Composition for treating ischemic disease comprising neural precursor cells as active ingredient

Abstract

The invention provides a composition for treating ischemic diseases or neuroinflammatory diseases. The polysialic acid nerve cell adhesion molecule-positive nerve precursor cell utilized in the present invention is used to promote angiogenesis in injected tissue and inhibit inflammatory response. According to the present invention, the anti-polysialic acid nerve cell adhesion molecule-positive nerve precursor cell can be simply separated by using the anti-polysialic acid nerve cell adhesion molecule-antibody, and compared with the mesenchymal stem cell, the anti-polysialic acid nerve cell adhesion molecule-positive nerve precursor cell has excellent angiogenesis and verification inhibitory activity; therefore, the compound can be usefully used as an effective therapeutic composition for ischemic diseases caused by vascular injury and nerve injury diseases caused by inflammation. Moreover, the secretory proteome of the neural precursor cells according to the present invention not only reduces ischemic injury sites but also restores neurological functions, and thus can be used as a therapeutic agent for degenerative nervous system diseases such as nerve injury diseases caused by ischemic diseases and inflammation.

Description

[0001] The present application is a divisional application of the invention patent application No. 201580034917.6 filed on June 26, 2015, entitled “Composition for treating ischemic diseases or neuroinflammatory diseases comprising neural precursor cells or their secretory proteome as an effective ingredient”. [Technical field]

[0002] The present invention relates to a neural precursor cell or a composition for treating ischemic diseases or neuroinflammatory diseases, comprising a secretome thereof as an effective component. [Background technology]

[0003] Stem cells are considered promising candidates for the treatment of a variety of diseases because of their multi-differentiation ability. For example, mesenchymal stem cells (MSCs) have the characteristics of being easily obtained and isolated, promoting angiogenesis, and inhibiting inflammation, etc. (Caplan, AI, & Dennis, JE (2006). Journal of Cellular Biochemistry, 98, 1076-1084). These characteristics of mesenchymal stem cells are applied to the study of treating human diseases. According to recent studies, mesenchymal stem cells play a role in tissue recovery in many animal models and human clinical treatments (Chen, J., Li, Y., Katakowski, M., et al. (2003). Journal of Neuroscience Research, 73, 778-786; Kopen, GC, Prockop, DJ, & Phinney, DG (1999). Proceedings of the National Academy of Sciences, 96, 10711-10716). Some reports mentioned the ability of mesenchymal stem cells to differentiate into neural series including neurons (Bae, KS, Park, JB, Kim, HS, Kim, DS, Park, DJ, & Kang, SJ (2011). Yonsei Medical Journal, 52, 401-412) and astrocytes (Kopen, GC, Prockop, DJ, & Phinney, DG (1999). Proceedings of the National Academy of Sciences, 96, 10711-10716) in vitro, but there was no clear evidence of the functions of these differentiated cells in vivo. The beneficial effects of mesenchymal stem cells are that they are induced by a paracrine mechanism rather than by cell replacement, and thus, transplantation of mesenchymal stem cells may have a temporary and limited effect rather than long-lasting improvement (Cho, SR, Kim, YR, Kang, HS, et al. (2009). Cell Transplantion, 18, 1359-1368).

[0004] On the contrary, embryonic stem cells (ESCs) can be differentiated into all specific cell forms derived from the three embryonic germ layers, and have a strong self-regeneration ability. It is worth noting that the neural precursor cells (NPCs) derived from embryonic stem cells are preferably differentiated into cells of a specific form of the neural series including neurons, astrocytes and oligodendrocytes, and can therefore be regarded as a cell source for brain tissue recovery. These cells also secrete some factors that promote the survival and proliferation of endogenous neural precursor cells (Capone, C., Frigerio, S., Fumagalli, S., et al. (2007). PLoS One, 7, e373). However, there is still no mention of how the neural precursor cells differentiated from embryonic stem cells or the culture fluid of neural precursor cells play a role in improving function after completing the disease model transplantation.

[0005] Throughout this specification, reference is made to a number of papers and patent documents, and their citations are indicated. The disclosures of the cited papers and patent documents are all incorporated into this specification as references, thereby more clearly illustrating the level of the technical field to which the present invention belongs and the content of the present invention. [Summary of the invention]

[0006]

Technical issues

[0007] The inventors have conducted in-depth research to develop a fundamental treatment method for ischemic diseases or neuroinflammatory diseases. As a result, when neural progenitor cells expressing polysialic acid neural cell adhesion molecule (PSA-NCAM, poly-sialylated neural cell adhesion molecule) as a neural adhesion molecule on the surface are injected into the lesion, angiogenesis is promoted and inflammatory reactions are inhibited, thereby effectively treating ischemic diseases caused by vascular damage and damage to neural tissue caused by inflammation, thereby completing the present invention. Therefore, as an embodiment different from stem cell transplantation, the ischemic damage site is reduced and the nerve function is restored by administering to the lesion site of the neural progenitor cell secretory protein group, thereby effectively treating degenerative nervous system diseases such as ischemic diseases and neural damage diseases caused by inflammation, thereby completing the present invention.

[0008] Another object of the present invention is to provide a composition for treating ischemic diseases or neuroinflammatory diseases.

[0009] Another object of the present invention is to provide a method for treating ischemic diseases or neuroinflammatory diseases.

[0010] Still another object and advantage of the present invention will be further apparent from the following detailed description of the invention, claims and drawings.

[0011]

Solution to the problem

[0012] According to one embodiment of the present invention, the present invention provides a composition for treating ischemic diseases or neuroinflammatory diseases, comprising polysialic acid neural cell adhesion molecule-positive neural progenitor cells as an effective ingredient.

[0013] According to still another embodiment of the present invention, the present invention provides a method for treating ischemic diseases or neuroinflammatory diseases, comprising the step of administering a composition comprising polysialic acid neural cell adhesion molecule-positive neural precursor cells as an effective ingredient to an individual in need thereof.

[0014] According to the present invention, the composition of the present invention restores the blood vessels of ischemic tissues or inhibits inflammatory reactions in individuals suffering from ischemic diseases or neuroinflammatory diseases, thereby inhibiting the development of the above symptoms or removing or alleviating the above symptoms. In addition, the composition of the present invention can also be used as a therapeutic composition for ischemic diseases or neuroinflammatory diseases due to its own characteristics, and can also be administered simultaneously with other anti-ischemic / anti-inflammatory compositions as a therapeutic adjuvant for these diseases. Here, the terms "treatment" or "therapeutic agent" used in this specification include the meaning of "therapeutic adjuvant" or "therapeutic adjuvant".

[0015] According to the present invention, the composition of the present invention significantly increases the expression of angiopoietin-1, which is an angiogenesis inducing factor, and greatly increases the number of blood vessels and the concentration of microvessels at the administration (or transplantation) site. In addition, the composition of the present invention can be used as an effective ischemic disease therapeutic composition for restoring blood flow by restoring vascular tissue or increasing the number of blood vessels in individuals with reduced blood flow due to the disappearance of vascular tissue, lack of angiogenesis, or formation of abnormal blood vessels.

[0016] According to the present invention, the composition of the present invention inhibits the activation of reactive microglia and astrocytes in the administered (or transplanted) neural tissue. Microglia are cells that perform primary immune functions in the central nervous system. Unlike normal microglia, activated microglia actively perform phagocytosis and achieve cell proliferation, and generate inflammatory mediators by expressing cytokines such as TNF-α, IL-1β and IL-6, chemokines, inducible nitric oxide synthase (iNOS), cyclooxygenase-2 (COX-2), and other genes. Activated astrocytes also secrete IL-6, TGF-β, LIF and IL-1, which are inflammatory cytokines. These secreted cytokines reactivate microglia and astrocytes, thereby worsening the internal environment of the tissue. Furthermore, the composition of the present invention for suppressing the activation of microglia and astrocytes can effectively prevent damage to nerve tissue caused by inflammatory response.

[0017] According to one example of the present invention, the composition for treating ischemic diseases or neuroinflammatory diseases of the present invention is used to increase the expression of angiopoietin-1.

[0018] The term "increased expression" used in this specification means that the expression of a gene or protein is significantly increased to a detectable degree different from the normal state, and more specifically, the expression level is 130% or more different from the control group.

[0019] According to one embodiment of the present invention, the composition for treating ischemic diseases or neuroinflammatory diseases of the present invention is used to inhibit the activation of glial cells or astrocytes.

[0020] The term "inhibition of activation" as used in this specification refers to the inhibition of in vivo deformation that causes a decrease in the number, function and activation of glial cells or astrocytes, for example, it refers to the inhibition of a phenomenon in which the expression of specific markers of these cells (e.g., CD68 or GFAP) is significantly reduced or the expression is undetectable or exists at an unconscious level.

[0021] According to one embodiment of the present invention, the polysialic acid neural cell adhesion molecule-positive neural progenitor cells used in the present invention are isolated from neural plexus differentiated from totipotent stem cells.

[0022] According to the present invention, the polysialic acid neural cell adhesion molecule-positive neural progenitor cells used in the present invention can be isolated from a neural plexus differentiated from totipotent stem cells by neural differentiation stimulation using an anti-polysialic acid neural cell adhesion molecule antibody.

[0023] According to another embodiment of the present invention, the present invention provides a composition for treating ischemic diseases or neuroinflammatory diseases, comprising the secretome of neural precursor cells as an effective ingredient.

[0024] According to another embodiment of the present invention, there is provided a method for treating ischemic diseases or neuroinflammatory diseases, comprising the step of administering a composition comprising the secretome of neural precursor cells as an effective ingredient to an individual in need thereof.

[0025] The term "secretome of neural precursor cells" (Secretome) used in this specification refers to a collection of proteins secreted from neural precursor cells to the outside (culture medium) during the process of culturing neural precursor cells.

[0026] According to one embodiment of the present invention, the neural precursor cells suitable for preparing the secretome of the present invention are differentiated into totipotent stem cells.

[0027] According to one embodiment of the present invention, the neural progenitor cells are neural progenitor cells in a neural rosette step formed by differentiating pluripotent stem cells (eg, embryonic stem cells or induced pluripotent stem cells) into neural series cells.

[0028] According to an example of the present invention, the neural progenitor cells are polysialic acid neural cell adhesion molecule-positive neural progenitor cells.

[0029] According to another embodiment of the present invention, the neural progenitor cells are polysialic acid neural cell adhesion molecule-negative neural progenitor cells.

[0030] The polysialic acid neural cell adhesion molecule-positive or -negative neural progenitor cells can be isolated from a neural plexus differentiated from totipotent stem cells by neural differentiation stimulation using an anti-polysialic acid neural cell adhesion molecule-antibody.

[0031] According to one embodiment of the present invention, the cell culture fluid obtained by culturing neural progenitor cells in an animal cell culture medium contains the secretory proteome. That is, the composition of the present invention may include a culture fluid of neural progenitor cells containing the secretory proteome of neural progenitor cells.

[0032] According to one example of the present invention, after culturing neural progenitor cells in a serum-free animal cell culture medium containing ITS (insulin / transferrin / selenium) and basic fibroblast growth factor (bFGF, basic fibroblast growth factor), the cell culture fluid of the neural progenitor cells can be obtained by removing the cells. In the above-mentioned culturing process, neural progenitor cells that have been cultured through generations can be used, for example, neural progenitor cells that have been cultured through generations (for example, more than 4 generations) in an animal cell culture medium containing basic fibroblast growth factor supplemented with N2, B-27 and / or Gem21.

[0033] The cells in the culture medium can be removed by using a common cell separation method such as centrifugation or filtration.

[0034] The animal cell culture medium is not limited as long as it is a common culture medium used in the process of culturing neural precursor cells, and for example, DMEM / F12 can be used.

[0035] According to one embodiment of the present invention, the neural progenitor cells are differentiated from human induced pluripotent stem cells, and the secretory proteome of the neural progenitor cells includes the following proteins: Agrin, Annexin A5, Basigin (BSG), Biglycan, Calponin-3, Coactosin-like protein, Cofilin-1, Collagen α-2, Cullin-3, Destrin, Dystroglycan, Ephrin-B2, Exportin-2, Ezrin, Fibronectin, Fibulin-1, Frizzled-related protein, Galectin-3 binding protein protein), Granulins, Growh / differentiation factor 11, Haptoglobin, Hemopexin, High mobility group protein B2, Hornerin, Importin-9, Insulin-like grwoth factor-binding protein 2, Lupus La protein, Macrophage migration inhibitory factor, Midkine, Moesin, Neuropilin 2, Pleiotrophin, Profilin-1, Protein DJ-1, Radixin, Secreted frizzled-related protein 2 protein-2), septin-11, talin-1, testican, thymopoietin, transgelin-3 and vimentin.

[0036] According to one embodiment of the present invention, the neural progenitor cells are differentiated from human embryonic stem cells, and the secretory proteome of the neural progenitor cells includes the following proteins: Agrin, Annexin A2, Attractin, Biglycan, Ceruloplasmin, Cofilin-1, Collagen α-1, Coronin-1X, Dermicidin, DERP12, Ephrin-B3, Exostosin-2, Ezrin, Gelatin-3 binding protein, Granulins, Growh / differentiation factor 11, Haptoglobin, Hemopexin, High-speed swimming group protein B2, Hornerin, Insulin-like growth factor-binding protein 2, 2), lupus La protein, Midkine, Moesin, Multiple epidermal growth factor-like domains protein 8, Nidogen-1, Parathymosin, Profilin-2, Protein DJ-1, Secretory frizzled-related protein-2, Secretogranin, Talin-1, Thymosin beta-4, Transforming growth factor-beta-induced protein ig-h3 (TGFBI), Transgelin and Vimentin.

[0037] Hereinafter, the contents commonly applicable to the composition and the treatment method of the present invention as described above will be described.

[0038] The term "stem cell" used in this specification is a general term for undifferentiated cells in the steps before differentiation into cells that form tissues, and has the ability to differentiate into specific cells according to specific differentiation stimuli (environment). Unlike cells that have completed differentiation and have stopped cell division, stem cells are characterized by being able to generate (self-renewal) cells identical to themselves through cell division and having the following differentiation plasticity, that is, if a differentiation stimulus is applied, they differentiate into specific cells, and this differentiation can also differentiate into a variety of cells according to other environments or other differentiation stimuli.

[0039] The stem cells used in the present invention are pluripotent stem cells, i.e., they can proliferate indefinitely in vitro and differentiate into a variety of cells derived from all three germ layers (ectoderm, mesoderm and endoderm). More specifically, the pluripotent stem cells are embryonic stem cells, induced pluripotent stem cells (iPSCs, induced pluripotent stem cells), embryonic germ cells or embryonic carcinoma cells.

[0040] Embryonic stem cells are derived from the inner cell mass (ICM) of the blastoderm, and embryonic germ cells are derived from the primordial germ cells of the gonadal ridge at 5 to 10 weeks of age.

[0041] Induced pluripotent stem cells are a type of fully differentiated stem cells artificially prepared by inserting a specific genetic gene that confers pluripotency from a non-fully differentiated cell (e.g., somatic cell). Induced pluripotent stem cells are the same as fully differentiated stem cells (e.g., embryonic stem cells) in terms of stem cell genetic gene and protein expression, chromosome methylation, doubling time, embryoid formation, teratoma formation, viable chimera formation, hybridization, and differentiation.

[0042] The term "neural rosette" refers to a neural stem cell in the initial step of the neural differentiation process of human embryonic stem cells, and the neural rosette has a cylindrical radial morphology. The neural rosette is formed by cells expressing initial neuroectodermal markers such as Pax6 and Sox1, and can differentiate into neurons and glial cells. The neural differentiation stimulation can be achieved by conventional implementation methods in the art, for example, by serum-free culture medium (Tropepe V et al., Neuron. 30: 6578 (2001)), fibroblast growth factors (FGFs, fibroblast growth factors), extracellular factors (Wnt) and retinoic acid (RA, retinoic acid) and other morphogens (morphogens) treatment (Ying QL et al. Nat Biotechnol. 21: 183186 (2003)), but is not limited thereto.

[0043] The above-mentioned antibody can use polyclonal antibody or monoclonal antibody. Antibodies against polysialic acid neural cell adhesion molecules can be prepared by conventional embodiments of the present technical field, for example, by fusion method (Kohler and Milstein, European Journal of Immunology, 6: 511-519 (1976)), recombinant DNA method (U.S. Patent No. 4,816,56) or phage antibody library method (Clackson et al, Nature, 352: 624-628 (1991) and Marks et al, J. Mol. Biol., 222: 58, 1-597 (1991)). The general process for preparing antibodies is described in detail in Harlow, E. and Lane, D., Using Antibodies: A Laboratory Manual, Cold Spring Harbor Press, New York, 1999; Zola, H., Monoclonal Antibodies: A Manual of Techniques, CRC Press, Inc., Boca Raton, Florida, 1984; and Coligan, CURRENT PROTOCOLS IN IMMUNOLOGY, Wiley / Greene, NY, 1991, which are incorporated herein by reference. For example, the preparation of hybridoma cells for producing monoclonal antibodies can be achieved by fusing non-apoptotic cell lines with antibody-producing lymphocytes. The techniques required in this process are well known to those skilled in the art and can be easily achieved. Polyclonal antibodies can be obtained by injecting polysialic acid neural cell adhesion molecule antigens into suitable animals, collecting antiserum from the animals, and separating antibodies from the antiserum using known affinity techniques.

[0044] In this specification, the term "antibody" used when referring to polysialic acid neural cell adhesion molecule is a specific antibody against polysialic acid neural cell adhesion molecule, and specifically binds to polysialic acid neural cell adhesion molecule protein, including not only complete antibody forms, but also antigen binding fragments of antibody molecules. The completed antibody has a structure of 2 full-length light chains and 2 full-length heavy chains, each light chain is connected to the heavy chain in the form of a disulfide bond, and the antigen binding fragment of the antibody molecule, as a fragment with antigen binding function, includes Fab, F(ab'), F(ab')2 and Fv.

[0045] To isolate polysialic acid neural cell adhesion molecule-positive neural precursor cells using antibodies, fluorescence-activated cell sorters (FACS), magnetic activated cell sorters (MACS) and complement-mediated lysis methods can be used.

[0046] The term "treatment" as used in this specification refers to: (a) inhibiting the development of a disease, condition or symptom; (b) alleviating a disease, condition or symptom; or (c) removing a disease, condition or symptom. The composition of the present invention plays a role in inhibiting, removing or alleviating the development of symptoms of ischemic diseases or neuroinflammatory diseases. In addition, the composition of the present invention can also be used as a therapeutic composition for ischemic diseases or neuroinflammatory diseases due to its own characteristics, and can also be administered simultaneously with other anti-ischemic / anti-inflammatory compositions as a therapeutic adjuvant for these diseases. Here, the terms "treatment" or "therapeutic agent" used in this specification include the awareness of "therapeutic adjuvant" or "therapeutic adjuvant".

[0047] The term "ischemic disease" used in this specification refers to a disease in which blood flow is reduced due to blood leakage, embolism, infarction, etc. associated with vascular damage, thereby causing necrosis of tissues whose blood supply is cut off.

[0048] According to one embodiment of the present invention, the ischemic disease that can be treated by the composition of the present invention is selected from the group consisting of ischemic heart disease, myocardial infarction, angina pectoris, lower limb artery ischemic disease, distal limb ischemic disease and ischemic cerebrovascular disease.

[0049] The term "ischemic heart disease" as used in this specification refers to a disease caused by a reduction in blood flow to the heart muscle due to damage, stenosis or blockage of the coronary arteries supplying blood to the heart. More specifically, the ischemic heart disease that can be treated by the composition of the present invention is selected from the group consisting of angina pectoris, myocardial infarction and heart failure.

[0050] The term "ischemic cerebrovascular disease" used in this specification refers to a disease in which brain tissue is damaged and cannot receive blood flow due to cerebrovascular damage, cerebrovascular stenosis or blockage. More specifically, the ischemic cerebrovascular disease is ischemic stroke.

[0051] The term "neuroinflammatory disease" used in this specification refers to a disease caused by damage to neural tissue due to an inflammatory response.

[0052] According to one example of the present invention, the neuroinflammatory disease that can be treated by the composition of the present invention is selected from the group consisting of Alzheimer's disease, Parkinson's disease, Huntington's disease, muscular dystrophy, Creutzfeldt-Jakob disease, multiple sclerosis, amyotrophic lateral sclerosis, diffuse Lewy body disease, leukoencephalitis, temporal lobe epilepsy and inflammatory spinal cord injury.

[0053] The term "administering" or "administering" used in this specification means that the same amount of the composition of the present invention is formed in the body of the subject by directly administering the therapeutically effective amount of the composition of the present invention to the subject. In addition, the term "administering" includes injecting the active ingredient of the present invention (polysialic acid neural cell adhesion molecule-positive neural progenitor cells or the secretory protein group of neural progenitor cells) into the lesion site, so the term "administering" and "injecting" are synonymous.

[0054] The "therapeutically effective amount" of the composition refers to the amount of the extract sufficient to provide a therapeutic effect or a preventive effect to the individual to whom the composition is to be administered, and the above-mentioned "therapeutically effective amount" includes a "preventive effective amount". The term "individual" used in this specification includes humans, mice, rats, guinea pigs, dogs, cats, horses, cows, pigs, monkeys, chimpanzees, baboons or macaques without limitation. Specifically, the individual of the present invention is a human.

[0055] When the composition of the present invention is prepared as a pharmaceutical composition, the pharmaceutical composition of the present invention includes a pharmaceutically acceptable carrier. The pharmaceutically acceptable carrier contained in the pharmaceutical composition of the present invention is usually used as a preparation, including lactose, glucose, sucrose, sorbitol, mannitol, starch, gum arabic, calcium phosphate, alginate, galactose agglutinin, calcium silicate, microcrystalline cellulose, polyvinyl pyrrolidone, cellulose, water, syrup, methylcellulose, methyl hydroxybenzoate, propyl hydroxybenzoate, talc, magnesium stearate, mineral oil, saline, phosphate buffered saline (PBS, phosphate buffered saline) or culture medium, but is not limited thereto.

[0056] In addition to the above ingredients, the pharmaceutical composition of the present invention may also include lubricants, wetting agents, sweeteners, flavoring agents, emulsifiers, suspending agents, and preservatives. Suitable pharmaceutically acceptable carriers and preparations are described in detail in Remington's Pharmaceutical Sciences (19th ed., 1995).

[0057] The pharmaceutical composition of the present invention can be administered orally or parenterally, specifically, parenterally, more specifically, intramuscularly, intracerebroventricularly, intrathecally, or intravascularly.

[0058] The appropriate dosage of the pharmaceutical composition of the present invention can be prescribed in various ways according to factors such as the formulation method, administration method, patient's age, weight, gender, morbidity, diet, administration time, administration route, excretion rate and reaction sensitivity. Based on adults, the common dosage of the pharmaceutical composition of the present invention is 10 2 -10 10 cell.

[0059] The pharmaceutical composition of the present invention is formulated using a pharmaceutically acceptable carrier and / or excipient according to a method that can be easily implemented by a person skilled in the art to which the present invention belongs, so that it can be prepared in a unit volume form or in a manner filled in a large container. In this case, the dosage form can be a solution, suspension, syrup or emulsion in an oil medium or an aqueous medium, and can also be an extract, powder, powder, granule, tablet or capsule form, and also includes a dispersant or stabilizer.

[0060] [Effects of the Invention]

[0061] The following summary describes the features and advantages of the present invention.

[0062] (a) The present invention provides a composition for treating ischemic diseases or neuroinflammatory diseases.

[0063] (b) The polysialic acid neural cell adhesion molecule-positive neural progenitor cells used in the present invention are used to promote angiogenesis in the injected tissue and inhibit inflammatory response. The polysialic acid neural cell adhesion molecule-positive neural progenitor cells can be easily isolated using anti-polysialic acid neural cell adhesion molecule-antibodies, and exhibit excellent angiogenesis and anti-inflammatory activity compared to mesenchymal stem cells, so that they can be usefully used as an effective therapeutic composition for ischemic diseases caused by vascular damage and nerve damage diseases caused by inflammation.

[0064] (c) The secretory proteome of the neural progenitor cells of the present invention not only reduces the ischemic damage site but also restores nerve function, and thus can be used as a therapeutic agent for degenerative nervous system diseases such as nerve damage diseases caused by ischemic diseases and inflammation.

Brief Description of the Drawings

[0065] Figure 1 shows the transplantation of NPCPSA-NCAM+ Figure 3 shows the reduction of infarct area in rat cerebral ischemia treated with mesenchymal stem cells. Figure 1a Schematic diagram showing the experimental plan. One day after middle cerebral artery occlusion (pMCAo), experimental animals were randomly administered NPC PSA-NCAM+ , mesenchymal stem cells or phosphate-buffered saline (n=10, respectively). The experimental animals were sacrificed 26 days after transplantation, and the brain tissues were subjected to immunohistochemical analysis. Figure 1b To show that mesenchymal stem cell transplantation and NPC in the rat middle cerebral artery occlusion model PSA-NCAM+ Graph showing the effect of transplantation on infarct size 26 days after transplantation. *P<0.05 and **P<0.01, respectively, compared to the phosphate-buffered saline group. Figure 1c To show the administration of phosphate buffered saline, NPC PSA-NCAM+ Figures are representative images of rats 26 days after transplantation of mesenchymal stem cells or mesenchymal stem cells.

[0066] Figure 2 shows the transplantation of NPC PSA-NCAM+ Figure 2 shows the improvement of mobility in a rat stroke model. Figure 2a ), forelimb air step test ( Figure 2b ), asymmetric test ( Figure 2c )、Balance beam test( Figure 2d ), grasping and traction test ( Figure 2e ) and modified neurological score ( Figure 2f ). The test values ​​are expressed as ± standard error. Compared with the phosphate-buffered saline group, *P<0.05, **P<0.01 and ***P<0.001, respectively.

[0067] Figure 3 shows the NPC survival PSA-NCAM+ Figure 1. Encoding and differentiation into rat brain tissue. Figure 3a The infarct site is shown. PSA-NCAM+ The survival and proliferation of cells were tested. Ki67 (green) or DCX (red) positive cells were detected in rat cerebral ischemia. Scale bar: 500 μm. Figure 3b for Figure 3a High magnification of the body. Scale bar: 200 μm. Figure 3 shows NPCs expressing hNu (green) and DCX (red) simultaneously. PSA-NCAM+ Image of a row of cells, many transplanted NPCs PSA-NCAM+ The cells are hNu positive, which shows that NPC PSA-NCAM+ The cells have excellent survival rate and survival rate in damaged brain tissue. Scale bar: 20μm. Figure 3dTo show that some proliferated Ki67 + HkD - Figure 3. Scale bar: 200 μm.

[0068] exist Figure 3b From the left are the graphs of DCX / DAPI, Ki67 / DAPI, DCX / Ki67 / DAPI, Tuj1 / DAPI, and Nestin / Ki67 / DAPI. Figure 3c Starting from the left and going clockwise are the images of DAPI, hNu, hNU / DCX, and DCX. Figure 3d From the left are graphs regarding hNU / DAPI, Ki37 / DAPI, and hNU / Ki67.

[0069] Figure 4 shows NPC in rat brain tissue PSA-NCAM+ Figure 3 shows the contribution to neural tissue and the reduction effect on glial cell activation. Figure 4a To show the transplantation of NPC PSA-NCAM+ hMito + (red) and MAP2 + (Green) Image of cells. Scale bar: 20 μm. Figure 4b Confocal images of transplanted cells 26 days after transplantation. Donor-derived cells (green, hNu + ) and MAP2 + (Red) Commonly located in NPC PSA-NCAM+ Transplantation site. DAPI is blue. Figure 4c The figure shows that there is no hMi co-existing with MAP2 in the host neurons of the contralateral striatum. + Cells. Scale bar: 20 μm. Figure 4d To show the transplantation of NPC PSA-NCAM+ hMito + GFAP + Figure 3. Scale bar: 20 μm. Figure 4e To show the NPC PSA-NCAM+ The ED-1 positive cells in the ipsilateral striatum of the transplantation group were significantly reduced, and the reduction in the mesenchymal stem cell transplantation group was less than that in the NPC group. PSA-NCAM+ Figure of the transplant group. NPC PSA-NCAM+ The transplantation group and the mesenchymal stem cell transplantation group showed significant differences from the phosphate-buffered saline group. PSA-NCAM+The expression of GFAP was significantly reduced in the transplanted group. Scale bar: 200 μm. The number of ED1 or GFAP positive cells was detected in at least 5 separate microscopic fields. The detection values ​​are expressed as ± standard error. The results of multiple comparisons between the groups are *P<0.05 and ***P<0.001, respectively.

[0070] Figure 5 shows the transplantation of NPC PSA-NCAM+ Figure 3. Brain ischemia promotes angiogenesis in rats. Figure 5a Figures show the phosphate buffered saline group, NPC PSA-NCAM+ Figure 3 is a graph showing the immunostaining results of ischemic brain in the MSC transplantation group or the mesenchymal stem cell transplantation group. Scale bar: 200 μm. Figure 5b To show NPC PSA-NCAM+ Representative images of host-derived α-SMA-positive vascular epithelial cells (red) at the transplantation site. Scale bar: 20 μm. Figure 5c To show the transplant NPC PSA-NCAM+ Figure 2 shows the results of quantitative analysis of α-SMA-positive microvessels in rats containing NPC or mesenchymal stem cells. Detection values ​​are expressed as ± standard error. PSA-NCAM+ Mesenchymal stem cells or *NPC PSA-NCAM+ The results of the comparison between the PBS group and the phosphate-buffered saline group were P<0.05 and P<0.01, respectively. Figure 5d To show that reverse transcription-polymerase chain reaction can inhibit NPC PSA-NCAM+ Figure 1 shows the results of detecting the expression of rat-angiopoietin-1 in ischemic brain 7 and 26 days after (NPC) or mesenchymal stem cells. In addition, the quantitative results of reverse transcription-polymerase chain reaction amplification of angiopoietin-1 (upper part) and the messenger RNA (mRNA) level (lower part) standardized by glyceraldehyde phosphate dehydrogenase (GAPDH) in the blank control group (baseline value) are shown. The detection values ​​are expressed as ± standard error. *P<0.05 compared with the phosphate-buffered saline group.

[0071] Figure 6 To demonstrate the use of reverse transcription-polymerase chain reaction to detect the presence of transplanted NPC PSA-NCAM+ Figure 1 shows the results of detecting the expression level of rat and human neurotrophic factors in cerebral ischemia with , mesenchymal stem cells or phosphate-buffered saline. In addition, the quantitative results of the reverse transcription-polymerase chain reaction amplification of neurotrophic factors and the messenger RNA level normalized by glyceraldehyde phosphate dehydrogenase in the blank control group (baseline value) (n=3 per group) are shown. The detection values ​​are expressed as ± standard error. *P<0.05 compared with the phosphate-buffered saline group.

[0072] Figure 7It is a graph showing the sizes of ischemic lesions in the phosphate-buffered saline control group, the medium control group, and the secretome-treated group.

[0073] Figure 8 It is a graph showing the changes in body weight of the phosphate-buffered saline control group, the medium control group, and the secretome-treated group.

[0074] FIG. 9 is a graph showing the results of behavioral analysis of a phosphate-buffered saline control group, a medium control group, and a secretome-treated group. Figure 9a The results of the balance beam test are shown. Figure 9b Shows the grip traction test results, Fig.9c The results of the forelimb stepping test are shown. Figure 9d The line cross results showing the activity of the behavior per unit time.

[0075] Fig.10 The graph shows the results of analysis of the comprehensive motor nerve improvement effect (modified neurological function score) of the phosphate-buffered saline control group, the medium control group, and the secretome-treated group.

[0076] exist Figures 7 to 10 In the table, *P value < 0.05, **P value < 0.01. [Specific implementation method]

[0077] The present invention is described in more detail below by way of examples. For those skilled in the art, these examples are only used to more specifically describe the present invention, and according to the gist of the present invention, the protection scope of the present invention is not limited to these examples.

[0078] [Example]

[0079] [Example 1. Therapeutic effect of polysialic acid neural cell adhesion molecule-positive neural precursor cells on ischemic diseases and neuroinflammatory diseases]

[0080]

Experimental methods

[0081]

NPCs derived from human mesenchymal stem cells and human embryonic stem cells PSA-NCAM+ Cell culture and differentiation

[0082] The use of human cells was approved by the Institutional Review Board (IRB No. 4-2008-0643). Human bone marrow was obtained from the posterior iliac crest of healthy adult volunteers who provided informed consent. The following is a brief description of the acquisition method, that is, bone marrow mononuclear cells were separated by density gradient centrifugation (GE Healthcare, Uppsala, Sweden), placed in DMEM with 10% fasting blood sugar (FBS) (Gibco, Grand Island, NY), and cultured at 37°C in a humidified atmosphere containing 5% CO2. After 24 hours, non-adsorbed cells were washed and removed. The culture medium was replaced every 3 days, and the cells were subcultured using 0.05% trypsin / ethylenediaminetetraacetic acid (Invitrogen, Carlsbad, CA) when the cell confluence reached 90%.

[0083] In this experiment, adsorbed mesenchymal stem cells that had completed 3 to 5 passages were used. For neural induction, embryoid bodies (EBs) derived from human embryonic stem cells were cultured for 4 days in a suspension containing 5 μM free alkali (DM, dorsomorphin) (Sigma, St. Louis, MO) and 5 to 10 μM SB431542 (Calbiochem, San Diego, CA) in a human embryonic stem cell culture medium without basic fibroblast growth factor (Invitrogen), and then adsorbed on a culture dish coated with Matrigel (BD Biosciences, Bedford, MA) for about 5 days in a 1×N2 (Invitrogen) medium with 20 ng / ml basic fibroblast growth factor ((Kim, DS, Lee, DR, Kim, HS, et al. al. (2012). PLoS One, 7, e39715). The neural plexus in the center of the adsorbed EB colony was carefully separated from the surrounding flat cells using a pulled glass pipette. The small plexus was boiled in a culture dish coated with matrigel and cultured in DMEM / F12 supplemented with 1×N2 and 1×B27 (Invitrogen) (Kim, DS, Lee, JS, Leem, JW, et al. (2010). Stem Cell Reviews and Reports, 6, 270-281).

[0084] Isolation of polysialic acid-neural cell adhesion molecule-positive neural precursor cells using magnetic activated cell sorter

[0085] Expanded neural plexuses that were 80-90% confluent were exposed to 10 μM Y27632 (Sigma) for about 1 hour to prevent apoptosis before the magnetic activated cell sorter step. After separation using Accutase (Invitrogen), cells (~1×10 8 The cells were then separated into blocks and incubated with anti-polysialic acid neural cell adhesion molecule antibodies conjugated with microbeads (Miltenyi Biotec) at 4°C for 15 minutes. After thorough washing, the cell suspension was placed in a magnetic activated cell sorter (MASC) and the labeled positive cells remaining in the column were eluted with a tube. The separated NPCs were PSA-NCAM+ 4~5×10 5 cells / cm 2 The cells were replaced in N2B27 medium or NBG medium (1×N2, 0.5×B27 and 0.5×G21) (GeminiBio-Products, West Sacramento, CA) supplemented with 20 ng / ml basic fibroblast growth factor. The culture medium was replaced every day, and the cells were subcultured every 2 to 3 days.

[0086]

【Establishment of stroke model and NPC PSA-NCAM+ Stereotaxic injection

[0087] Two-week-old male Sprague-Dawley rats (weighing approximately 250-300 g) were anesthetized with 3% isoflurane (HanaPharm, Seoul, Korea) at a N2O:O2 ratio of 70% to 30%. The left common carotid artery and the external carotid artery were isolated and ligated with 4-0 surgical sutures. A nylon thread was inserted into the left internal carotid artery and moved to the circle of Willis (permanent middle cerebral artery occlusion), and the thread was left until the rat was sacrificed.

[0088] NPC was performed 2 days after middle cerebral artery occlusion. PSA-NCAM+, mesenchymal stem cells, or phosphate-buffered saline. Rats were anesthetized with Zota (Virbac S.A., France, 25 mg / kg) and placed in an orthostatic surgical tool (David Kopf Instruments, Tujunga, CA). An A26 needle (Hamilton syringe, Hamilton, Reno, NV) was inserted into the left striatum (coordinates from the anterior bregma: anteroposterior +0.7mm, mediolateral -2mm and dorsoventral -5.5mm, from the meninges -2.5mm); 5μl of NPC was injected into the 5.5mm and -2.5mm sites. PSA-NCAM+ , mesenchymal stem cells (1×10 5 Cells were injected into the left striatum at a rate of 1 μl / min to prevent cell aggregation. Nine animals died during the middle cerebral artery occlusion surgery and cell transplantation.

[0089] All animals were housed in an Association for Assessment and Accreditation of Laboratry Animal Care (AAALAC)-approved facility under a 12-hour light / dark cycle. Animal experiments were approved by the Institutional Review Board (IRB No. 4-2011-0087).

[0090]

Behavioral test

[0091] Foot fault test: The foot fault test is used to test the degree to which the forepaw can be accurately placed on an equidistant grid (60×60 cm, 6 cm long) during a 2-min test. The above test is based on existing studies and performed according to modified procedures [12, 13].

[0092] Asymmetric behavior test: A modified elevated body swing test (EBST) was used as reported. Lateral movements were measured after the rat's tail was raised to 10 cm above the surface of the experimental area. The frequency of swinging to the right or left side was measured for 1 minute. The asymmetry score was calculated as follows: 0 points - twisting the trunk, swinging to the left or right side, 1 point - asymmetric twist of <30°, 2 points ->30° asymmetric twist. Depending on the direction of the twisted trunk, the score was calculated as ipsilateral twist (ipsilateral twist, in the same direction as the infarct site) or contralateral twist (contralateral twist, in the opposite direction to the infarct site).

[0093] Beam balance test: The beam walking mechanism is formed by a beam (100×5×2 cm). The motor ability is evaluated according to the 6-point system used in previous studies: 1 point - achieving a stable posture on the beam and balancing with the paws, 2 points - grasping the side of the beam and performing a swinging movement, 3 points - falling of more than one paw, 4 points - falling while trying to maintain balance, 5 points - falling while carrying the beam, and 6 points - falling without trying to maintain balance.

[0094] Prehensile traction test: The ability to grasp in the test is tested by the ability of the rat to hang on a horizontal rope with its front paws. The prehensile traction test is conducted to evaluate the muscle strength of the rat. The test is conducted by an existing method. An iron bar (2 cm in diameter, 100 cm in length) is placed horizontally 70 cm above a sponge rubber pad (7.5 cm in thickness). The rat is released after the rat's front paws are placed on the iron bar. The rat is allowed to hang on the iron bar for 5 seconds. The score is calculated by calculating the time it takes to fall and whether the hind paws are placed on the iron bar as follows: 0 points - the rat hangs for 5 seconds and the hind paws do not fall, 1 point - the rat hangs for 5 seconds and the hind paws fall; 2 points - the rat hangs for 3 to 4 seconds, 3 points - the rat hangs for 0 to 2 seconds.

[0095] Modified neurological severity score (mNSS): The neurological impairment score is derived by combining motor, sensory and reflex neurological examinations and is performed using existing methods. Objective quantification is achieved based on asymmetric behavior tests, balance beam test, grasping and traction test, open field test (rotation frequency) and forelimb stepping test, and the score is calculated as follows: 0 points - no defect, 2 points - it is difficult to fully extend the opposite front leg (3≤front foot fault<10), 4 points - it is impossible to extend the opposite front leg (front foot fault≥10), 6 points - a slight rotation to the opposite side (1≤rotation or asymmetric twist <5), 8 points - severe rotation (rotation or asymmetric twist ≥5), 10 points - falling to the opposite side (grasping and traction ≤2).

[0096]

Immunohistochemical analysis and quantification

[0097] The brain tissue was fixed with 4% formaldehyde for about 24 hours and washed with phosphate buffered saline. To prepare paraffin sections, the tissue was dehydrated in increasing amounts of ethanol and embedded in paraffin. The brain embedded in paraffin was cut in 5 mm layers on a microtome for microscopy, deparaffinized in xylene for 10 minutes, and rehydrated in increasing amounts of alcohol. After treating the sections with 10 mM citric acid for about 1 hour, a 5% bovine serum albumin solution containing phosphate buffered saline and 0.5% triton X-100 was added. Then, brain slices were incubated with primary antibodies against DCX (Abcam), Tuj1 (Covance), hNu (Millipore, clone 235-1), GFAP (Millipore), Ki67 (Leica Microsystems), hMito (Millipore), MAP2 (Millipore), human Nestin (Millipore, clone 10C2), or ED-1 (Abcam) (1:100) at 4°C for 10 to 12 hours. After overnight incubation with the primary antibodies, the slices were washed with phosphate-buffered saline and incubated with fluorescently labeled anti-rabbit IgG as a secondary antibody for about 31 hours. The slices were washed again with phosphate-buffered saline and mounted with 4',6-diamidino-2-phenylindole (DAPI). Fluorescent images of the slices were acquired using a fluorescence microscope (Olympus IX71). In order to accurately detect the number of neurons that react with a specific antibody in brain tissue, a blind test was used. Three experimenters who were unaware of the experiment in advance examined five 50 mm sections of the slide. 2 ED-1 in the quadrangle +Cells and α-SMA + The researchers then combined the results of three researchers to determine the exact number of nerve cells detected.

[0098] 26 days after transplantation, rats (10 per group) were anesthetized with Zotal (Virbac SA, France, 25 mg / kg) and perfused with 4% paraformaldehyde in phosphate-buffered saline and phosphate-buffered saline (pH 7.5).

[0099] To detect the infarct size, brain sections were stained with hematoxylin and photographed using a microscope (Zeiss, Oberkochen, Germany). The indirect injury size was calculated by subtracting the infarct size of the ipsilateral hemisphere from the infarct size of the contralateral hemisphere. The relative infarct size was analyzed by the NIH ImageJ program (version 1.47). The average percentage of indirect injury compared with the contralateral hemisphere is shown.

[0100]

Reverse transcription-polymerase chain reaction (RT-PCR)

[0101] Total RNA was isolated using Trizol reagent (Invitrogen). First, standard reverse transcription (RT) was performed using Transcriptase II (Invitrogen), followed by reverse transcription-polymerase chain reaction using the following primer set: Angiopoietin 1 forward primer: TGTGTCCATCAGCTCCAGTTGC (first sequence in the sequence list), reverse primer: CGGCTACCATGCTCGAGATAGG (second sequence in the sequence list) (Bioneer, Daejeon, Korea). The polymerase chain reaction product was transferred to 1.2% agarose gel, stained with ethidium bromide, and the bands (about 400 bp) were detected by ultraviolet light. Finally, the detected bands were quantified using the NIH ImageJ program (version 1.47).

[0102]

Statistical Analysis

[0103] Data are presented as mean ± standard error. The data of behavioral tests and infarct size were analyzed using SPSS (Statistical Package for Social Sciences, Version 20.0) and analysis of variance (ANOVA) and independent sample t-test. When P-values ​​< 0.05, it was considered statistically significant.

[0104]

Experimental results

[0105]

【NPC PSA-NCAM+ Transplantation reduces the infarct site in the host brain.

[0106] Figure 1a The overall experimental design of the present invention is shown. The degree of damage to the neural tissue was evaluated by using the brain area (area) that could not be stained normally with hematoxylin 26 days after transplantation. The infarct site was mainly shown in the cerebral cortex and striatum. PSA-NCAM+ In the case of phosphate-buffered saline-treated ischemic brain, the infarct site was clearly wider ( Figure 1b The percentage of infarct area on the opposite side was significantly higher in NPC transplanted mice compared with the phosphate-buffered saline group (25.1±2.4%). PSA-NCAM+ The NPC cell population was significantly decreased in the group with NPC (7.1±2.5%) or mesenchymal stem cells (14.9±1.9%) (F=13.64, P<0.01). PSA-NCAM+ There was no significant difference in infarction between the transplantation group and the mesenchymal stem cell transplantation group, but NPC PSA-NCAM+ The infarct size in the transplantation group was significantly narrower than that in the mesenchymal stem cell transplantation group ( Figure 1c ).

[0107]

【NPC PSA-NCAM+ Transplantation of glioma cells improves mobility in a rat stroke model.

[0108] The body weight of rats was reduced by 40 g compared to the baseline value measured 1 day after middle cerebral artery occlusion. The body weight reduction peaked 7 days after phosphate-buffered saline treatment. In the mesenchymal stem cell transplantation group, the body weight returned to the baseline stage 17 days after transplantation. However, compared with the phosphate-buffered saline group, the body weight in the NPC group was PSA-NCAM+ In the transplantation group, significant weight recovery was detected starting from day 3 after transplantation (P<0.05) ( Figure 2a From 3 days (P<0.05) to 13 days (P<0.01) after middle cerebral artery occlusion, the frequency of missed steps / line sections in NPC was significantly higher than that in phosphate-buffered saline group. PSA-NCAM+ transplantation group and mesenchymal stem cell transplantation group were significantly reduced ( Figure 2b ). Moreover, compared with the mesenchymal stem cell transplantation group, NPC PSA-NCAM+ The transplant group also significantly reduced the number of missed steps / wire sections on day 13. However, this difference became less significant as the body weight increased and activity decreased thereafter (days 17 and 24 after transplantation).

[0109] Before MCA occlusion, all rats showed relatively low asymmetry in the electronic blood tracking system (EBTS), whereas after MCA occlusion, asymmetry was clearly observed in all experimental animals. PSA-NCAM+ The transplantation group and the mesenchymal stem cell transplantation group began to show ipsilateral twisting behavior. The mesenchymal stem cell transplantation group showed a slow upward trend until the 13th day of transplantation (P<0.05). PSA-NCAM+ The asymmetric behavior scores of the transplanted group began to decrease significantly from 7 days after transplantation and continued until 24 days (P<0.01) ( Figure 2c ).

[0110] Compared with the mesenchymal stem cell transplantation group and the phosphate-buffered saline group, NPC PSA-NCAM+ Transplantation also improved functional recovery in the balance beam test from day 3 to day 24 (P < 0.01) ( Figure 2d ).NPC PSA-NCAM+ Transplantation significantly increased the hours spent on the beam for response motor conditioning, but no statistical differences were observed between the mesenchymal stem cell-treated and phosphate-buffered saline-treated groups.

[0111] The grasping traction score, which was negatively correlated with the muscle strength of the forepaw, was significantly higher in NPC PSA-NCAM+ The transplant group gradually decreased between days 3 and 24 (P < 0.01) ( Figure 2e ). The mesenchymal stem cell transplantation group also showed a similar improvement pattern 7 to 24 days after transplantation.

[0112] In order to standardize the quantitative neurological recovery effect, the inventors finally evaluated the modified neurological function score based on asymmetric behavior scores, balance beam test, grasping traction test, open field test (rotation frequency, unpublished data) and forelimb air step test. The modified neurological function score showed that compared with the phosphate-buffered saline treatment group, the NPC PSA-NCAM+ In the transplantation group and the mesenchymal stem cell transplantation group, gradual neurological function recovery began to appear from the 3rd day (P<0.05) ( Figure 2f Moreover, compared with the mesenchymal stem cell transplantation group, NPC PSA-NCAM+ The transplant group also showed substantial improvement from 7 to 24 days (P<0.01). PSA-NCAM+ The effect of the transplantation group was particularly evident between 3 days and 7 days, which showed that there was a strong paracrine at the beginning of the transplantation.

[0113]

【Transplanted NPC PSA-NCAM+ Survive in the host brain and differentiate into the nervous system]

[0114] To track the density of transplanted cells, the inventors performed histochemical analysis on the 26th day using antibodies against hNu (human-specific nucleus), Ki67 (proliferating cell marker), DCX (neuroblast marker), nestin (neural stem cell marker), and Tuj1 (neural marker). PSA-NCAM+ After transplantation, most of the cells were found at the initial transplantation site (e.g., striatum). PSA-NCAM+ Survival, proliferation and differentiation of mitochondria through Ki67 in damaged brain + 、DCX + 、Tuj1 + Nestin + to confirm the existence of Figure 3a and Figure 3b ). Most of the NPCs that were ported PSA-NCAM+ The cells expressed DCX or Tuj1, and a portion was positive for nestin. The mitotic steps of the transplanted cells were investigated by Ki67-immunoreactivity. + Some of the cells (9184 cells) were also positive for Ki67 on day 26 after transplantation (432 cells, 4.7%). PSA -NCAM+ Tuj-1 immunoreactivity in cells extensively overlaps with DCX immunoreactivity ( Figure 3b These DCX-immunoreactive cells were not derived from rat cells, but from human cells ( Figure 3c ), it can be seen that the reduction in the area of ​​cerebral infarction is partly due to the fusion of the transplanted cells.

[0115] Many ported NPCs PSA-NCAM+ The cells showed excellent survival rate and were incorporated into damaged tissues, but only a few cells were detected 26 days after the hNu-expressing mesenchymal stem cells were transplanted ( Figure 3d ). Most of the ported NPCs PSA-NCAM+ The cells are immature neural cells (e.g., DCX-positive, some are Ki67-positive cells) ( Figure 3b ). In contrast, the transplanted mesenchymal stem cells (hNu + cells) did not show DCX positive in the injured area. In most of the mesenchymal stem cell transplantation groups, a small number of proliferating hNu - Ki67 + Cells are present in and around the needle tract ( Figure 3d ).

[0116] Transplanting NPC PSA-NCAM+ hMito + MAP2 + and hNu+ MAP2 + Double labeled cells ( Figure 4a and 4b ), but hMito was hardly detected + GFAP + ( Figure 4d ) or hMito + GalC + (Unpublished data) Co-stained cells, thus, NPC PSA-NCAM+ hMito cells are precursor cells that mainly participate in the nervous system. + cell( Figure 4c ).

[0117]

【NPC PSA-NCAM+ Transplantation of glial cells inhibits the activity of reactive glial cells in the host brain

[0118] A few GFAP (astrocyte marker)-positive cells appeared inside and around the needle tract, but GFAP expression was not detected in NPC. PSA-NCAM+ The transplant group had significantly fewer ( Figure 4e ). In fact, the number of GFAP-positive cells in NPC PSA-NCAM+ transplantation group was greatly reduced (P<0.001), and the reduction was lower in the mesenchymal stem cell transplantation group ( Figure 4e and Figure 4f ). From this we can see that NPC PSA-NCAM+ Transplantation strongly inhibits the activation of reactive astrocytes, thereby forming an environment that is favorable for tissue regeneration (Gonzalez, FF, McQuillen, P., Mu, D., et al. (2007). Developmental Neuroscience, 29, 321-330).

[0119] Ischemic stroke induces an opposite reaction of microglia to that produced by tissue damage. In view of this, the present inventors investigated the activation of microglia in ischemic brain tissue using ED1 antibody for recognizing CD68 (a marker of active microglia) 26 days after transplantation ( Figure 4e ). Notably, ED1-positive cells in NPC PSA-NCAM+ The NPC group was significantly reduced (P<0.001), while the reduction in the mesenchymal stem cell transplantation group was less than that in the NPC group. PSA-NCAM+ Group (P<0.05) ( Figure 4f Although Nu+ cells in the striatum were detected after 6 months, PSA-NCAM+ There was no trace of teratoma at the transplant site or anywhere else in the brain.

[0120]

【NPC PSA-NCAM+ Transplantation promotes angiogenesis in the host brain

[0121] Endogenous angiogenesis in the ischemic brain was investigated using an antibody against α-SMA, a smooth muscle actin marker. The results showed that compared with the mesenchymal stem cell-treated group and the phosphate-buffered saline-treated group, NPC PSA-NCAM+ The number of α-SMA-responsive blood vessels increased around the transplantation site in transplanted rats ( Figure 5a , Figure 5b ) Through quantitative analysis of microvessels, it was clearly confirmed that NPC treated with mesenchymal stem cells and phosphate-buffered saline (PBS) had a PSA-NCAM+ The number of α-SMA+ vessels in transplanted rats increased at the infarct site ( Figure 5c ).

[0122] The expression level of angiopoietin-1, an angiogenesis-inducing factor, in brain tissue was investigated by reverse transcription-polymerase chain reaction 7 and 26 days after transplantation. The results showed that on the 26th day, NPC PSA-NCAM+ The expression level in transplanted rats was significantly higher than that in other groups (P<0.05) ( Figure 5d ), it can be seen that the NPCs that survive for a long time PSA-NCAM+ Induced angiogenesis. Compared with 7 days after transplantation, NPC PSA-NCAM+ The transplanted rats showed an increased pattern of angiopoietin-1, whereas angiopoietin-1 in the MSC-treated rats remained unchanged or slightly decreased compared with that in the 7th day. However, compared with the phosphate-buffered saline-treated group, the MSC-treated rats showed an increased pattern on the 7th day (P<0.05).

[0123] [Example 2. Therapeutic effects of the secretory proteome of neural precursor cells on ischemic diseases and neuroinflammatory diseases]

[0124] Experimental materials and methods

[0125] NPCs derived from human embryonic stem cells PSA-NCAM+ Acquisition of cells

[0126] The use of human cells was approved by the Institutional Review Board (IRB No. 4-2008-0643). For neural induction, various embryoid bodies (EBs) derived from human embryonic stem cells and iPSCs were cultured for 4 days in a suspension containing 5 μM free alkali (Sigma, St. Louis, MO) and 5-10 μM SB431542 (Calbiochem, San Diego, CA) in human embryonic stem cell culture medium (Invitrogen) without basic fibroblast growth factor, and then adsorbed on culture dishes coated with matrix gel (BD Biosciences, Bedford, MA) for about 5 days in 1×N2 (Invitrogen) culture medium with 20 ng / ml basic fibroblast growth factor (Kim, DS, Lee, DR, Kim, HS, et al. (2012). Highly pure and expandable PSA-NCAM-positive neural precursors from human ESC and iPSC-derived neuralrosettes. PLoS One, 7, e39715). The neural clump in the center of the adsorbed EB colony was carefully separated from the surrounding flat cells using a glass pipette. The small clump was boiled in a culture dish coated with matrigel and cultured in DMEM / F12 supplemented with 1×N2 and 1×B27 (Invitrogen) (Kim, DS, Lee, JS, Leem, JW, et al. (2010). Robust enhancement of neural differentiation from human ES and iPS cells regardless of their innate difference in differentiation propensity. Stem Cell Reviews and Reports, 6, 270-281).

[0127] Expanded neural plexuses that were 80-90% confluent were exposed to 10 μM Y27632 (Sigma) for about 1 hour to prevent apoptosis before the magnetic activated cell sorter step. After separation using Accutase (Invitrogen), cells (~1×10 8Cells were collected and incubated with anti-polysialic acid neural cell adhesion molecule antibody conjugated with microbeads (Miltenyi Biotec) at 4°C for 15 minutes. After thorough washing, the cell suspension was placed in a magnetic cell sorter and the labeled positive cells remaining in the column were eluted with a tube. The separated NPC PSA-NCAM+ 4~5×10 5 cells / cm 2 The cells were replaced in N2B27 medium or NBG medium (1×N2, 0.5×B27 and 0.5×G21) (GeminiBio-Products, West Sacramento, CA) supplemented with 20 ng / ml basic fibroblast growth factor. The culture medium was replaced every day, and the cells were subcultured every 2 to 3 days.

[0128] Isolation of the secreted proteome in neural progenitor cells (NPs) derived from human fully differentiated stem cells

[0129] The neural progenitor cells (polysialic acid neural cell adhesion molecule-positive neural progenitor cells) derived from human whole-line stem cells obtained in the above process were placed in a basic culture medium (DMEM / F-12), and serum-depleted supplements of N2 (100×-final concentration 1×), B-27 (50×-final concentration 0.5×) and Gem21 (50×-final concentration 0.5×) were added, basic fibroblast growth factor (20 ng / ml) was added, and cultured repeatedly for more than 4 passages in a 60 mm culture dish coated with Matrigel. After the expansion was completed, 8 to 10 culture dishes were cultured until about 90% of the cells were filled. After the culture medium was removed, the cells were washed three times with a phosphate buffer solution, and only ITS (100×-final concentration 1×) and basic fibroblast growth factor (20 ng / ml) were added to the serum-free basic culture medium (DMEM / F12), and cultured for 24 hours. In the control group, the same amount of culture medium with the same composition (the same amount of ITS and basic fibroblast growth factor were added to the basal culture medium) was added to the cell-free culture dish, and the culture medium was cultured for about 24 hours, and the recovered medium was used as the control group. All the culture medium was collected and centrifuged (at 800g for 30 minutes), and after removing the cell debris, it was immediately frozen in a -70°C freezer and used by thawing when necessary.

[0130] Preparation of stroke model

[0131] In order to detect the neuron protection effect on neuron damage caused by local cerebral ischemia, the intraluminal suture method is used. The local cerebral ischemia model developed by ZiaLonga (ZeaLonga, et al, Stroke., 1989, 20, 84-91) has the advantages of being clinically similar to other models. For these reasons, it has become a model suitable for the mechanism study of ischemia-reperfusion or the screening of the effects of various drugs.

[0132] After one cycle, the experimental animals (male Sprague-Dawley rats, weighing 250-300 g) were anesthetized using a respiratory anesthesia machine, and isoflurane was used as an anesthetic. First, general anesthesia was induced in rats with 5% isoflurane in a mixed gas of 80% N2O and 20% O2, and anesthesia was maintained at 2-2.5%. In order to prepare a stroke model, after the skin of the left neck of the rat was incised, the common carotid artery, external carotid artery and internal carotid artery were peeled inward, and each blood vessel was gently tied with black silk to cut off the blood flow. The common carotid artery was cut halfway, and the end of the nylon suture was cauterized through the cut surface, so that a 25mm 4-0 nylon probe prepared to 0.40mm by rounding was inserted. The nylon probe inserted through the external carotid artery is inserted through the internal carotid artery and fixed to the middle cerebral artery. After being inserted about 18 to 20 mm into the common carotid artery branch, the beginning of the middle cerebral artery is blocked and fixed with a thread. After the middle cerebral artery is permanently closed, the skin incision is re-sutured and the patient recovers naturally from anesthesia.

[0133]

Secretory proteome injection and behavioral experiments in stroke models

[0134] One day after the induction of stroke, a baseline was established for the behavioral experiment, and then an insulin needle was inserted into the internal carotid artery through the right external carotid artery in the same manner as the preparation of the stroke model, and then about 0.2 mg / kg (volume 50 μl) of the secretome was injected into the artery through the above needle, and the control group was administered with the same volume of culture medium or phosphate buffer solution (phosphate buffered saline). After the injection of the secretome liquid, the state of the animal was observed for about 14 days, the body weight was measured once before the injection, and the body weight was measured 4 times after the injection, and behavioral analysis was performed.

[0135] ① Torso twisting test: This test is to test the torso twisting, which is perceived by the cerebral cortex and striatum of experimental animals, and to detect asymmetric movement behavior.

[0136] ②Beam balance test: The gross vestibulomotor function is evaluated by allowing the experimental animals to maintain a stable balance posture on a narrow beam.

[0137] ③Foot-fault test: As an experimental method used to detect the coordination (coordination) and combination (integration) of motor movement during movement, foot-fault refers to the situation where the animal's front or hind paw is misplaced or the paw falls from between the grid bars. Foot-fault is unusually symmetrical in the animals in the field.

[0138] ④ Prehensile Traction test: The grasping traction in the test is detected by the ability of the experimental animal to hang on the horizontal rope with its front paws. The grasping traction test is conducted to evaluate the muscle strength of the experimental animal. The above test is conducted by the existing method. An iron bar (2 cm in diameter, 100 cm in length) is placed horizontally at 70 cm above a sponge rubber pad (7.5 cm in thickness). After placing the front paws of the experimental animal on the iron bar, release the experimental animal. Let the experimental animal hang on the iron bar for 5 seconds. The score is calculated by calculating the time it takes to fall and whether the hind paws are placed on the iron bar as follows: 0 points - the rat hangs for 5 seconds and the hind paws do not fall, 1 point - the rat hangs for 5 seconds and the hind paws fall; 2 points - the rat hangs for 3 to 4 seconds, 3 points - the rat hangs for 0 to 2 seconds.

[0139] ⑤Open-field test: As a test to confirm different walking or multi-level, the animal's activity, emotionality and behavior patterns are detected by directly observing the animal's behavior patterns and characteristics.

[0140] ⑥ Modified Neural Sibiarity Score: As the neutralized result of the movement, perception, balance, reaction and emotion test values ​​obtained through the above-mentioned various tests, the score is calculated according to the following criteria (the modified neural sibiarity score is measured by summing up the scores for each individual).

[0141] -Open field test (to test the animal's emotions, activity, behavior patterns, etc.)

[0142] No action: 3

[0143] 1-20 times: 2

[0144] 21-30 times: 1

[0145] More than 30 times: 0

[0146] - Grip and traction test (physical strength test)

[0147] 0-5 seconds: 3

[0148] 6-10 seconds: 2

[0149] 11-20 seconds: 1

[0150] More than 21 seconds: 0

[0151] -Balance beam test (balance perception test)

[0152] 0 points: 1 = stable posture

[0153] 2 = Grab the side of the beam and shake it slightly

[0154] 1 point: 3 = 1 or more claws fall from the beam

[0155] 4 = Falling while trying to keep balance

[0156] 2 points: 5 = Lost balance, hung upside down on the beam and fell

[0157] 6=The person cannot keep balance on the beam and falls

[0158] - Forelimb stepping test (motor coordination ability)

[0159] 0 to 5 times: 0

[0160] 6-10 times: 1

[0161] 11-20 times: 2

[0162] 21+: 3

[0163] -Upper body posture test (asymmetric motor behavior)

[0164] 0 times: 2

[0165] 1 to 4 times: 1

[0166] 5 or more times: 0

[0167] 14 days after inducing cerebral ischemia, rats were anesthetized with sutane and thoracotomy was performed. Then, the right atrial appendage was cut open, and after a needle was injected into the left ventricle, the blood was removed by perfusing the heart with a phosphate buffer solution using a pump, and the brain tissue was removed. The tissue sections used to prepare the samples were embedded in paraffin with the bregma as the reference. In order to confirm the damaged brain tissue, the brain tissue sections were stained with hematoxylin, fixed after dehydration, and the slides were photographed with a digital camera and stored in a computer. The cerebral infarction rate (%) was calculated using the image analysis program (image J) with the following mathematical formula 1.

[0168]

Mathematical formula 1

[0169] Cerebral infarction rate (%) = (area of ​​normal left hemisphere - area of ​​normal tissue at the site of cerebral infarction) / area of ​​normal left hemisphere × 100

[0170] Secretome analysis (Secretomics)

[0171] The secretome of neural progenitor cells derived from human embryonic stem cells and the secretome of neural progenitor cells derived from human iPSC were separated by polyacrylamide gel electrophoresis (SDS-PAGE) using a gradient Novex Bis-Tris gel (Invitrogen) of 4-12%, and then the gel was stained with Gel Cord Blue staining reagent (Pierce) in such a way that no protein bands could be seen. The stained gel was cut into 10 bands of the same size and digested with in-gel trypsin using the existing method.

[0172] The peptides prepared by in-gel degradation were analyzed using a LinearTrap Quadrupole (LTQ) mass spectrometer (Thermo Finnigan) coupled to Nano Ultra Performance liquid chromatography (Eksigent Technologies). Specifically, the trypsin-treated peptides were applied to an analytical column (75 microns x 11 cm) filled with C18 normal 5 micron size resin. A linear 45-minute gradient was performed using 60% of solution B (0.1% formic acid added to acetonitrile) at 97% solution A (0.1% formic acid added to distilled water) at a flow rate of 0.3 microliters / hour. The degraded peptide ions were electrosprayed with a nano-electrospray ionization (ESI) source. In the MS / MS spectrum, the entire MS scan was selected by fragment, and a maximum of 5 spectra were obtained with result-dependent scanning. The repeat count for dynamic exclusion was set to 1, the repeat period was set to 30 seconds, the dynamic exclusion period was set to 180 seconds, the exclusion mass width was set to 1.5 Da, and the motion exclusion list was set to 50.

[0173] The Thermo-SEQUEST algorithm (ThermoFinnigan) was used to search for peptide and protein confirmation in the ipi.HUMANv3.76 database (89378 items). After searching the database, scarffold2 (ProteomeSoftware) was used to confirm the confirmed peptides and proteins. Among the peptides retrieved by SEQUEST, a group of peptides with a peptide prediction (Peptide Prophet) of more than 0.95 was selected. In addition, a list of proteins with a protein prediction (ProteinProphet) probability of more than 0.99 and more than 2 inherent peptides was obtained.

[0174]

Statistical Analysis

[0175] The statistical significance level between the groups was obtained using one-way analysis of variance (ANOVA) with Tukey's correction, and a p value < 0.05 was considered statistically significant.

[0176]

Experimental results

[0177] In order to examine the disease improvement of the secretome of neural progenitor cells in a stroke model, the following three groups were used for a two-week experiment. 24 hours after the induction of stroke, rats that had been confirmed to have completed disease induction by behavioral experiments were randomly divided into three groups, and the same amount (50 μl) of the secretome (0.2 mg / kg, volume 50 μl), culture medium or phosphate-buffered saline was injected into the right external carotid artery. After the injection of each substance, the state and weight of the animals were checked on the 3rd, 7th, 10th and 14th days, and behavioral analysis was performed.

[0178]

Table 1

[0179] Group illustrate Phosphate buffered saline control group Phosphate-buffered saline treatment group after stroke induction Culture medium control group Medium treatment groups suitable for neural progenitor cell culture after stroke induction Secretome treatment group Neural progenitor cell culture medium treatment group after stroke induction

[0180]

Analysis results of ischemic lesion sites

[0181] Induction of stroke by permanent MCAO in rats caused extensive brain pathological damage. 14 days after stroke induction, the brain was removed and the presence and location of brain damage were confirmed by triphenyltetrazolium chloride (TTC (2,3,5-triphenyltetrazoliumchloride)) staining. TTC staining reacts with the normal mitochondrial oxidative enzyme system in cells. If mitochondria are damaged by cerebral ischemia, the oxidative system is disturbed, and the staining is not completed and appears white, so the damaged site of the brain can be distinguished.

[0182] like Figure 7 As shown in Figure 2, the damage caused by middle cerebral artery occlusion mainly occurs in the cortex and striatum of the right side of the brain ( Figure 7 In addition, the injection of secretome from neural progenitor cells reduced the size of ischemic lesions. In the phosphate buffered saline control group, nearly 60% of the right brain was damaged, and in the culture medium control group, about 46% was damaged. However, in the secretome-treated group, the damaged area was only about 29%, which was significantly reduced compared to the control group.

[0183]

Weight analysis results

[0184] Since stroke induction reduces the motor ability of rats, the body weight decreases immediately and lasts until the 7th day. Various therapeutic agents induce weight gain by restoring motor ability. Injection of secretome also induces weight gain in the same way as cell transplantation ( Figure 8 The most significant phenomenon in the recovery process of nerve injury was the restoration of body weight. Compared with the phosphate buffered saline control group, the secretome treated group showed significant improvement.

[0185]

Behavioral analysis results

[0186] Compared with the two control groups, the secretome-treated group showed statistically significant behavioral improvements in the balance beam test, and this effect showed an immediate effect, such as improvements starting from the third day of treatment ( Figure 9a ).

[0187] Moreover, compared with the two control groups, a statistically significant effect was observed in the grasping traction test starting from the 7th day of treatment (injection). Figure 9b ).

[0188] Furthermore, secretome injection showed an effect of reducing the frequency of foot faults in the net bag ( Fig.9c ). The line cross that detects the activity of behavior per unit time also shows an improving trend ( Figure 9d ).

[0189]

Analysis results of comprehensive motor nerve improvement effect (modified neurological function score)

[0190] The Modified Neurological Severity Score test is a structured table used to test neurological function. It evaluates motor (muscle status) and sensory (visual, olfactory and proprioceptive) items. Normal is 0 points, and the higher the score, the more serious the functional abnormality is judged to be. Fig.10 As shown, in the analysis of modified neurological function score, the secretome-treated group showed a significantly higher therapeutic effect (behavioral improvement) than the phosphate-buffered saline control group and the medium control group from the beginning of treatment ( Fig.10 ).

[0191] In the modified neurological function score test, the phosphate buffered saline control group changed from an average of 5.4 points to an average of 5.5 points 14 days after inducing cerebral ischemia, which shows that the neurobehavioral disorders caused by stroke are maintained. In the case of the culture medium control group, a temporary behavioral improvement effect was shown on the third day after treatment, but no additional improvement effect was exerted. On the contrary, in the case of the secretome treatment group, a sustained behavioral improvement effect was shown from the third day of treatment (modified neurological function score of 4.5 points) to the tenth day (modified neurological function score of 3 points).

[0192] [Secretome analysis results]

[0193] The secretory proteome obtained from neural progenitor cells derived from induced pluripotent stem cells includes Agrin, Annexin A5, Basigin (BSG), Biglycan, Calponin-3, Coactosin-like protein, Cofilin-1, Collagen α-2, Cullin-3, Destrin, Dystroglycan, Ephrin-B2, Exportin-2, Ezrin, Fibronectin, Fibulin-1, Frizzled-related protein, Galectin-3 binding protein protein), Granulins, Growh / differentiation factor 11, Haptoglobin, Hemopexin, High mobility group protein B2, Hornerin, Importin-9, Insulin-like grwoth factor-binding protein 2, Lupus La protein, Macrophage migration inhibitory factor, Midkine, Moesin, Neuropilin 2, Pleiotrophin, Profilin-1, Protein DJ-1, Radixin, Secreted frizzled-related protein 2 protein-2), Septin-11, Talin-1, Testican, Thymopoietin, Transgelin-3 and Vimentin.

[0194] The secretory proteome obtained from neural progenitor cells of human embryonic stem cells includes Agrin, Annexin A2, Attractin, Biglycan, Ceruloplasmin, Cofilin-1, Collagen α-1, Coronin-1X, Dermicidin, DERP12, Ephrin-B3, Exostosin-2, Ezrin, Gelatin-3 binding protein, Granulins, Growh / differentiation factor 11, Haptoglobin, Hemopexin, High-speed swimming group protein B2, Hornerin, Insulin-like grwothfactor-binding protein 2 2), lupus La protein, Midkine, Moesin, Multiple epidermal growth factor-like domains protein 8, Nidogen-1, Parathymosin, Profilin-2, DJ-1, Secretory Frizzled-related protein-2, Secretogranin, Talin-1, Thymosin beta-4, Transforming growth factor-beta-induced protein ig-h3, Transgelin and Vimentin, etc.

[0195] As described above, the specific parts of the present invention are described in detail. For those skilled in the art, these specific technologies are only preferred examples, and the scope of the present invention is not limited to the above examples. Therefore, the actual scope of the present invention is defined by the appended claims and their equivalents.

Claims

1. A composition for treating ischemic diseases or neuroinflammatory diseases, comprising polysialic acid neural cell adhesion molecule-positive neural progenitor cells as an effective ingredient. 2 . The composition for treating an ischemic disease or a neuroinflammatory disease according to claim 1 , wherein the composition for treating an ischemic disease or a neuroinflammatory disease is used to increase the expression of angiopoietin-1. 3 . The composition for treating an ischemic disease or a neuroinflammatory disease according to claim 1 , wherein the composition for treating an ischemic disease or a neuroinflammatory disease is used to inhibit the activation of glial cells or astrocytes. 4 . The composition for treating an ischemic disease or a neuroinflammatory disease according to claim 3 , wherein the composition for treating an ischemic disease or a neuroinflammatory disease is used to reduce the expression of CD68 or glial fibrillary acid protein. 5 . The composition for treating ischemic diseases or neuroinflammatory diseases according to claim 1 , wherein the polysialic acid neural cell adhesion molecule-positive neural precursor cells are isolated from neural plexus differentiated from totipotent stem cells.

6. A composition for treating ischemic diseases or neuroinflammatory diseases, comprising the secretome of neural precursor cells as an effective ingredient. 7 . The composition for treating ischemic diseases or neuroinflammatory diseases according to claim 6 , wherein the neural precursor cells are differentiated from totipotent stem cells.

8. The composition for treating ischemic diseases or neuroinflammatory diseases according to claim 6, wherein the neural progenitor cells are neural progenitor cells in a neural plexus step differentiated from totipotent stem cells. 9 . The composition for treating ischemic diseases or neuroinflammatory diseases according to claim 6 , wherein the neural precursor cells are polysialic acid neural cell adhesion molecule-positive neural precursor cells. 10 . The composition for treating ischemic diseases or neuroinflammatory diseases according to claim 6 , wherein the neural precursor cells are polysialic acid neural cell adhesion molecule-negative neural precursor cells. 11 . The composition for treating ischemic diseases or neuroinflammatory diseases according to claim 6 , wherein the secretome is contained in a cell culture fluid obtained by culturing neural progenitor cells in an animal cell culture medium. 12 . The composition for treating ischemic diseases or neuroinflammatory diseases according to claim 11 , wherein the cell culture fluid is obtained by culturing neural progenitor cells in a serum-free animal cell culture medium containing insulin / transferrin / selenium and basic fibroblast growth factor and then removing the cells.

13. The composition for treating ischemic diseases or neuroinflammatory diseases according to claim 6, wherein the secretory protein group includes the following proteins: agrin, annexin A5, basic immunoglobulin, biglycan, calmodulin-3, coactivin-like protein, cofilin-1, collagen α-2, tardatin-3, eliminin, dystroglycan, ephrin-B2, exportin-2, ezrin, fibronectin, fibrillin-1, frizzled-related protein, galectin-3 binding protein, granulin, growth differentiation factor 11, haptoglobin, hemopexin, high-speed mobilization group B2, keratin, importin-9, insulin-like growth factor binding protein 2, lupus La protein, macrophage migration inhibitory factor, midkine, moesin, neuropilin 2, pleiotrophin, arrestin-1, DJ-1 protein, radixin, secreted frizzled-related protein-2, cleavage protein-11, talin-1, testesin, thymopoietin, transcollin-3, and vimentin.

14. The composition for treating ischemic diseases or neuroinflammatory diseases according to claim 6, wherein the secretory protein group includes the following proteins: agrin, annexin A2, attractin, biglycan, ceruloplasmin, cofilin-1, collagen α-1, coronarin-1X, picotrin, DERP12, ephrin-B3, exostose-like protein-2, ezrin, galectin-3 binding protein, granulin, growth differentiation factor 11, haptoglobin, hemopexin, high-speed swimming group protein B2, keratin, insulin-like growth factor binding protein 2, lupus La protein, midkine, moesin, multiple epidermal growth factor-like domain protein 8, nestin-1, parathymic hormone, arrestin-2, DJ-1 protein, secretory frizzled-related protein-2, secretogranulin, talin-1, thymosin β-4, transforming growth factor B-induced protein IG-H3, transcollin and vimentin.

15. The composition for treating ischemic disease or neuroinflammatory disease according to claim 1 or 6, wherein the ischemic disease is selected from the group consisting of ischemic cerebrovascular disease, ischemic heart disease, myocardial infarction, angina pectoris, lower limb artery ischemic disease and distal limb ischemic disease. The composition for treating ischemic diseases or neuroinflammatory diseases according to claim 15 , wherein the ischemic cerebrovascular disease is ischemic stroke.

17. The composition for treating an ischemic disease or a neuroinflammatory disease according to claim 1 or 6, wherein the neuroinflammatory disease is selected from the group consisting of Alzheimer's disease, Parkinson's disease, Huntington's disease, muscular dystrophy, Creutzfeldt-Jakob disease, multiple sclerosis, amyotrophic lateral sclerosis, diffuse Lewy body disease, leukoencephalitis, temporal lobe epilepsy and inflammatory spinal cord injury.

18. The composition for treating ischemic diseases or neuroinflammatory diseases according to any one of claims 5, 7, and 8, wherein the totipotent stem cells are embryonic stem cells, induced pluripotent stem cells, embryonic germ cells, or embryonic carcinoma cells.

19. A method for treating ischemic diseases or neuroinflammatory diseases, comprising the step of administering a composition comprising polysialic acid neural cell adhesion molecule-positive neural precursor cells as an effective ingredient to an individual in need thereof.

20. A method for treating an ischemic disease or a neuroinflammatory disease, comprising the step of administering a composition comprising a secretome of neural precursor cells as an effective ingredient to an individual in need thereof.

Images