Method for improving catalytic activity of flavanone-3-hydroxylase and application of flavanone-3-hydroxylase in catalytic reaction

Abstract

The invention provides a method for improving catalytic activity of flavanone-3-hydroxylase and application of the flavanone-3-hydroxylase in catalytic reaction, and belongs to the technical field of biology. According to the method for improving the catalytic activity of the flavanone-3-hydroxylase, the flavanone-3-hydroxylase is obtained by mutating a key amino acid of a conserved sequence of wild flavanone-3-hydroxylase. The mutant enzyme is used for catalytic reaction after overexpression, has high catalytic activity under the condition of a high-concentration substrate, overcomes the defect of substrate inhibition existing in wild-type enzyme, and has good industrial application prospects in biosynthesis of flavonoid compounds.

Description

[0001] This application is a divisional application of application number 202311706493.6, application date December 13, 2023, and invention name “A method for improving the catalytic activity of flavanone-3-hydroxylase and its application”. Technical Field

[0002] The invention relates to the field of biotechnology, in particular to a method for improving the catalytic activity of flavanone-3-hydroxylase and an application thereof in a catalytic reaction. Background Art

[0003] Flavonoids are an important class of secondary metabolites of plants. They are a class of compounds derived from 2-phenylchromone as the parent nucleus, that is, derived from C6-C3-C6 as the basic carbon skeleton. Studies have shown that flavonoids have multiple biological activities such as antibacterial, antiviral, anti-tumor, and antioxidant, and are used in the production of medicines or health products.

[0004] Flavanone 3-hydroxylase (F3H) is a key enzyme in the synthesis of flavonoids and belongs to the plant 2-oxoglutarate dependent dioxygenase (2-ODD) family. F3H can catalyze the production of dihydroflavonols from the flavanones of formula I:

[0005]

[0006] Studies have shown that the amino acid sequence and spatial structure of the protein encoded by the F3H gene are highly conserved among different species, and contain typical 2-ketoglutarate and ferrous ion binding domains. With the development of synthetic biology, heterologous expression pathways of flavonoids have been established in microorganisms such as Escherichia coli and Saccharomyces cerevisiae.

[0007] However, in existing studies, F3H mainly plays a catalytic role at a relatively low substrate concentration (about 0.2 g / L), which is not suitable for industrial production requirements. At higher substrate concentrations, the enzyme shows obvious substrate inhibition, resulting in a significant decrease in enzyme activity or even complete disappearance. Therefore, it is necessary to obtain F3H with higher catalytic activity under high substrate concentration conditions to meet the requirements of industrial production of flavonoids. Summary of the invention

[0008] In view of the above problems existing in the prior art, the present invention provides a method for improving the catalytic activity of flavanone-3-hydroxylase and its application in catalytic reactions. The mutant provided by the present invention has higher catalytic activity under the condition of high substrate concentration, overcomes the disadvantage of substrate inhibition existing in the wild-type enzyme, and has good industrial application prospects in the biosynthesis of flavonoid compounds.

[0009] The technical solution of the present invention is as follows:

[0010] 1. The present invention provides a method for improving the catalytic activity of flavanone-3-hydroxylase, which is achieved by performing site-directed mutagenesis on the conservative sequence of wild-type flavanone-3-hydroxylase to obtain a mutant. The flavanone-3-hydroxylase (F3H) mutant is obtained by mutating the key amino acids in the conservative sequence of the wild-type flavanone-3-hydroxylase.

[0011] Furthermore, the wild-type flavanone-3-hydroxylase has an amino acid sequence as shown in SEQ ID NO.1, or has a sequence identity of more than 80% with the amino acid sequence as shown in SEQ ID NO.1, and contains the conservative sequences GKKGGFIVSSHL, DWREIVTYFSYP, DMDQKVVI / VN, SRLSIATFQNPA and MYK / RRKMSKD.

[0012] Furthermore, the F3H mutant is mutated in at least one of the six amino acids, including the third amino acid K in the conservative sequence GKKGGFIVSSHL, the seventh amino acid I in the conservative sequence GKKGGFIVSSHL, the third amino acid R in the conservative sequence DWREIVTYFSYP, the fifth amino acid K in the conservative sequence DMDQKVVI / VN, the tenth amino acid N in the conservative sequence SRLSIATFQNPA, and the second amino acid Y in the conservative sequence MYK / RRKMSKD of the parent F3H amino acid sequence.

[0013] Preferably, the six amino acid sequences are mutated to A, V, K, E, Q and F, respectively.

[0014] 2. The present invention also provides the use of the flavanone-3-hydroxylase (F3H) mutant in catalyzing the synthesis of flavonoids from flavanones, that is, using the flavanone-3-hydroxylase mutant or a recombinant engineered bacterium expressing the flavanone-3-hydroxylase mutant for catalysis.

[0015] Specifically, the method for using the F3H mutant in catalyzing the synthesis of flavonoids comprises the following steps:

[0016] S1. Construction of recombinant engineering bacteria expressing F3H mutant.

[0017] Preferably, the host cell of the recombinant engineered bacteria is Escherichia coli.

[0018] S2. Cultivation of recombinant engineered bacteria containing the F3H mutant.

[0019] Furthermore, the culture process includes seed liquid culture and fermentation culture stages.

[0020] S3. Using flavonoids as substrates, the F3H mutant was used to catalyze the flavonoids to obtain the target product.

[0021] Furthermore, the catalytic process may use a purified F3H mutant enzyme, a crude enzyme solution containing the F3H mutant enzyme, or a recombinant engineered bacterium expressing the F3H mutant.

[0022] Furthermore, the catalytic process can be carried out during the fermentation culture process described in S2, or the catalytic reaction can be carried out after the bacterial cells are collected after the fermentation is completed.

[0023] Furthermore, in the catalytic process, the recombinant engineered bacteria expressing the F3H mutant are added in an amount of 1-50 g / L by wet weight, the substrate is added in an amount of 0.2-10 g / L, Tween 80 is added in an amount of 1-15 g / L, glucose is added in an amount of 5-20 g / L, and ferrous sulfate is added in an amount of 5-50 mg / L.

[0024] Furthermore, in the catalytic process, the reaction pH is 6.0-8.0, the reaction temperature is 25-40° C., and the reaction time is 1-72 h.

[0025] The beneficial technical effects of the present invention are:

[0026] The present invention discloses a method for improving the catalytic activity of flavanone-3-hydroxylase and its application, which improves the inhibition of high-concentration substrate on enzyme activity, so that flavanone-3-hydroxylase can play a catalytic role under high-concentration substrate conditions, which greatly facilitates the biosynthesis of flavonoid compounds. BRIEF DESCRIPTION OF THE DRAWINGS

[0027] Figure 1 is the effect of substrate concentration on the catalysis of compound I and compound II by wild-type F3H;

[0028] Figure 2 is the conversion rate of the catalytic reaction of the F3H mutant to different concentrations of compound I. DETAILED DESCRIPTION

[0029] The present invention is described in detail below in conjunction with the accompanying drawings and embodiments. Obviously, the described embodiments are only a part of the embodiments of the present invention, rather than all the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0030] The formulas of the culture medium and buffer used in the examples are as follows:

[0031] LB medium: yeast powder 5.0 g / L, peptone 10.0 g / L, NaCl 10.0 g / L.

[0032] Fermentation medium: yeast powder 12.0 g / L, peptone 15.0 g / L, Na2HPO4·12H2O 8.9 g / L, KH2PO4 3.4 g / L, (NH4)2SO4 3.3 g / L, MgSO4·7H2O 0.49 g / L, use ammonia water to adjust the pH to 7.0.

[0033] pH 7.0 phosphate buffer solution (200 mM): Na2HPO4·12H2O 67.8 g / L, NaH2PO4·2H2O 0.82 g / L.

[0034] The detection method of flavanone and dihydroflavonol in the following examples is:

[0035] Take 1 mL of reaction solution (containing 0-10 g / L substrate or product), add an equal volume of ethyl acetate, vortex extract 3 times, centrifuge at 8000g for 10 min, and combine the organic phases. After the ethyl acetate evaporates completely, add 1-5 mL of methanol to dissolve all the precipitates, dilute them appropriately, and perform high performance liquid chromatography (HPLC) analysis.

[0036] Agilent 1200 series high performance liquid chromatography, diode array detector, Agilent Eclipse XDB C18 chromatographic column, 4.6mm×150mm. Phase A is water containing 0.5% glacial acetic acid, phase B is acetonitrile, isocratic elution, the ratio of phase A to phase B is 60:40; the flow rate is 0.6mL / min. The column temperature is maintained at 30℃, and the detection wavelength is 280nm.

[0037] Qualitative and quantitative methods: Qualitative analysis is performed based on the retention time and UV absorption spectrum of the standard product; quantitative analysis is performed based on the standard curve of the standard product.

[0038] Example 1: Construction of wild-type flavanone-3-hydroxylase CsF3H expression strain

[0039] The wild-type flavanone-3 hydroxylase CsF3H (amino acid sequence as shown in SEQ ID NO.1) from tea tree (Camellia sinensis) was selected for enzymatic property research. The gene coding sequence of CsF3H was optimized for Escherichia coli codon preference by entrusting Sangon Biotech (Shanghai) Co., Ltd. to obtain the optimized gene coding sequence (DNA sequence as shown in SEQ ID NO.2).

[0040] Restriction sites BamHI and SalI were designed at the upstream and downstream of the gene, respectively, and the whole gene was synthesized. The synthesized gene was subcloned into the BamHI and SalI sites of the vector pET28a to prepare the recombinant plasmid pET-F3H-WT containing the wild-type CsF3H. The recombinant plasmid pET-F3H-WT was transformed into the expression host E. coli BL21 (DE3) to obtain a recombinant E. coli expressing the wild-type flavanone-3-hydroxylase, named F3H-WT.

[0041] Example 2: Analysis of the catalytic activity of wild-type flavanone-3-hydroxylase at different substrate concentrations

[0042] The recombinant E. coli obtained in Example 1 was activated by streaking on a plate, and a single colony was picked into LB medium containing 50 μg / mL kanamycin, and cultured overnight at 37°C and a shaking speed of 200 rpm. Then, the inoculum was transferred to the fermentation medium at a rate of 3%. The culture was carried out at 37°C and 200 rpm for 3 hours, and IPTG (isopropyl-β-D-thiogalactoside) was added at a final concentration of 0.2 mM. The temperature was lowered to 30°C and the culture was continued for about 12 hours.

[0043] After the culture was completed, the cells were collected by centrifugation at 8000 g and washed three times with 50 mM phosphate buffer (pH 7.0). The precipitate was resuspended with phosphate buffer to a wet weight content of 5 g / L. The recombinant E. coli BL21 (DE3) containing only an empty plasmid was subjected to the same operation as a negative control.

[0044] In a 250 mL Erlenmeyer flask, add 50 mL of phosphate buffer to the resuspended bacteria, add FeSO4 with a final concentration of 10 mg / L, glucose with a final concentration of 5 g / L, and Tween 80 with a final concentration of 5 g / L, and then add different concentrations of compound I or compound II, respectively, and catalyze the reaction in a constant temperature shaker at 30°C and 200 rpm for 12 hours.

[0045] The molecular formulas of compound I and compound II are shown below:

[0046]

[0047] The conversion rate was calculated based on the product content after the reaction and the molar ratio of the initially added substrate, and the catalytic efficiency of the recombinant E. coli was analyzed. Figure 1 As shown, when the substrate concentration is low (0.05-0.25 g / L), the conversion rate of F3H-WT to compound I is about 80%, and the product is compound III. The conversion rate to compound II is about 62%, and the product is compound IV.

[0048] The molecular formulas of compound III and compound IV are shown below:

[0049]

[0050] When the substrate concentration was greater than or equal to 0.6 g / L, the recombinant E. coli F3H-WT had no activity against both substrates, showing obvious substrate inhibition.

[0051] Example 3: Construction of a flavanone-3-hydroxylase mutant library

[0052] The F3H gene sequence was amplified by error-prone PCR using Agilent's GeneMOrph.II RandomMUtagenesis Kit. The plasmid pET-F3H-WT was used as a template to design primer pair F3H-F / F3H-R for error-prone PCR.

[0053] The error-prone PCR reaction system includes: 500ng pET-F3H-WT plasmid template, 40mM dNTP Mix1μL, 10×Mutazyme II reaction buffer 5μL, Mutazyme II DNA polymerase 1μL, primer mix 0.5μL, and ddH2O to make up the total volume to 10μL.

[0054] Upstream primer F3H-F:

[0055] CAGCAAATGGGTCGCGGAATGGCTCCAACAACTACATTAACG;

[0056] Downstream primer F3H-R:

[0057] GCTCGAGTGCGGCCGCATTAGGCAAAGATTTCGTCGGTACT.

[0058] The PCR reaction conditions were as follows: pre-denaturation at 95°C for 2 min; denaturation at 95°C for 30 s; annealing at 55°C for 30 s; extension at 72°C for 1 min; and complete extension at 72°C for 10 min, for 30 cycles.

[0059] The PCR product was recovered and purified by gel and then homologously recombined with the pET28a vector linearized by double restriction digestion of BamHI and HindIII. The recombinant vector was constructed using ClonExpress Ultra One Step Cloning Kit from Novozymes. The recombination reaction system was as follows:

[0060] Linearized vector 150ng, purified target gene 100ng, 2×ClonExpress Mix 5μL, ddH2O to make up to a total volume of 10μL. The reaction procedure is: 50℃ for 15min. The recombinant product was transformed into E. coli BL21 (DE3) by heat shock method, and more than 10 4 A random mutation library of 10 clones.

[0061] Transformants from the random mutation library were selected and inoculated into 96-well culture dishes containing 500 μL LB medium. Kanamycin with a final concentration of 50 ng / mL was added to the medium. After culturing at 37°C for 2.5-3 hours, the temperature was lowered to 30°C, and IPTG with a final concentration of 0.4 mM was added. After further culturing for 3 hours, compound II with a final concentration of 0.6 g / L was added and cultured overnight.

[0062] After the incubation, add 10 μL of 10% aluminum chloride solution and 10 μL of 1M sodium acetate solution. After standing at room temperature for 30 minutes, measure the absorbance at 415 nm. An increase in absorbance indicates that the substrate has been converted. After initial screening of more than 8,000 strains in the mutant library, plasmids were extracted and sequenced for positive mutants, and finally 6 different mutants were obtained and sent to Beijing Qingke Biotechnology Co., Ltd. for sequencing.

[0063] By comparing the amino acid sequence with the wild-type CsF3H, it was finally confirmed that 6 different mutations occurred in the F3H gene. The mutated amino acids were K111A, I115V, R129K, K197E, N294Q, and Y324F, and the corresponding strains were named F3H-K111A, F3H-I115V, F3H-R129K, F3H-K197E, F3H-N294Q, and F3H-Y324F.

[0064] Example 4: Verification of the catalytic ability of the CsF3H mutant

[0065] The recombinant strain obtained by the initial screening was subjected to a catalytic reaction according to the method described in Example 2, using 0.5-10 g / L of compound I as a substrate. After the catalytic reaction was completed, the conversion rate was detected and calculated according to the method described in Example 2. The calculation results are as follows: Figure 2As shown in the figure, all mutants showed activity in 0.6 g / L substrate (the wild type was inactive), among which F3H-K111A and F3H-K197E were still active at a substrate concentration of 10 g / L.

[0066] Example 5: Analysis of conserved sequences of flavanone-3-hydroxylase

[0067] The position-specific iterative (PSI)-BLAST tool provided by the NCBI website (https: / / www.ncbi.nlm.nih.gov / ) was used to input the amino acid sequence of CsF3H for Blast to search for homologous proteins of CsF3H. The top 100 amino acid sequences with high sequence consistency were downloaded, and the conserved sequences of F3H from different sources were analyzed using the online sequence alignment website ClustalW (http: / / www.genome.jp / tools-bin / clustalw) and default parameters.

[0068] After analysis, the 100 selected F3H amino acid sequences from different sources have more than 80% amino acid sequence identity and multiple conserved sequence regions. And the CsF3H mutation sites K111A, I115V, R129K, K197E, N294Q, and Y324F are all located in the conserved sequence region of F3H. Among them, K111 and I115 belong to the third and seventh amino acids of the conserved sequence GKKGGFIVSSHL, respectively; R129 belongs to the third amino acid of the conserved sequence DWREIVTYFSYP; K197 belongs to the fifth amino acid of the conserved sequence DMDQKVVI / VN; N294 belongs to the tenth amino acid of SRLSIATFQNPA; Y324 belongs to the second amino acid of MYK / RRKMSKD. And the above mutation sites are highly conserved in the 100 selected F3H amino acid sequences from different sources.

[0069] Example 6: Verification of the catalytic ability of other flavanone-3-hydroxylase mutants

[0070] Flavanone-3-hydroxylases PcF3H (GenBank: Q7XZQ7.1) and ZmF3H (GenBank: AAA91227.1) from parsley Petroselinum crispum and corn Zea mays were selected for mutation verification, and the sites of the conserved sequences corresponding to K111 and K197 in Example 5 were selected for site-directed mutagenesis, mutated to A and E, respectively, and their DNA coding sequences were codon optimized.

[0071] The optimized DNA coding sequences are shown in SEQ ID NO.3 and SEQ ID NO.4, respectively. The above genes were synthesized and subcloned into the BamHI and SalI restriction sites of the pET28a vector by entrusting Sangon Biotech (Shanghai) Co., Ltd. The recombinant plasmids were transformed into the expression host E. coli BL21 (DE3) to obtain recombinant E. coli PcF3H-WT, PcF3H-M, ZmF3H-WT and ZmF3H-M expressing wild-type flavanone-3-hydroxylase and mutants.

[0072] The above recombinant strain was subjected to catalytic reaction according to the method described in Example 2, using 5 g / L of compound I as substrate. After the catalytic reaction was completed, detection and conversion rate were calculated according to the method described in Example 2, and the calculation results are shown in Table 1 below.

[0073] Table 1

[0074] PcF3H-WT PcF3H-M ZmF3H-WT ZmF3H-M Conversion rate (%) 0 35.3±1.2 0 42.1±3.6

[0075] As can be seen from Table 1, at a substrate concentration of 5 g / L, strains PcF3H-WT and ZmF3H-WT expressing wild-type flavanone-3-hydroxylase had no catalytic activity towards the substrate; whereas strains PcF3H-M and ZmF3H-M expressing flavanone-3-hydroxylase mutants had higher conversion activity.

[0076] Although the embodiments of the present invention have been disclosed as above, they are not limited to the applications listed in the specification and implementation modes, and can be fully applicable to various fields suitable for the present invention. For those familiar with the art, for those of ordinary skill in the art, various changes, modifications, substitutions and variations can be made to these embodiments without departing from the principle and spirit of the present invention. Therefore, without departing from the general concept defined by the claims and the scope of equivalents, the present invention is not limited to specific details.

Claims

1. A method for improving the catalytic activity of flavanone-3-hydroxylase, characterized in that: The method is achieved by performing site-directed mutagenesis on the conservative sequence of wild-type flavanone-3-hydroxylase to obtain a mutant; The amino acid sequence of the wild-type flavanone-3-hydroxylase is the amino acid sequence shown in SEQ ID NO.1 in the sequence table and contains the conservative sequence GKKGGFIVSSHL; The mutant is mutated at the seventh amino acid I in the conservative sequence GKKGGFIVSSHL of flavanone-3-hydroxylase; the amino acid sequence is mutated to V.

2. Use of the flavanone-3-hydroxylase mutant obtained according to claim 1, characterized in that: The mutant is used for catalyzing the synthesis of dihydroflavonols from flavanones.

3. The use according to claim 2, characterized in that: The catalytic process comprises the following steps: S1. constructing a recombinant engineering bacterium expressing the flavanone-3-hydroxylase mutant; S2, cultivation of recombinant engineering bacteria containing flavanone-3-hydroxylase mutants; S3. Using flavanone as substrate, a flavanone-3-hydroxylase mutant was used to catalyze the conversion of flavanone into dihydroflavonol.

4. The use according to claim 3, characterized in that: The flavanone-3-hydroxylase added in step S3 may be in the form of a purified mutant enzyme, a crude enzyme solution containing a flavanone-3-hydroxylase mutant enzyme, or a recombinant engineered bacterium expressing a flavanone-3-hydroxylase mutant.

5. The use according to claim 3, characterized in that: In the catalytic process described in step S3, the recombinant engineering bacteria expressing the flavanone-3-hydroxylase mutant are added in an amount of 1-50 g / L by wet weight, the substrate is added in an amount of 0.2-10 g / L, Tween 80 is added in an amount of 1-15 g / L, glucose is added in an amount of 5-20 g / L, and ferrous sulfate is added in an amount of 5-50 mg / L.

6. The use according to claim 3, characterized in that: In the catalytic process described in step S3, the reaction pH is 6.0-8.0, the reaction temperature is 25-40° C., and the reaction time is 1-72 h.

Images