blood, perform relevant genetic engineering on TCR in vitro, and the modified T cells can express chimeric antigen receptors to recognize tumor cells expressing specific antigens, and finally return them to the patient's body to achieve the purpose of anti-tumor treatment. In terms of liver cancer, the most studied CAR-T research is currently targeting the GPC-3 (Glypican3) antigen. There are also relevant research institutions in China that are conducting further clinical research, but no good clinical data has been published yet.

[0005] The present invention selects liver cancer-related antigen DLK1 (Delta like homolog 1), which is a liver cancer stem cell marker gene discovered by us in the early stage and expressed in the cell membrane of stem cells. DLK1 is located on human chromosome 14 and, as an imprinted gene, participates in cell growth, differentiation and other related life activities. Human DLK1 protein is a transmembrane protein composed of 383 (385 in mice and 383 in rats) amino acids, and its structure and amino acid sequence are highly homologous to the corresponding structures of invertebrates such as Delta, Notch, Serrate of fruit flies, Lin-12 and glpl of nematodes, and Notch proteins of mammals. DLK1 is characterized by having 6 epidermal growth factor (EGF)-like repeats and a signal sequence in the extracellular membrane region. The repeat is a domain composed of 35 to 40 amino acids and has a conservative interval of 6 cysteines. The size variation of the sugar chain connected to the N-terminus of DLK1 makes its molecular weight distribution between 45 and 60 kDa. FA1 (fetal antigen 1) was first isolated from human amniotic fluid. It is a single-chain glycoprotein containing 225 to 262 amino acids and is considered to be a large fragment protease hydrolysis product of the extracellular part of the DLK1 protein, that is, its soluble form. In normal tissues, DLK1 protein is highly expressed in the embryonic period. With the maturation and differentiation of cells, its expression level gradually decreases, followed by adrenal glands, ovaries and testicular tissues. DLK1 protein includes two forms: membrane protein and secretory protein. Highly expressed DLK1 protein has been detected in the serum of patients with liver cancer.

[0006] Chimeric antigen receptor T cells can specifically recognize antigens on the surface of tumor cells and activate the T cells' own ability to kill tumor cells. Combined with the heavy chain and light chain variable region sequences and T cell signal activation domains on monoclonal antibodies of tumor-associated antigens, CAR-T cells can directly recognize overexpressed tumor cell surface antigens. The present invention uses the extracellular end of DLK1 as an immune antigen to obtain a monoclonal antibody, and after sequencing, obtains a single-chain antibody sequence (scFv), which can specifically recognize liver tumor cells corresponding to highly expressed DLK1 proteins, and further activate T cells to play a role in killing tumor cells. Because DLK1 is highly expressed in tumor tissues, the expression of DLK1 in other normal tissues is relatively low, which can reduce the side effects caused by off-target effects and further improve the body's tolerance. Summary of the invention

[0007] The purpose of the present invention is to provide a method for constructing CAR-T cells targeting liver cancer-related antigen DLK1, which can provide a certain research basis for liver cancer immunotherapy research and its clinical application.

[0008] One of the technical problems to be solved by the present invention is to provide a method for preparing a DLK1 single-chain antibody.

[0009] The second technical problem to be solved by the present invention is to provide a monoclonal antibody that can specifically bind to natural DLK1 or denatured DLK1.

[0010] The third technical problem to be solved by the present invention is to provide a method for constructing a DLK1-CAR vector.

[0011] The fourth technical problem to be solved by the present invention is to provide a lentiviral supernatant for a method of constructing a CAR-T targeting the liver cancer-related antigen DLK1.

[0012] The fifth technical problem to be solved by the present invention is to provide a method for preparing the above-mentioned lentiviral supernatant: by transducing 293T cells with 20 micrograms of DLK1-CAR vector and lentiviral packaging plasmid (15 micrograms for pSPAX2 and 5 micrograms for pMD2.G) under the action of 20 microliters of transfection reagent Lip2000, collecting the cell culture fluid after 48 hours, obtaining a precipitate by ultra-high-speed centrifugation, and then resuspending it in RPMI1640 medium (without serum).

[0013] The sixth technical problem to be solved by the present invention is to provide the DLK1-CAR-T cells of the above-mentioned CAR-T construction method targeting the liver cancer-related antigen DLK1: by infecting human peripheral blood T lymphocytes with the DLK1-CAR vector virus supernatant under the action of the infection-promoting reagent polybrene (the final concentration during infection is 5 micrograms per milliliter).

[0014] In order to solve the above technical problems, the present invention is implemented by the following technical solutions:

[0015] <First aspect>

[0016] The present invention provides a method for preparing a DLK1 single-chain antibody, the method comprising the following steps:

[0017] A1, RNA was obtained from the SP2 / 0 and Balb / c mouse spleen cell monoclonal antibody hybridoma cell lines with a deposit number of CGMCC No.11596, and cDNA was obtained after reverse transcription;

[0018] A2. Design PCR primers for the heavy chain variable region and the light chain variable region; the heavy chain variable region gene sequence is shown in SEQ ID NO.1, and the light chain variable region gene sequence is shown in SEQ ID NO.2;

[0019] A3. Using the cDNA as a template, amplify and splice the heavy chain and light chain variable regions.

[0020] The sequence used for splicing is shown in SEQ ID NO:3.

[0021] Step A1 specifically includes: after the hybridoma cells are revived, RNA is extracted using Trizol, and reverse transcribed into cDNA under the action of reverse transcriptase.

[0022] In step A2, PCR primers for synthesizing the heavy chain variable region (VH) and the light chain variable region (VL) are designed based on the gene framework structure.

[0023] Step A3 is specifically as follows: using the cDNA in step A1 as a template, the primers in step A2 are used to amplify the heavy chain and light chain variable region genes of the antibody; overlapping extension PCR method is used to splice the linker between the heavy chain and light chain variable regions, and connect them into a single-chain antibody.

[0024] <Second Aspect>

[0025] The present invention also provides a DLK1 single-chain antibody prepared by the above-mentioned preparation method.

[0026] The DLK1 monoclonal antibody involved in the present invention is secreted and produced by hybridoma cell lines.

[0027] The hybridoma cell line is prepared by a method comprising the following steps:

[0028] S1. The extracellular end of recombinant human DLK1 protein (24aa-303aa) was selected as the immunogen;

[0029] S2. Animal immunization: mice secreting high-titer anti-human DLK1 monoclonal antibodies were obtained by subcutaneous immunization of mice;

[0030] S3, SP2 / 0 and Balb / c mouse spleen cells that secrete high-titer anti-human DLK1 monoclonal antibodies were selected and fused with mouse myeloma cells in vitro;

[0031] S4, ELISA to screen antibody-secreting hybridoma cells;

[0032] S5. The positive hybridoma cells are subcloned and identified to obtain hybridoma monoclonal cells that stably secrete anti-human DLK1 monoclonal antibodies, i.e., the hybridoma cell line. The monoclonal antibodies secreted by the hybridoma cell line are confirmed to specifically recognize and bind to human DLK1 by ELISA, immunoblotting, flow cytometry, immunohistochemistry and other methods.

[0033] Preferably, the hybridoma cell lines include the deposit numbers CGMCC No. 11596SP2 / 0 and the Balb / c mouse spleen cell monoclonal antibody hybridoma cell line.

[0034] <Third Aspect>

[0035] The present invention relates to a DLK1-CAR vector, wherein the DLK1 single-chain antibody prepared by the above-mentioned preparation method is constructed onto a CAR expression vector to obtain the DLK1-CAR vector.

[0036] Preferably, the construction specifically comprises the following steps:

[0037] B1. Linearization of empty vector: CAR vector (pCDH-CAR-GFP-Puro) was linearized after single restriction digestion with BamHⅠ;

[0038] B2. The DLK1 single-chain antibody gene sequence was inserted into the CAR expression vector by seamless cloning, and sequencing was performed to verify whether the inserted sequence was correct.

[0039] <Fourth Aspect>

[0040] The present invention relates to a lentiviral supernatant used in a CAR-T construction method targeting liver cancer-related antigen DLK1. The DLK1-CAR vector and lentiviral packaging plasmids pSPAX2 and pMD2.G are co-transfected into 293T cells, and the viral supernatant is collected after infection, i.e., the lentiviral supernatant.

[0041] <Fifth Aspect>

[0042] The present invention relates to a DLK1CAR-T cell for a CAR-T construction method targeting liver cancer-related antigen DLK1, which is a genetically engineered T cell and comprises an extracellular antigen recognition region, a transmembrane region and an intracellular signal activation domain; the extracellular antigen recognition region is the DLK1 single-chain antibody sequence prepared by the above preparation method, the transmembrane region is CD8α, and the intracellular signal activation domain is 4-1BB and CD3ζ.

[0043] <Sixth Aspect>

[0044] The present invention relates to a method for constructing DLK1 CAR-T cells, wherein the above-mentioned lentiviral supernatant is used to infect human peripheral blood T lymphocytes under the action of an infection-promoting reagent polybrene to construct the DLK1 CAR-T cells.

[0045] <Seventh Aspect>

[0046] The present invention relates to use of the above-mentioned DLK1 CAR-T cells in preparing anti-liver cancer drugs.

[0047] The hybridoma cell line of the present invention that can secrete DLK1 monoclonal antibody is code-named 29A7D11C8B7-019, classified and named SP2 / 0 and Balb / c mouse spleen cell monoclonal antibody hybridoma cell line, and was deposited in the General Microbiology Center of China Microorganism Culture Collection Committee (abbreviated as CGMCC) on November 24, 2015, with the deposit number CGMCC No.11596, and the deposit address is: Institute of Microbiology, Chinese Academy of Sciences, No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing.

[0048] The present invention uses the extracellular end of DLK1 as an immune antigen to obtain a monoclonal antibody, and after sequencing, obtains a single-chain antibody sequence (scFv), which can specifically identify liver tumor cells corresponding to highly expressed DLK1 protein, and further activate T cells to kill tumor cells. Because the expression of DLK1 in other tissues is relatively low in tumor tissues, it can reduce the side effects caused by cytokine release and improve the body's tolerance.

[0049] Compared with the prior art, the present invention has the following beneficial effects:

[0050] 1. The present invention selects DLK1, an antigen with relatively high expression in liver cancer, as a target, integrates the DLK1 single-chain antibody sequence into the second-generation CAR lentiviral vector by genetic engineering methods, and obtains DLK1CAR-T cells after further amplification. In vitro cytotoxicity experiments show that DLK1 CAR-T cells have a strong lysis ability against DLK1-positive liver cancer cells, but have no killing effect on DLK1-negative liver cancer cells, thus improving the killing ability of DLK1 CAR-T cells against DLK1-positive liver cancer cells;

[0051] 2. The biological properties of the antibodies in the present invention are superior to those mentioned in CN 108456662 A of this research group, with higher affinity and better binding to the DLK1 antigen expressed on the surface of liver cancer cells, which improves the infection efficiency of lentivirus to T cells and the expression level of DLK1 CAR protein, and improves the recognition ability of DLK1 CAR-T cells to DLK1-positive liver cancer cells;

[0052] 3. The technical advantage of the present invention is that compared with existing CAR-T therapies targeting other liver cancer targets, it improves the sensitivity of DLK1-positive liver cancer cells to be recognized by CAR-T cells, and also improves the killing power of DLK1 CAR-T cells against DLK1-positive liver cancer cells, providing a therapeutic strategy with clinical application prospects for the immunotherapy of liver cancer. BRIEF DESCRIPTION OF THE DRAWINGS

[0053] Other features, objects and advantages of the present invention will become more apparent from the detailed description of non-limiting embodiments made with reference to the following drawings:

[0054] Figure 1 This is a standard curve diagram of the ELISA method for identifying and detecting the binding between the hybridoma cell supernatant and the recombinant DLK1 protein in Example 1 of the present invention;

[0055] Figure 2 The DLK1 single-chain antibody gene shown in the DNA agarose electrophoresis pattern in Example 2 of the present invention;

[0056] Figure 3 is the base sequence of the DAN single-chain antibody in Example 2 of the present invention;

[0057] Figure 4 This is a schematic diagram of the construction of the DLK1-CAR vector in Example 3 of the present invention;

[0058] Figure 5 This is a graph showing the test results of the killing ability of DLK1 CAR-T cells on liver cancer cells HepG2 in Example 4 of the present invention. DETAILED DESCRIPTION

[0059] The present invention is described in detail below in conjunction with examples. The following examples will help those skilled in the art to further understand the present invention, but are not intended to limit the present invention in any form. It should be noted that, for those of ordinary skill in the art, some adjustments and improvements can also be made without departing from the concept of the present invention. These all belong to the protection scope of the present invention. The experimental methods for which specific conditions are not specified in the examples are usually carried out under conventional conditions or according to the conditions recommended by the manufacturer.

[0060] Example 1. Establishment and screening of hybridoma cell lines that stably secrete anti-DLK1 monoclonal antibodies

[0061] Step 1. Preparation of recombinant human DLK1 protein (immune antigen)

[0062] The expression vector pcDNA3.1B-DLK1 was constructed by PCR technology. In order to be more convenient for gene expression, this empty plasmid pcDNA3.1B was artificially modified in our laboratory. Specifically, the BGH sequence was deleted at the 5' end of its sequence, and the T7 promoter, XhoⅠ, NotⅠ, EcoRⅤ and EcoRⅠ restriction sites were added, and three flag tags were introduced. The gene fragment encoding the secretory region sequence of human DLK1 (DLK1 soluble region, 24-303aa) was amplified from the human genome, and the kappa signal peptide sequence was added in front and the His 6tag tag sequence was added in the back to construct the insertion fragment kappa sp-DLK1 solublereg-His 6tag. After sequence determination and identification, it was cloned into the expression vector pCPC (KpnI / NotI) (purchased) after being treated with restriction endonucleases. The expression plasmid pCPC-DLK1-His was obtained, and the 293-E / CHOE cell line was transfected to screen out the high-efficiency expression cell line. The high-efficiency expression cell line was amplified and cultured, and after expression, separation and purification, a DLK1-His protein with a purity of more than 95% was obtained.

[0063] Step 2: Animal immunization:

[0064] The purified recombinant human DLK1 protein was mixed with Freund's complete adjuvant and injected subcutaneously into 5 Balb / c and 5 SJL mice (100ul / mouse, 100ug DLK1 protein in total). 2-3 weeks after the first immunization, the mice were given a subcutaneous multiple injection of a mixture of DLK1 protein and incomplete adjuvant for booster immunization. After 2-3 booster immunizations, a small amount of mouse serum was taken and the titer of anti-DLK1 protein antibody in the mouse serum was detected by ELISA using a 96-well ELISA plate coated with DLK1 protein. The spleen cells of mice with high titers were used for the next step of cell fusion.

[0065] Step 3, cell fusion:

[0066] Three days after the last immunization with DLK1 protein, a mouse spleen cell suspension was prepared aseptically and fused with S / P 20 mouse myeloma cells (purchased from the Cell Collection Center of Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences) at a ratio of 10:1 under the action of 50% PEG-1500 (Sigma, USA). The fusion was performed according to the conventional method (Kohler G. and Milstein C: Nature 1975; 256: 495-497), with 1 ml of PEG added slowly within 1 minute. After 90 seconds of reaction, the reaction was terminated with serum-free RPMI-1640 medium, centrifuged at 1000 rpm for 10 minutes, the supernatant was removed, and the cells precipitated by centrifugation were adjusted to a cell concentration of 1×10 in RPMI 1640-10% FCS medium containing 10% HAT (H stands for hypoxanthine, A stands for aminopterin, and T stands for thymidine, which is a product of Sigma). 6 / ml, added to 96-well flat-bottom cell culture plates (200ul per well), and cultured in a 37°C, 5% CO2 incubator for 2-3 weeks.

[0067] Step 4: Screening of antibody-secreting hybridoma cells by enzyme-linked immunosorbent assay (ELISA):

[0068] The ELISA plate was coated with recombinant human DLK1 protein (1 μg / ml, pH 7.4, PBS solution) at 37°C for 2 hours or at 4°C overnight; blocked with 2% bovine serum albumin (BSA) at 4°C overnight. After washing with PBS-0.1% Tween20 solution, the culture supernatant of the hybridoma cells to be tested (the culture supernatant of the unfused S / P 20 myeloma cells was used as a negative control) was added and incubated at 37°C for 2 hours; after washing with PBS-0.1% Tween20 solution, horseradish peroxidase (HRP)-labeled goat anti-mouse Ig (Sigma product) was added and incubated at 37°C for 1 hour; after washing with PBS-0.1% Tween20 solution, TMB substrate solution was added for color development for 10-15 minutes, and the reaction was terminated with 0.1M HCl. The OD value at 450nm was read in a plus384 ELISA reader (MD product). Hybridoma cells with OD 450 values ​​5-10 times higher than the negative control were re-cloned, expanded and frozen.

[0069] Step 5: Subcloning of positive hybridoma cells - limiting dilution method

[0070] The positive cells obtained from the above primary screening were diluted to 1-10 cells per well with RPMI-1640-10% FCS medium, plated on a 96-well cell culture plate, and cultured in a 37°C, 5% CO2 incubator for 2-3 weeks. After the clones are grown, the supernatant is taken and the secretion of anti-DLK1 antibodies is detected again by ELISA. After detection and identification, multiple antibody secretion positive cell lines were obtained. Among them, after subcloning and identification again, the multiple hybridoma cell lines that can stably secrete anti-DLK1 monoclonal antibodies obtained in this example include cell lines with the deposit numbers of CGMCC No.11596 and CGMCC No.11595. Figure 1 The hybridoma cell supernatant was identified and detected by ELISA method to bind to the recombinant DLK1 protein. The results showed that the hybridoma cell supernatant contained a high titer monoclonal antibody against the DLK1 protein. The monoclonal antibody was identified as IgG1. The hybridoma cell line was then amplified, long-term subcultured and frozen. The following Table 1 is Figure 1 The data corresponding to the curve.

[0071] Table 1

[0072] Bovine serum group BSA Group r2 0.9855 0.9943 Application 0.02-5ng / ml 0.02-5ng / ml

[0073] Example 2: Preparation of DLK1 single-chain antibody

[0074] 1. Extract RNA from hybridoma cell lines and reverse transcribe it into cDNA using reverse transcriptase

[0075] The hybridoma cell lines were revived and RNA was extracted by Trizol method. After quantification, 2 μg RNA was taken and reverse transcribed into cDNA by reverse transcriptase (Takara reverse transcription kit).

[0076] 2. Using the above cDNA as a template, heavy chain variable region primer VH Mix and light chain variable region primer VL Mix (amplification primers are from the kit provided by Novagen, catalog number 69831-3) are used to amplify the heavy chain and light chain variable region genes respectively under the action of DNA polymerase;

[0077] P1: Heavy chain variable region gene sequence VH:

[0078] CAGGTGCAACTGCAGCAGTCTGGAGGAGGCTTGGTGCAACCTGGAGGATCCA

[0079] TGAAACTCTCTTGTGCTGCCTCTGGATTCACTTTTAGTGACGCCTGGATGGACTGG

[0080] GTCCGCCAGTCTCCAGAGAAGGGGCTTGAGTGGATTGCTGAAATTAGAAGCAAA

[0081] GCTAATAATCATGCAACATACTATGCTGAGTCTGTGAAAGGGAGGTTCACCATCTC

[0082] AAGAGATGATTCCAAAAGTTGTGTCTACCTGCAAATGAACAGCTTAAGAGCTGAA

[0083] GACACTGGCATTTATTACTGTAGGTATGACGGAGCTTACTGGGGCCAAGGGACCACGGTCACCGTCTCCTCA(SEQ ID NO:1)

[0084] P2: Light chain variable region gene sequence VL:

[0085] GACATTGAGCTCACCCAGTCTCCATCCTCCCTGAGTGTGTCGGCAGGAGAGA

[0086] AGGTCACTTTGAGCTGCAAGTCCAGTCAGAGTCTGTTAAATAGTGGAAATCAAAA

[0087] GACCTACTTGGCCTGGTACCAGCAGAAACCAGGGCAGCCTCCTAAACTGTTGATC

[0088] TACGGGGCATCTAATAGGGCATCTGGGGTCCCTGATCGCTTCACAGGCAGTGGAT

[0089] TTGGAACCGATTTCTCCCTTACCATCAGCAGTGTGCAGGCTGAAGACCTGGCAGT

[0090] TTATTATTGTCAGAATGATCATAGTTATCCGGTCACGTTCGGTGCTGGCACCAAGCTGGAAATCAAA(SEQ ID NO:2)

[0091] 2.1 Prepare the following reaction system (taking 50 μl as an example)

[0092] Table 2

[0093] name Volume (μl) VH Mix or VL Mix 45 DNA polymerase 0.3 cDNA 1 <![CDATA[H2O]]> 3.7

[0094] VH Mix: mouse antibody heavy chain amplification system

[0095] VL Mix: mouse antibody light chain amplification system

[0096] 2.2 PCR reaction amplification conditions

[0097] Table 3

[0098]

[0099] 2.3 After agarose electrophoresis, recover the PCR product

[0100] 3. Connect the heavy chain and light chain variable region genes to form the scFv single-chain antibody gene. The DNA agarose electrophoresis results are as follows Figure 2 As shown, the linker splicing region sequence is as follows:

[0101] P3: Linker splicing region sequence:

[0102] GGTGGTGGTGGTTCTGGTGGTGGTGGTTCTGGCGGCGGCGGCTCC (SEQ ID NO: 3)

[0103] 3.1 Prepare the following reaction system (taking 50 μl as an example)

[0104] Table 4

[0105] name Volume (μl) scFv Mix 45 DNA polymerase 0.3 VH 2 V L 2 <![CDATA[H2O]]> 0.7

[0106] scFv Mix is ​​a single-chain antibody connection amplification system

[0107] 3.2 PCR reaction amplification conditions

[0108] Table 5

[0109]

[0110] Example 3. Construction of DLK1 CAR vector and production of lentiviral supernatant

[0111] 1. DLK1 CAR vector construction

[0112] 1.1 Vector linearization: The CAR protein expression vector was linearized after single restriction digestion with BamHⅠ;

[0113] 1.2 Based on the principle of homologous recombination, PCR primers were designed, and the scFv single-chain antibody gene was inserted into the CAR vector by seamless cloning to construct a DLK1 CAR vector;

[0114] PCR primer sequences:

[0115] P4: DLK1-scFv-F: TCCACGCCGCCAGGCCGGCAGGTGCAACTGCAGCAGTCT (SEQ ID NO: 4)

[0116] P5: DLK1-scFv-R: AGACCGGCACGAAGGATCTTTGATTTCCAGCTTGGTGCC (SEQ ID NO: 5)

[0117] 1.3 The DLK1 single-chain antibody sequence was inserted into the CAR expression vector by seamless cloning, and sequencing was performed to verify whether the sequence was correct. The schematic diagram of the DLK1-CAR vector insertion fragment is shown in Figure 3 As shown, the DLK1 single-chain antibody gene sequence is as Figure 4 As shown, it includes the VH heavy chain variable region, the Linker splicing region and the VL light chain variable region.

[0118] 2. Lentiviral Supernatant Production

[0119] 2.1 Lentivirus packaging, CAR expression vector and DLK1-CAR vector were co-transfected with lentivirus packaging plasmids pSPAX2 and pMD2.G into 293T cells, and viral supernatant was collected 48 hours after infection. Taking a 10 cm diameter cell culture dish as an example, 20 μg of CAR expression vector or DLK1-CAR vector, 15 μg of pSPAX2, 5 μg of pMD2.G, and 30 μl of Lip2000 were required for transfection;

[0120] 2.2 Concentration of lentiviral supernatant: The viral supernatant obtained in step 2.1 above was subjected to ultra-high speed centrifugation at 28,000 rpm and 4 degrees for 2 hours. The precipitate was resuspended in RPMI1640 culture medium, divided into small tubes, and stored at -20 degrees for later use;

[0121] 2.3 Lentivirus supernatant titer detection, using the well dilution method to determine the lentivirus titer

[0122] 2.3.1 One day before the assay, passage 293T cells in a 96-well plate, 100 μl per well, with a cell number of 4 times 104;

[0123] 2.3.2 On the second day, virus dilution solution was prepared as follows: Take another 96-well plate and add 90 μl of dilution solution (DMEM culture medium containing 0.5% fetal bovine serum and 8 μg / ml Polybrene) to each well;

[0124] 2.3.3 Take 10 μl of the virus solution to be tested and add 90 μl of diluent. Mix well and add to the first well in step A2-3-2. Mix well and take 10 μl to the second well. Repeat the same operation in the following wells until the last well. Starting from the second well, the amount of virus stock solution in each well is 10 μl. -1 , 10 -2 , 10 -3 , 10 -4 ;

[0125] 2.3.4 Aspirate 90 μl of culture medium from the cell wells in step A2-3-1 above, add the diluted virus solution in step A2-3-3, and after 24 hours, add 100 μl of culture medium to each well;

[0126] 2.3.5 Observe the fluorescence expression of GFP after 4 days and calculate the titer: for example, when the virus dilution is 10 -4 If two cells with GFP were observed in the well, the virus titer is the ratio of the number of fluorescent cells to the amount of virus stock solution, which is 2 / 10. -4 =2×10 4 TU / μl, i.e. 2×10 7 TU / ml.

[0127] Example 4: Detection of the killing ability of DLK1 CAR-T cells on liver cancer cells HepG2.

[0128] 1. Isolation of human peripheral blood lymphocytes: Ficoll density gradient centrifugation

[0129] 1.1 On the first day, take 5 ml of human venous peripheral blood into each tube, add 250 μl of CD4 positive T cell separation reagent and CD8 positive T cell separation reagent to each tube, and incubate at room temperature for 20 minutes;

[0130] 1.2 Add an equal volume of diluent (PBS containing 2% fetal bovine serum) to each tube, mix well and slowly add to the centrifuge tube containing Ficoll separation solution, centrifuge at room temperature, 250g, 20 minutes; after centrifugation, aspirate the white blood cell layer between the plasma and the Ficoll separation solution, add 5 times the volume of diluent (PBS containing 2% fetal bovine serum) to the precipitate, centrifuge at room temperature, 100g, 10 minutes;

[0131] 1.3 Repeat the above operation once, resuspend the precipitate in T cell culture medium (RPMI1640 culture medium containing 10% fetal bovine serum and 30 IU / ml IL-2), and count for later use.

[0132] 2. T cell activation: Mix the CD4-positive T cells and CD8-positive T cells obtained in step 1 above at a ratio of 1:1, and add Dynabeads (CD3 / CD28) to activate T cells. (According to the ratio of 1×106 per cell number, add 20 μl Dynabeads (CD3 / CD28);

[0133] 3. Lentiviral infection of activated T cells

[0134] 3.1 After 48 hours of activation, remove the beads, add 50-100 μl of virus supernatant to each well, supplement the culture medium (RPMI1640 culture medium containing 10% fetal bovine serum and 30 IU / ml IL-2) and add the infection-promoting reagent polybrene to a final concentration of 5 μg / ml, place in an incubator, and culture overnight;

[0135] 3.2 Change the medium on the second day, remove half of the culture medium, discard it and add new culture medium (RPMI1640 culture medium containing 10% fetal bovine serum and 30 IU / ml IL-2);

[0136] 3.3 After 7-10 days of continuous culture, DLK1 CAR-T cells were successfully constructed and further functional experiments were carried out (new culture medium was added every two days);

[0137] 4. Experiment on killing liver cancer cells by DLK1 CAR-T cells

[0138] 4.1 On the first day, subculture HepG2 cells in a 96-well plate, 100 μl per well, with a cell number of 1 x 104;

[0139] 4.2 On the second day, the transduced DLK1 CAR-T cells (effector cells) and HepG2 (target cells) were added to the corresponding wells at different ratios of 4:1, 2:1 and 1:1, respectively, with a volume of 100 μl, and a control group was set up. After incubation for 16-20 hours, the supernatant was taken to detect the release of cellular lactate dehydrogenase. The results showed that DLK1 CAR-T cells had a significant killing ability against liver cancer cells (HepG2), such as Figure 5 shown.

[0140] The above describes the specific embodiments of the present invention. It should be understood that the present invention is not limited to the above specific embodiments, and those skilled in the art may make various modifications or variations within the scope of the claims, which do not affect the essence of the present invention.

Claims

1. A method for preparing a DLK1 single-chain antibody, characterized in that: The method comprises the following steps: A1, RNA was obtained from SP2 / 0 and Balb / c mouse spleen cell monoclonal antibody hybridoma cell lines with a deposit number of CGMCC No.11596, and cDNA was obtained after reverse transcription; A2. Design PCR primers for the heavy chain variable region and the light chain variable region; The heavy chain variable region gene sequence is shown in SEQ ID NO.1, and the light chain variable region gene sequence is shown in SEQ ID NO.2; A3, using the cDNA as a template, amplifying and splicing the heavy chain and light chain variable regions; The sequence used for splicing is shown in SEQ ID NO:

3.

2. The method for preparing a DLK1 single-chain antibody according to claim 1, characterized in that: Step A3 is specifically as follows: using the cDNA in step A1 as a template, the primers in step A2 are used to amplify the heavy chain and light chain variable region genes of the antibody; overlapping extension PCR method is used to splice the linker between the heavy chain and light chain variable regions, and connect them into a single-chain antibody.

3. A DLK1 single-chain antibody prepared by the preparation method according to any one of claims 1 to 2.

4. A DLK1-CAR vector, characterized in that: The DLK1 single-chain antibody prepared by the preparation method as claimed in claim 3 is constructed into a CAR expression vector to obtain a DLK1-CAR vector.

5. The DLK1-CAR vector according to claim 4, characterized in that The construction specifically includes the following steps: B1. Linearization of empty vector: CAR vector was linearized after single restriction digestion with BamHⅠ; B2. The DLK1 single-chain antibody gene sequence was inserted into the CAR expression vector by seamless cloning, and sequencing was performed to verify whether the inserted sequence was correct.

6. A lentiviral supernatant used in a method for constructing a CAR-T targeting liver cancer-related antigen DLK1, characterized in that: The DLK1-CAR vector as described in claim 4 or 5 is co-transfected with the lentiviral packaging plasmids pSPAX2 and pMD2.G into 293T cells, and the viral supernatant, i.e., the lentiviral supernatant, is collected after infection.

7. A DLK1 CAR-T cell for constructing a CAR-T targeting liver cancer-related antigen DLK1, which is a genetically engineered T cell, characterized in that: It comprises an extracellular antigen recognition region, a transmembrane region and an intracellular signal activation domain; the extracellular antigen recognition region is the DLK1 single-chain antibody sequence obtained by the preparation method according to claim 1 or 2, the transmembrane region is CD8α, and the intracellular signal activation domain is 4-1BB and CD3ζ.

8. A method for constructing DLK1 CAR-T cells, characterized in that: The lentiviral supernatant as claimed in claim 6 is used to infect human peripheral blood T lymphocytes under the action of the infection-promoting reagent polybrene to construct the DLK1CAR-T cells.

9. Use of the DLK1 CAR-T cell according to claim 7 in the preparation of an anti-liver cancer drug.

Images