A primer set for detecting apple fire blight resistance traits and its application

Abstract

The present invention relates to a primer set for detecting apple fire blight resistance traits and its application. The primer set includes a forward specific primer F-anti, a forward specific primer F-sense and a common reverse primer R; the present invention also provides an application of the primer set in screening apple resources resistant to fire blight; the primer set can be used to quickly screen apple fire blight resistance resources at the molecular level with high accuracy.

Description

Technical Field

[0001] The invention belongs to the field of apple molecular genetic breeding, and in particular relates to a primer set for detecting apple fire blight resistance traits and an application thereof. Background Art

[0002] Apple is a perennial deciduous tree belonging to the genus Malus in the family Rosaceae. As one of the four major fruits in the world, apple production is carried out in more than 80 countries and regions around the world. Apple plays an important role in our diet. Not only is it a source of food supplement, but it is also rich in polyphenols and other nutrients and bioactive substances, which have a positive effect on preventing cardiovascular diseases and anti-aging. As the saying goes, "an apple a day keeps the doctor away." However, apple production is affected by a variety of biological and abiotic stresses, especially fire blight, which has a great impact on the growth of apples. The selection of fire blight-resistant varieties has always been an important goal of apple breeders around the world.

[0003] Fire blight is a bacterial disease caused by Eriwinia amylovora. It harms the flowers, buds, branches, trunks and rootstocks of fruit trees such as apples and pears, eventually leading to tree death and reduced orchard production. In severe cases, it can even cause devastating disasters. In recent years, with the spread of fire blight around the world, fire blight has appeared in apple orchards in Xinjiang, my country. Due to its great harm and difficulty in prevention and control, screening fire blight-resistant resources and breeding new varieties resistant to fire blight are important ways to prevent this disease. Molecular markers can shorten the breeding process, but there is currently a lack of molecular markers linked to apple fire blight resistance. Therefore, it is very necessary to develop primers for molecular markers for screening fire blight-resistant resources. Summary of the invention

[0004] In view of the problems existing in the prior art, the present invention provides a primer set for detecting apple fire blight resistance traits and its application, which can be used to screen fire blight-resistant apple resources and has the advantages of high accuracy.

[0005] The technical solution of the present invention to solve the above technical problems is as follows:

[0006] The present invention provides a primer set for detecting apple fire blight resistance traits, the primer set comprising a forward specific primer F-anti, a forward specific primer F-sense and a common reverse primer R; the forward specific primer F-anti comprises the nucleotide sequence shown in SEQ ID NO:1; the forward specific primer F-sense comprises the nucleotide sequence shown in SEQ ID NO:2; the common reverse primer R comprises the nucleotide sequence shown in SEQ ID NO:3.

[0007] The beneficial effects of the present invention include: it can be used for rapid screening of apple resources or hybrid offspring for resistance to fire blight, is not affected by environmental factors, greatly reduces the workload of field or laboratory inoculation and identification, improves selection efficiency, and provides reference and convenience for subsequent mining of fire blight resistance genes. The present invention has the advantages of rapid and scalable operation, convenient genotyping, high screening efficiency, high accuracy, etc.

[0008] Furthermore, the 5' end of the forward specific primer F-anti comprises a FAM fluorescent linker sequence, and the FAM fluorescent linker sequence comprises the nucleotide sequence shown in SEQ ID NO:4.

[0009] Furthermore, the 5' end of the forward specific primer F-sense includes a VIC fluorescent linker sequence, and the VIC fluorescent linker sequence includes the nucleotide sequence shown in SEQ ID NO:5.

[0010] The beneficial effects of adopting the above scheme include: the above primer set has the advantages of rapid and scalable operation, convenient genotyping, high screening efficiency, and high accuracy.

[0011] The present invention provides a kit for detecting apple fire blight resistance, comprising the above primer set. For example, the kit may also include one or more of genomic DNA, KASP working solution, negative control, positive control, and water.

[0012] The beneficial effects of adopting the above scheme include: the above kit has the advantages of rapid and scalable operation, convenient genotyping, high screening efficiency and high accuracy.

[0013] The present invention provides the use of one or more of the above primer sets and kits in breeding fire blight resistant varieties.

[0014] The beneficial effects of adopting the above scheme include: using one or more of the above primer sets and kits can screen fire blight-resistant apple resources at the molecular level, which has the advantages of rapid and scalable operation, convenient genotyping, high screening efficiency, and high accuracy.

[0015] The present invention provides a method for detecting the fire blight resistance trait of apple, comprising the following steps: extracting apple genomic DNA, using the primer set to perform PCR amplification and genotyping on the apple genomic DNA, and then determining the fire blight resistance trait of apple.

[0016] Furthermore, the PCR amplification program included: pre-denaturation at 95°C for 10 min, denaturation at 95°C for 30 s, annealing at 61°C for 45 s, decreasing 0.6°C in each cycle, 10 cycles, denaturation at 95°C for 30 s, annealing at 55°C for 45 s, and 35 cycles.

[0017] Furthermore, the kit includes KASP working solution, mixed primers and ultrapure water; the mixed primers include forward specific primer F-anti, forward specific primer F-sense and common reverse primer R, the concentration of the forward specific primer F-anti is 12mM / L, the concentration of the forward specific primer F-sense is 12mM / L, and the concentration of the common reverse primer R is 30mM / L; the PCR amplification reaction system is 5uL, including: 50ng of genomic DNA, 2.5uL 2×KASP Master mix, 0.07uL of mixed primers, and ultrapure water is supplemented to 5uL.

[0018] Furthermore, the fluorescence quantitative PCR instrument ABI-Q6 Flex can be used to directly detect the fluorescence signal during the amplification process for genotyping.

[0019] Furthermore, if the result is displayed as blue (CC) or green (TC), it means that the test objects are all apple materials resistant to fire blight, among which, if the result is displayed as blue (CC), it means that the test objects are homozygous fire blight-resistant materials; if the result is displayed as green (TC), it means that the test objects are heterozygous fire blight-resistant materials; if the result is displayed as red (TT), it means that the test objects are fire blight-susceptible materials; if the result is displayed as purple, it means that the test objects are materials that failed typing.

[0020] The beneficial effects of adopting the above scheme include: the present invention has the advantages of rapid and scalable operation, convenient genotyping, high screening efficiency, high accuracy, etc. BRIEF DESCRIPTION OF THE DRAWINGS

[0021] Figure 1 This is the indoor inoculation identification and evaluation of apple resources for fire blight on branches. The left picture is a resistant resource (Stonetash) and the right picture is a susceptible resource (Early Golden Crown).

[0022] Figure 2 This is the genotyping diagram in the test resources of Example 2. DETAILED DESCRIPTION

[0023] The principles and features of the present invention are described below in conjunction with the accompanying drawings. The examples given are only used to explain the present invention and are not used to limit the scope of the present invention.

[0024] The present invention utilizes the fire blight resistance phenotype of the natural population of apple germplasm resources, and combines the resequencing data to perform GWAS (Genome-Wide Association Study) analysis. The genetic variation (marker) polymorphism of multiple individuals in the whole genome is detected through GWAS analysis to obtain genotypes, and then the genotypes are combined with observable traits (i.e., phenotypes) for population-level statistical analysis. The genetic variation (marker) that is most likely to affect the trait is screened out based on the statistic or significant p value, and genes related to trait variation are mined. The SNP linked to apple fire blight resistance is obtained by the above method, which can be used as an auxiliary selection for apple fire blight resistance screening.

[0025] The primer set used to detect the fire blight resistance trait of apple includes a forward specific primer F-resistance, a forward specific primer F-sense and a common reverse primer R;

[0026] The nucleotide sequence of the forward specific primer F-anti is 5'-TCTGTAACTTCGTATCTGACTCTGAC-3' (SEQ ID NO: 1);

[0027] The nucleotide sequence of the forward specific primer F-sense is 5'-TCTGTAACTTCGTATCTGACTCTGAT-3' (SEQ ID NO: 2);

[0028] The nucleotide sequence of the common reverse primer R is 5′-TGTTTCATTTCAAGTAGATGCTTCCG-3′ (SEQ ID NO: 3).

[0029] Furthermore, when synthesizing primers, a FAM fluorescent linker sequence can be added to the 5' end of the forward specific primer F-anti, and the FAM fluorescent linker sequence is 5'-GAAGGTGACCAAGTTCATGCT-3' (SEQ ID NO: 4); a VIC fluorescent linker sequence can be added to the 5' end of the forward specific primer F-sense, and the VIC fluorescent linker sequence is 5'-GAAGGTCGGAGTCAACGGATT-3' (SEQID NO: 5).

[0030] That is, the complete sequence of the forward specific primer F-anti is 5'- GAAGGTGACCAAGTTCATGCT TCTGTAACTTCGTATCTGACTCTGAC-3' (SEQ ID NO: 6);

[0031] The complete sequence of the forward specific primer F-sense is: 5'- GAAGGTCGGAGTCAACGGATT TCTGTAACTTCGTATCTGACTCTGAT-3' (SEQ ID NO:7).

[0032] The present invention provides a kit for detecting apple fire blight resistance, comprising the above primer set. For example, the kit may also include one or more of genomic DNA, KASP working solution, negative control, positive control, and water.

[0033] The present invention provides the use of one or more of the above primer sets and kits in breeding fire blight resistant varieties.

[0034] The present invention provides a method for screening apple fire blight resistance traits, comprising the following steps:

[0035] (1) Detection: using the above primer set and / or kit to perform PCR amplification and genotyping on the detection object (i.e., genomic DNA of leaves of apple resources to be detected);

[0036] (2) Result judgment: If the result is displayed as blue (CC) or green (TC), it means that the test objects are all apple materials resistant to fire blight. If the result is displayed as blue (CC), it means that the test objects are homozygous fire blight-resistant materials; if the result is displayed as green (TC), it means that the test objects are heterozygous fire blight-resistant materials. If the result is displayed as red (TT), it means that the test objects are susceptible to fire blight. If the result is displayed as purple, it means that the test objects are materials that failed typing.

[0037] Furthermore, the PCR amplification reaction system is 5uL, including: 50ng of genomic DNA, 2.5uL of 2×KASPMaster mix, 0.07uL of mixed primers, and ultrapure water is added to 5uL.

[0038] Furthermore, the mixed primer includes a forward specific primer F-anti, a forward specific primer F-sense and a common reverse primer R, the concentrations of the forward specific primers F-anti and F-sense are both 12 mM / L, and the concentration of the common reverse primer R is 30 mM / L.

[0039] Furthermore, the PCR amplification procedure included: pre-denaturation at 95°C for 10 min, denaturation at 95°C for 30 s, annealing at 61°C for 45 s, decreasing 0.6°C in each cycle, 10 cycles, denaturation at 95°C for 30 s, annealing at 55°C for 45 s, and 35 cycles.

[0040] Furthermore, the PCR amplification reaction was detected using a fluorescent quantitative PCR instrument AB-Q6 Flex.

[0041] The present invention also provides the use of the above primer set in screening apple resources for fire blight-resistant materials, which can quickly screen fire blight-resistant individuals in apple germplasm resources at the molecular level with high accuracy, greatly improving the screening efficiency, and having the advantages of scalable operation and convenient genotyping.

[0042] In the present invention, unless otherwise specified, the experimental methods used are conventional experimental methods in the art. The materials, reagents, and instruments used are conventional materials, reagents, and instruments in the art, which can be obtained through commercial channels or prepared by conventional methods.

[0043] In the examples, 2×KASP Master mix was purchased from Shanghai LGC Company. The primers F-resistance, F-sense, and common reverse primer R involved in the present invention were synthesized by Shanghai Shenggong Company. The fire blight pathogen (Eriwinia amylovora) was donated by Professor Hu Baishi of Nanjing Agricultural University. The public can obtain the strain only for non-commercial purposes to verify the experiments recorded in the examples of the present invention.

[0044] The following is an introduction through specific embodiments.

[0045] Example 1 Identification of fire blight pathogens in apple resources inoculated indoors

[0046] 70 apple resource branches collected from the National Pear and Apple Germplasm Resource Nursery (Xingcheng) were evaluated for resistance to apple fire blight by indoor inoculation.

[0047] The specific method of indoor inoculation identification and evaluation can include the following steps:

[0048] (1) The fire blight pathogen (Eriwinia amylovora) with a bacterial solution number of E.α6 was used in an inoculation experiment at the Xinjiang Bayingol Agricultural Science Institute. The test strain was inoculated on a nutrient agar medium with 5% (w) sucrose (NA+5% sucrose) purchased from Shanghai Shenggong and incubated at 28.5℃ for 36h for activation. A single colony was picked and incubated in a NA+5% sucrose culture medium at 28.5℃ and 160r·min. -1 The culture was shaken for 12 h until the bacterial concentration reached 1×10 7 CFD / mL, OD 600 It is about 0.4.

[0049] NA+5% sucrose culture medium was purchased from Shanghai Biotechnology Co., Ltd., and nutrient agar was not added based on the NA+5% sucrose culture medium formula.

[0050] (2) Use a toothpick to dip into the bacterial solution obtained in step (1) until water droplets of bacterial solution are clearly visible on the toothpick, and use the toothpick to prick and inoculate the young branches on the main stem at the root of the second fully expanded leaf.

[0051] (3) The inoculated shoots were placed in 2% (mass percentage) sucrose water for cultivation. The sucrose water was replaced every 24 hours and the humidity was maintained by spraying water mist. The length of the lesions was observed and recorded.

[0052] Disease index calculation: In order to reduce the impact of uneven lengths of young leaves and branches, the length of lesions on young leaves and branches was normalized by dividing it by the length of the longest lesion, and the normalized ratio was used as the grading value.

[0053] Grade 0: no pathological changes;

[0054] Level 1: The percentage of lesion length to total length is >0 and ≤5%;

[0055] Level 3: The percentage of lesion length to total length is >5% and ≤15%;

[0056] Level 5: The percentage of lesion length to total length is >15% and ≤30%;

[0057] Level 7: The percentage of lesion length to total length is >30% and ≤50%;

[0058] Level 9: The percentage of lesion length to total length is >50%.

[0059]

[0060] After that, resistance evaluation is carried out. If the disease index is 0-5 (including the boundary value), it is considered to be highly resistant; if the disease index is >5 and ≤15, it is considered to be resistant; if the disease index is >15 and ≤30, it is considered to be moderately resistant; if the disease index is >30 and ≤60, it is considered to be moderately susceptible; if the disease index is >60 and ≤80, it is considered to be susceptible; if the disease index is >80, it is considered to be highly susceptible.

[0061] The results of indoor inoculation evaluation showed that among the 70 apple resources, 32 were resistant to fire blight and 38 were susceptible to fire blight. Figure 2 and Table 1).

[0062] Table 1 Disease resistance evaluation and expansion of 70 apple resources

[0063]

[0064]

[0065]

[0066] Example 2 KASP marker typing screening of apple resources

[0067] The experimental materials were the same as those in Example 1. Leaves of the 70 apple resources were collected, genomic DNA was extracted using a kit (Tian Gen, DP321-03), PCR amplification was performed, and the fluorescence signal was directly detected during the amplification process using a fluorescence quantitative PCR instrument ABI-Q6 Flex for genotyping.

[0068] The PCR amplification reaction system includes: 50 ng of genomic DNA, 2.5 uL of 2×KASP Master mix, 0.07 uL of mixed primers, and ultrapure water is added to 5 uL.

[0069] Among them, the mixed primer includes forward specific primer F-anti, forward specific primer F-sense and common reverse primer R; in the mixed primer, the concentration of forward specific primer F-anti is 12mM / L, the concentration of forward specific primer F-sense is 12mM / L, and the concentration of common reverse primer R is 30mM / L.

[0070] The PCR amplification program included: pre-denaturation at 95°C for 10 min, denaturation at 95°C for 30 s, annealing at 61°C for 45 s, decreasing 0.6°C in each cycle, 10 cycles, denaturation at 95°C for 30 s, annealing at 55°C for 45 s, and 35 cycles.

[0071] Experimental results: Genotypes were obtained for 69 of the 70 apple resources, including 33 TT genotypes, 22 TC genotypes, and 14 CC genotypes. Combined with the above phenotypic results, the overall identification accuracy was 81.42%, the accuracy of resistant resources was 87.50%, and the accuracy of susceptible resources was 76.32% ( Figure 2 and Table 1).

[0072] The present invention and its implementation methods are described above, and such description is not restrictive. In short, if a person skilled in the art is inspired by it and, without departing from the purpose of the invention, designs structures and implementation methods similar to the technical solution without creativity, they should all fall within the protection scope of the present invention.

Claims

1. A primer set for detecting apple fire blight resistance, characterized in that: The primer set includes a forward specific primer F-anti, a forward specific primer F-sense and a common reverse primer R; the forward specific primer F-anti includes the nucleotide sequence shown in SEQ ID NO:1; the forward specific primer F-sense includes the nucleotide sequence shown in SEQ ID NO:2; the common reverse primer R includes the nucleotide sequence shown in SEQ ID NO:

3.

2. The primer set according to claim 1, characterized in that: The 5' end of the forward specific primer F-anti includes a FAM fluorescent linker sequence, and the FAM fluorescent linker sequence includes the nucleotide sequence shown in SEQ ID NO:

4.

3. The primer set according to claim 1 or 2, characterized in that: The 5' end of the forward specific primer F-sense includes a VIC fluorescent linker sequence, and the VIC fluorescent linker sequence includes the nucleotide sequence shown in SEQ ID NO:

5.

4. A kit for detecting the fire blight resistance of apple, characterized in that: The invention comprises the primer set according to any one of claims 1 to 3.

5. The kit according to claim 4, characterized in that: The kit also includes one or more of genomic DNA, KASP working solution, negative control, positive control and water.

6. Use of the primer set according to any one of claims 1 to 3, or one or more of the kits according to claim 4 or 5 in breeding apple varieties resistant to fire blight.

7. A method for detecting the fire blight resistance of apple, characterized in that: The following steps are involved: Extract apple genomic DNA, use the primer set described in any one of claims 1 to 3 to perform PCR amplification and genotyping on the apple genomic DNA, and then determine the fire blight resistance trait of the apple.

8. The method according to claim 7, characterized in that: The PCR amplification program included: pre-denaturation at 95°C for 10 min, denaturation at 95°C for 30 s, annealing at 61°C for 45 s, decreasing 0.6°C in each cycle for 10 cycles, denaturation at 95°C for 30 s, annealing at 55°C for 45 s for 35 cycles.

Images