Molecular marker related to sheep tail fat character and application of molecular marker in sheep breeding

Abstract

The invention provides an application of a molecular marker related to a sheep tail fat deposition character in breeding. According to the invention, PCR amplification and sequence analysis are carried out on a sheep GDF10 gene, an A / T polymorphic site exists at the 614th site of an amplified fragment, an AQP primer pair is further used for detecting polymorphic sites of 795 Hu sheep and establishing a least square model, correlation analysis is carried out on genotypes and tail fat deposition traits, and the genotype and tail fat deposition traits are identified. Finally, it is determined that the amplified GDF10 gene segment can be used as the molecular marker related to the sheep tail fat deposition character. The molecular marker can be used for breeding low-tail fat type sheep in breeding by detecting the molecular marker, AT hybrid type sheep can be selectively reserved to enter a core group for breeding, tail fat deposition of the sheep can be reduced, and economic benefits can be increased.

Description

Technical Field

[0001] The invention belongs to the technical field of molecular markers, and in particular relates to a GDF10 gene fragment as a molecular marker affecting sheep tail fat deposition traits and an application thereof in sheep breeding. Background Art

[0002] Hu sheep is a type of sheep. As a short fat-tailed breed originating in my country, it is widely welcomed by farmers for its high reproductive performance, fast growth, strong adaptability, early sexual maturity, year-round estrus, large lambing, and strong lactation ability. With the development of indoor sheep production systems and changes in people's consumption concepts, excessive deposition of tail fat has limited the commercial value of lambs, and fat tails have become a less popular and less necessary feature. The ratio of tail fat weight to carcass weight is an important indicator affecting carcass quality. Excessive tail fat deposition will reduce feed conversion rate, increase feeding costs, affect livestock meat quality, animal mating and normal movement. Therefore, it is imperative to reduce the deposition of tail fat in Hu sheep.

[0003] GDF10 (growth differentiation factor 10), also known as bone morphogenetic protein 3b (BMP-3b), is a member of the BMP family and an important growth factor protein. The GDF10 gene encodes a secreted ligand of the TGF-β (transforming growth factor-β) superfamily of proteins, which binds to various TGF-β receptors, leading to the recruitment and activation of SMAD family transcription factors that regulate gene expression. The preproprotein encoded by this gene undergoes proteolytic processing to produce homodimeric subunits linked to disulfide bonds, which promotes neural repair after stroke. This protein may also act as a tumor suppressor, and reduced expression of this gene is associated with oral cancer. In addition, this gene is involved in osteogenesis and adipogenesis, plays an inhibitory role in osteoblast differentiation through the SMAD2 / 3 pathway, and plays an inhibitory role in adipogenesis. Studies by Akiyoshi Uezumi et al. have shown that BMP3b is specifically expressed in mesenchymal progenitor cells, and its expression level is significantly reduced during aging or adipogenic differentiation. The study by Tamana RYousof et al. showed that the plasma GDF10 level of children with elevated BMI was significantly reduced (P<0.05), which indicates that the plasma GDF10 level of obese children is low, revealing the potential mechanism leading to childhood obesity. At present, the mechanism of action of the GDF10 gene in sheep tail fat deposition has not been reported, its function is still unclear, and whether the GDF10 gene is related to sheep tail fat deposition is also unclear. The present invention sequences and analyzes the GDF10 gene to explore the association between its different genotypes and the sheep tail fat deposition trait, aiming to provide genetic materials for the genetic improvement of reducing sheep tail fat deposition, and accelerate the breeding process of a new breed of low-tail fat high-quality mutton sheep with independent intellectual property rights. Summary of the invention

[0004] In order to solve the above technical problems, the present invention provides a molecular marker associated with sheep tail fat deposition traits and its application.

[0005] The molecular marker of the present invention is amplified from the sheep GDF10 gene, and its specific nucleotide sequence is shown in SEQ ID NO. 1. By amplifying the DNA sequence of the sheep GDF10 gene and sequencing, the polymorphic site of the GDF10 gene is found, the correlation between different genotypes and the sheep tail fat deposition trait is analyzed, and a detection method for the molecular marker containing the polymorphic site is established, and the molecular marker can be applied to the breeding of new varieties of sheep with reduced tail fat deposition.

[0006] To achieve the above object, the present invention adopts the following technical solutions:

[0007] A molecular marker associated with sheep tail fat deposition traits is used in breeding. The nucleotide sequence of the molecular marker is shown in SEQ ID NO.1, wherein W at the 614 bp position represents A or T. Since the above sequence has an A / T mutation at the 614th base, the A / T polymorphism of the sheep GDF10 gene at this site is caused.

[0008] The application of the primer pair for detecting the molecular marker related to the sheep tail fat deposition trait in sheep breeding, the primer pair comprises an upstream primer and a downstream primer, the nucleotide sequence of the upstream primer is shown in SEQ ID NO.2, and the nucleotide sequence of the downstream primer is shown in SEQ ID NO.3.

[0009] The application of the AQP SNP primer pair for detecting the above-mentioned molecular markers related to the sheep tail fat deposition trait in sheep breeding, the AQP SNP primer pair includes a forward primer for detecting AlleleA, a forward primer for detecting AlleleT and a universal reverse primer, wherein the nucleotide sequence of the forward primer for detecting AlleleA is shown in SEQ ID NO.4, the nucleotide sequence of the forward primer for detecting AlleleT is shown in SEQ ID NO.5, and the nucleotide sequence of the universal reverse primer is shown in SEQ ID NO.6.

[0010] The use of a kit for detecting the molecular markers related to the sheep tail fat deposition trait in sheep breeding, wherein the kit comprises a PCR primer pair or an AQP SNP primer pair for detecting the molecular markers.

[0011] A method for detecting molecular markers associated with sheep tail fat deposition traits, the specific detection method comprising the following steps:

[0012] S1. Amplify sheep genomic DNA using the above-mentioned PCR primer pair, AQP SNP primer pair or a kit containing the above-mentioned primer pair;

[0013] S2. Identify the polymorphic sites of the amplified product obtained in step S1.

[0014] Wherein, in step S2, the above-mentioned typing and identification methods include but are not limited to direct sequencing method, fluorescent probe method, gene chip method, and high-resolution melting curve method.

[0015] The method for detecting molecular markers related to sheep tail fat deposition traits using the above primer pair comprises the following steps:

[0016] a) extracting genomic DNA from sheep blood as a sample, and performing AQP typing using primer pairs with nucleotide sequences as shown in SEQ ID NO.4, SEQ ID NO.5 and SEQ ID NO.6;

[0017] b) After amplification, use the C1000 Touch Thermal Cycler instrument to detect the fluorescent signal and check the typing results.

[0018] The detection method as described above is used in the detection of sheep tail fat deposition traits. By detecting the molecular markers of the present invention in the genomic DNA of the sheep to be tested and analyzing the types of polymorphic sites, the level of sheep tail fat can be determined, and then sheep breeds with less tail fat deposition can be screened out. The tail fat relative to carcass weight of sheep carrying the AT genotype is significantly lower than that of sheep carrying the AA genotype, and the tail fat deposition of sheep carrying the AT genotype is lower than that of sheep carrying the AA and TT genotypes.

[0019] The detection method as described above is used in sheep breeding, wherein the breeding is to select a sheep breed with low tail fat. If the genotype of the sample to be tested is AT, the sheep with this genotype are low tail fat. The tail fat deposition of sheep carrying the AT genotype is lower than that of sheep carrying the AA and TT genotypes, and the genotype selected is AT for breeding.

[0020] The present invention performs PCR amplification and sequencing on the GDF10 gene of Hu sheep, a representative sheep breed, and finds that there is an A / T polymorphic site at the 614th position of the amplified fragment. By detecting the polymorphism of 795 Hu sheep and establishing a least squares model, a molecular marker related to the sheep tail fat deposition trait is determined. The molecular marker can be used for the breeding of sheep with low tail fat deposition trait, providing an effective genetic engineering means for the genetic improvement of the sheep tail fat deposition trait, and has great practical application value.

[0021] The beneficial effects of the present invention are:

[0022] The present invention provides an application of a molecular marker related to the fat deposition trait of the tail of sheep in sheep breeding. The nucleotide sequence of the molecular marker is shown in SEQ ID NO.1, wherein W at the 614 bp position represents A or T, and the tail fat relative carcass weight of sheep carrying the AT genotype is significantly lower than that of the AA genotype; sheep carrying the AT genotype are low-tail-fat sheep, and the AT genotype can be selected during breeding. By detecting the genotype of the polymorphic site, it is possible to effectively identify whether the sheep is of the low-tail-fat type, thereby providing an effective detection means for the selection and breeding of low-tail-fat sheep.

[0023] The present invention also establishes a detection method for molecular marker polymorphic sites related to the sheep tail fat deposition trait, which can determine the genotype of the polymorphic sites of the sheep to be tested, and can be used to select sheep with AA homozygous genes as breeding sheep for breeding, so as to reduce the deposition of tail fat, improve the quality of sheep, and help improve the economic benefits of the breeding industry. BRIEF DESCRIPTION OF THE DRAWINGS

[0024] Figure 1 The figure is an agarose gel electrophoresis diagram of the sheep GDF10 gene fragment used as a molecular marker in the present invention.

[0025] Figure 2 This is the sequencing result of the g.41276013A>T mutation site of the sheep GDF10 gene in the present invention.

[0026] Figure 3 This is the AQP typing result of the amplified fragment of the GDF10 gene of sheep in the present invention. DETAILED DESCRIPTION

[0027] The present invention analyzes the relationship between the single nucleotide polymorphism of the Hu sheep GDF10 gene and the tail fat deposition trait. In addition, the expression level of the GDF10 gene in sheep of different genotypes is also studied. The present invention provides a valuable molecular marker for sheep breeding.

[0028] The following examples are used to further illustrate the present invention, but should not be construed as limiting the present invention. Without departing from the spirit and substance of the present invention, modifications or substitutions made to the present invention all belong to the scope of the present invention.

[0029] Unless otherwise specified, the technical means used in the examples are conventional means well known to those skilled in the art. Unless otherwise specified, the reagents used in the present invention are of analytical grade or above.

[0030] Example 1 Amplification of GDF10 gene

[0031] Using sheep GDF10 gene DNA (GenBank accession number: NC_056078.1) as a template, a pair of primers were designed using Oligo7.0 software: an upstream primer as shown in SEQ ID NO.2 and a downstream primer RR as shown in SEQ ID NO.3. The primer sequences are as follows:

[0032] SEQ ID NO.2: 5'-GCACTACCACAAGCACGAG-3'

[0033] SEQ ID NO.3: 5'-GAGTTACACTGCGAAGTCACC-3'

[0034] Amplification and sequencing of the GDF10 gene

[0035] Genomic DNA was extracted from sheep blood using a DNA submission kit and used as a DNA template for PCR amplification. The total reaction volume for PCR amplification was 35 μL, including 17.5 μL of 2×PCR Master Mix, 1 μL of upstream primer (SEQ ID NO.2) with a concentration of 10 μmol / L, 1 μL of downstream primer (SEQ ID NO.3), 1.4 μL of DNA template, and 14.1 μL of ddH2O. The DNA template was DNA from 9 different sheep plus a mixed sample, a total of 10 samples, and the mixed sample was a mixture of DNA from 9 sheep.

[0036] PCR amplification program: 94°C pre-denaturation for 3 min, 94°C denaturation for 30 s, 56.3°C annealing for 30 s, 72°C extension for 30 s, 35 cycles, and finally 72°C extension for 10 min.

[0037] The PCR amplification reaction products were detected by 1% agarose gel electrophoresis. Figure 1 As shown, wherein, lane M: molecular weight 1500 marker, lanes 1-10: lanes 1-9 are the GDF10 gene amplification results of blood samples of 9 sheep, respectively, and the last lane is the GDF10 gene amplification result of mixed DNA samples of 9 sheep. The amplified PCR fragment was sequenced, and the sequencing result showed that a 789 bp amplified fragment was obtained, and its nucleotide sequence is shown in SEQ ID NO.1, wherein there is a polymorphic site in the fragment, specifically, W at the 614 bp site is A or T, that is, the amplified GDF10 gene fragment (SEQ ID NO.1) has A / T polymorphism at the 614 bp site (see Figure 2 ).

[0038] Among them, SEQ ID NO.1: GCACTACCACAAGCACGAGCTGTGGCCCAG CCCCTTCCGTGCACTGAAGCCTCGGCCAGGCCGCAAGGACCGCAGGAAGAAGGGCCAGGATGTGTTCATGGCCTCCTCACAGGTGCTGGACTTCGATGAGAAGACGATGCAGAAAGCCCGGAAGAAGCAATGGGATGAGCC ACGGGTCTGCTCCCGGAGGTATCTGAAGGTGGACTTCGCGGACATAGGGTGGAATGAGTGGGTCATCTCACCCAAGTCCTTCGACGCCTACTACTGCTCGGGGGCCTGCGAGTTCCCGATGCCCAAGGTAGGGTCGCCCTGCTGTGCTCCGCTCGCTGTCATCTCAGCTCTGCCCTCGTAGGCGAGTCCTTCTGCCTCCTCACTCTGTTCCCTGTCTGTAAGCAGGGATAATAACACCTCCCATCCATCTGAGCCAGAGAATAGCTAGACAGGCATACCCAAATGGCAGCCTGTTGGGTGGATACAACCCACAGATGGATGCTGTCTGGCTGTCCTTTTGAAAGTGTTGCCTTCATAGCACTGGAATTTTAAATCAGAACCTGTCTTCTTTTGCAGAGCAGGAGATCCTTCCTTTCAGGTGTGTGTTTCCACACAGCAAATCWCAGAGGTTGCGTGGACGCTGGCCGTTCCCCATTCCTCCCCCCGCCCCACCCCGCACACAGGTCCAGTCTCTTAAACACCTTCATTGCCAAGGCTCTTCTGGAAATCTGGCTTGGATTTCAGGGCATGGTGTCTGTAACCAGCAGAGCTGGCCTCGGTGACTTCGCAGTGTAACTC。

[0039] DNA sequence homology search and identification:

[0040] The DNA sequence obtained after sequencing was compared with the known physiological function genes published in the GenBank database by BLAST (Basic Local Alignment Search Tool) software on the website of the National Center for Biotechnology Information (NCBI, http: / / www.ncbi.nlm.nih.gov) to identify and obtain the functional information of the DNA sequence. The search results showed that the sequence was 99% homologous to the partial sequence of the sheep GDF10 gene DNA (GenBank accession number: NC_056078.1).

[0041] Example 2 Establishment of genotyping detection method

[0042] 1. First, design the primer sequence

[0043] AQP primer pairs were designed from right to left for the A / T polymorphic site of the amplified fragment sequence in Example 1, so as to be used for specific detection of the polymorphic site. The nucleotide sequence of the AQP primer pairs designed after optimization was:

[0044] Forward primer A1 (SEQ ID NO. 4) for detecting AlleleA: GAAGGTCGGAGTCAACGGATTAGCGTCCACGCAACCTCTGT;

[0045] Forward primer A2 for detecting AlleleT (SEQ ID NO. 5): GAAGGTGACCAAGTTCATGCTAGCGTCCACGCAACCTCTGA;

[0046] Universal reverse primer C (SEQ ID NO. 6): GAGATCCTTCCTTTCAGGTGTGTG TT.

[0047] The above primers were synthesized by Beijing Shenggong Biotechnology Co., Ltd.

[0048] 2. Secondly, quality control of the extracted genomic DNA

[0049] The genomic DNA can be extracted from the sheep's blood using a DNA extraction kit. The extracted genomic DNA is then tested for quality using 1% agarose electrophoresis and Nanodrop2100. Qualified DNA requires: (1) Agarose electrophoresis shows a single DNA band with no obvious diffusion. (2) Nanodrop2100 tests A260 / 280 between 1.8-2.0; A260 / 230 between 1.8-2.0; no obvious light absorption at 270nm. Unqualified DNA requires re-extraction and testing. And according to the AQP of Beijing Jiacheng Biotechnology Co., Ltd. TM The detection technology and genome size are used to calculate the DNA dosage to be 2-50 ng / sample. The extracted genomic DNA is diluted to a concentration of 2-50 ng / μL and used as a DNA template.

[0050] 3. Perform genotyping

[0051] First, the forward primer A1 for detecting AlleleA, the forward primer A2 for detecting AlleleT, and the universal reverse primer C in the AQP primer pair were made into a 100 μmol / L solution, and these primers were mixed with sterile water in a volume ratio of 12:12:30:46 (forward primer A1: forward primer A2: reverse primer C: sterile water) to prepare a primer mixture for use.

[0052] Then use a pipette to add 0.07 μL of primer mixture, 0.5 μL of sterile water, 2.5 μL of HiGeno 2xProbe Mix, and 2 μL of diluted DNA template (2-50 ng / μL) to each well of the 384-well plate. After adding, seal the membrane, shake and centrifuge, and place on the C1000Touch TM PCR amplification was performed on a Thermal Cycler instrument.

[0053] The specific procedures are:

[0054] Pre-denaturation at 95°C for 10 minutes;

[0055] 95℃, 20 seconds (denaturation) - 61℃-55℃, 40 seconds (renaturation & extension), amplification for 10 cycles, reducing 0.6℃ each cycle;

[0056] Amplification was continued for 34 cycles from 95°C, 20 seconds (denaturation) to 55°C, 40 seconds.

[0057] After amplification, use C1000 Touch TM The thermal cycler instrument detects the fluorescence signal at 37°C and checks the typing status. The results of some samples are as follows: Figure 3As shown. With FAM as the horizontal axis and HEX as the vertical axis, each figure in the figure represents a test material, where the blue square near the left side indicates that the site is a homozygous genotype "AA"; the green triangle near the middle indicates that the site is a heterozygous genotype "AT"; the orange dot near the right side indicates that the site is a homozygous genotype "TT".

[0058] 4. Application of the molecular markers of the present invention in association analysis of fat deposition traits in sheep

[0059] A total of 795 Hu sheep were tested for polymorphism, their genotypes were determined, and the least squares model described below was established to conduct association analysis between genotype and fat deposition traits.

[0060] Y ijkl =μ+G i +P j +S k +F l +ε ijkl

[0061] Among them, Yijk is the observed value of tail fat deposition, μ is the overall mean, Gi is the genotype effect, Pj is the batch effect, Sk is the season effect, Fl is the field effect, and εijkl is the random error. It is assumed that εijkl are independent of each other and obey the N(0, σ2) distribution.

[0062] The results of genotype detection showed that among the 795 individuals, there were 384 individuals with AA genotype, 345 individuals with AT genotype, and 66 individuals with TT genotype. The results of the association analysis between genotype and traits are shown in Table 1. Among them, the weight at 180 days of age is the weight before slaughter, the tail fat relative to body weight refers to the ratio of tail fat weight to 180 days of age, and the tail fat relative to carcass weight refers to the ratio of tail fat weight to carcass weight.

[0063] Table 1 Association analysis between sheep GDF10 gene polymorphism and tail fat deposition traits

[0064]

[0065] Note: All data in the table are mean ± standard error. Data in the same column with different letters in the subscript indicate significant differences (P<0.05), and data with the same letters in the subscript indicate no significant differences (P>0.05)

[0066] The results showed that the A>T mutation site at the 614bp of the sequence in the GDF10 gene as shown in SEQ ID NO.1 was significantly correlated with the tail fat deposition trait of sheep. Tail fat deposition requires higher energy costs and feed costs. The tail fat relative body weight and relative carcass weight of sheep carrying the AT genotype are significantly lower than those carrying the AA genotype. And the tail fat deposition of sheep carrying the AT genotype is better than that of sheep carrying the AA and TT genotypes. It shows that the mutation site at the 614bp of the sequence of the GDF10 gene as shown in SEQ ID NO.1 can be used as a potential molecular marker affecting the tail fat deposition trait of Hu sheep. Sheep with the AT genotype can be retained during breeding, which can reduce the deposition of tail fat during the growth of sheep and obtain a superior flock with less tail fat deposition. Selecting the AT genotype for seed preservation during breeding can reduce the deposition of tail fat during the growth of sheep and obtain a superior flock with less tail fat deposition.

Claims

1. Application of a molecular marker related to sheep tail fat deposition traits in sheep breeding, characterized in that: The nucleotide sequence of the molecular marker is shown in SEQ ID NO.1, wherein W at the 614th bp represents A or T, and the mutation leads to the A / T polymorphism of the molecular marker.

2. Use of a primer pair for detecting a molecular marker associated with sheep tail fat deposition traits in sheep breeding, characterized in that: The primer pair includes primer RF and primer RR. The nucleotide sequence of primer RF is shown in SEQ ID NO.2, and the nucleotide sequence of primer RR is shown in SEQ ID NO.

3.

3. Application of an AQP SNP primer pair for detecting molecular markers associated with sheep tail fat deposition traits in sheep breeding, the AQP SNP primer pair comprising a forward primer for detecting AlleleA, a forward primer for detecting AlleleT and a universal reverse primer, wherein: The nucleotide sequence of the forward primer for detecting AlleleA is shown in SEQ ID NO.4, the nucleotide sequence of the forward primer for detecting AlleleT is shown in SEQ ID NO.5, and the nucleotide sequence of the universal reverse primer is shown in SEQ ID NO.

6.

4. Use of a detection kit for detecting molecular markers associated with sheep tail fat deposition traits in sheep breeding, characterized in that: The detection kit comprises a primer pair or an AQP SNP primer pair, wherein the primer pair comprises a primer RF and a primer RR, the nucleotide sequence of the primer RF is shown in SEQ ID NO.2, and the nucleotide sequence of the primer RR is shown in SEQ ID NO.3; The AQP SNP primer pair includes a forward primer for detecting AlleleA, a forward primer for detecting AlleleT and a universal reverse primer, wherein the nucleotide sequence of the forward primer for detecting AlleleA is shown in SEQ ID NO.4, the nucleotide sequence of the forward primer for detecting AlleleT is shown in SEQ ID NO.5, and the nucleotide sequence of the universal reverse primer is shown in SEQ ID NO.

6.

5. A method for detecting molecular markers associated with sheep tail fat deposition traits, characterized in that: The nucleotide sequence of the molecular marker is shown in SEQ ID NO.1, wherein W at position 614 bp represents A or T, and the detection method comprises the following steps: S1, amplifying sheep genomic DNA using the primer pair shown in SEQ ID NO.2 and SEQ ID NO.3 or the AQP SNP primer pair shown in SEQ ID NO.4-6; S2. Perform typing and identification on the polymorphic sites of the amplified product obtained in step S1.

6. The method according to claim 5, characterized in that The typing and identification method in step S2 is a sequencing method, a gene chip method, a fluorescent probe method or a high-resolution melting curve method.

7. The method according to claim 5, characterized in that When using the AQP SNP primer pair for PCR amplification, after the amplification is completed, the C1000 Touch Thermal Cycler instrument is used to detect the fluorescent signal and view the typing results.

8. Application of the method according to any one of claims 5 to 7 in detecting the fat deposition trait in the tail of sheep, for screening out small-tailed sheep breeds with less tail fat deposition, wherein the tail fat relative to carcass weight of sheep carrying the AT genotype is significantly lower than that of sheep carrying the AA genotype.

9. Use of the method according to any one of claims 5 to 7 in sheep breeding.

10. The use according to claim 9, characterized in that: The breeding purpose is to select sheep with low tail fat.

Images