B family DNA polymerase mutant as well as construction method and application thereof

Abstract

The invention belongs to the technical field of molecular biology, and discloses a B family DNA polymerase mutant as well as a construction method and application thereof. Compared with the B family DNA polymerase 4K8Z with the amino acid sequence as shown in SEQ ID NO: 1, the B family DNA polymerase mutant provided by the invention comprises two or more of E134K mutation, E154A mutation, Y291S mutation and K317E mutation. The B family DNA polymerase mutant has excellent amplification performance and fidelity performance, also has good anti-inhibition performance, can be well applied to in-vitro amplification of DNA, especially has an excellent amplification effect on complex samples, and has good application prospects.

Description

Technical Field

[0001] The invention belongs to the technical field of molecular biology, and in particular relates to a B family DNA polymerase mutant and a construction method and application thereof. Background Art

[0002] DNA polymerase is a key substance in PCR amplification technology. The most commonly used DNA polymerases include pfuDNA polymerase, Taq DNA polymerase and B family DNA polymerase. Among them, B family DNA polymerase belongs to B family DNA polymerase, which is an enzyme molecule isolated from a strain living in an extreme environment with higher temperatures and has both DNA synthase activity and 3'-5' nuclease activity. It has relatively good amplification performance, heat resistance and fidelity performance.

[0003] However, existing B family DNA polymerases have poor tolerance to inhibitory components such as proteins and polysaccharides, which leads to inhibition of PCR amplification and has great limitations. Summary of the invention

[0004] The first purpose of the present invention is to provide a B family DNA polymerase mutant, which has excellent amplification performance and fidelity performance as well as good anti-inhibition performance, and can be well applied to in vitro amplification of DNA, especially for complex samples, and has excellent amplification effect, and has good application prospects.

[0005] The second object of the present invention is to provide a method for constructing the above-mentioned B family DNA polymerase mutant.

[0006] The third object of the present invention is to provide the use of the above-mentioned B family DNA polymerase mutant in in vitro DNA amplification.

[0007] Specifically, the B family DNA polymerase mutant provided by the present invention includes two or more of E134K mutation, E154A mutation, Y291S mutation and K317E mutation compared to the B family DNA polymerase 4K8Z with an amino acid sequence as described in SEQ ID NO: 1.

[0008] Furthermore, the B family DNA polymerase mutants include E134K mutation, Y291S mutation and K317E mutation.

[0009] Furthermore, the B family DNA polymerase mutants include E154A mutation, Y291S mutation and K317E mutation.

[0010] The method for constructing the above-mentioned B family DNA polymerase mutant provided by the present invention comprises: S1, taking the coding gene of the B family DNA polymerase 4K8Z and a plasmid vector for recombination treatment to obtain a recombinant plasmid; taking a mutation primer to carry out site-directed mutagenesis on the recombinant plasmid to obtain the construct; S2, taking the construct and introducing it into a host cell to obtain an expression strain; S3, taking the expression strain for inducing expression and purification treatment to obtain the B family DNA polymerase mutant.

[0011] Furthermore, in step S1, the nucleotide sequence of the gene encoding the B family DNA polymerase 4K8Z is shown in SEQ ID NO:2.

[0012] Further, in step S1, the plasmid vector is selected from one or more of pET-3a, pET-3b, pET-3c, pET-24a, pET-24b and pET-24c.

[0013] Furthermore, in step S1, the mutation primers include two or more of E134K mutation primers, E154A mutation primers, Y291S mutation primers and K317E mutation primers.

[0014] Furthermore, the E134K mutation primers include a forward primer having a nucleotide sequence as shown in SEQ ID NO:3 and a reverse primer as shown in SEQ ID NO:4.

[0015] Further, the Y291S mutation primers include a forward primer having a nucleotide sequence as shown in SEQ ID NO:5 and a reverse primer as shown in SEQ ID NO:6;

[0016] Further, the K317E mutation primers include a forward primer having a nucleotide sequence as shown in SEQ ID NO:7 and a reverse primer as shown in SEQ ID NO:8;

[0017] Furthermore, the E154A mutation primers include a forward primer having a nucleotide sequence as shown in SEQ ID NO:9 and a reverse primer as shown in SEQ ID NO:10.

[0018] Furthermore, in step S2, the introduction treatment includes one or more of a calcium chloride method, an electroporation method, and a lambda phage infection method.

[0019] Furthermore, in step S3, the inducing agent for inducing expression is IPTG.

[0020] Furthermore, in step S3, the temperature for inducing expression is 25-30° C. and the time is 16-18 hours.

[0021] Furthermore, in step S3, the purification treatment includes one or more of centrifugation, Ni-NTA column chromatography and dialysis.

[0022] The present invention also provides the use of the above-mentioned B family DNA polymerase mutant in in vitro DNA amplification.

[0023] Beneficial effects:

[0024] The B family DNA polymerase provided by the present invention is based on the existing known B family DNA polymerase 4K8Z, and site-directed mutations are performed on the amino acids at positions 134, 154, 291 and / or 317 in its structure to optimize the structure of the enzyme molecule and the residues of the relevant active domain, which is conducive to the conformational changes of the domain during the polymerization process and improves the resistance of the enzyme molecule to interfering substances, so that the mutant finally obtained has excellent amplification performance and fidelity performance, as well as good anti-inhibition performance, and can be well applied to PCR amplification. DETAILED DESCRIPTION

[0025] Based on a profound understanding of the correlation between the structure of B family DNA polymerase and its catalytic activity, the inventors of the present invention have creatively discovered through extensive and in-depth research that introducing two or more of the E134K mutation, E154A mutation, Y291S mutation and K317E mutation into the structure of the original B family DNA polymerase 4K8Z can greatly improve the catalytic activity, mismatch correction ability and stability of the enzyme molecule, thereby obtaining a B family DNA polymerase mutant with good amplification performance, fidelity performance and anti-inhibition performance. The amino acid sequence of the B family DNA polymerase 4K8Z is shown in SEQ ID NO: 1.

[0026] In the present invention, the E134K mutation, E154A mutation, Y291S mutation and K317E mutation are encoded by referring to the amino acid sequence shown in SEQ ID NO: 1. Among them, the E134K mutation is defined as a mutation of the amino acid residue at position 134 on the B family DNA polymerase 4K8Z from glutamic acid (E) to lysine (K). The E154A mutation is defined as a mutation of the amino acid residue at position 154 on the B family DNA polymerase 4K8Z from glutamic acid (E) to alanine (A). The Y291S mutation is defined as a mutation of the amino acid residue at position 291 on the B family DNA polymerase 4K8Z from tyrosine (Y) to serine (S). The K317E mutation is defined as a mutation of the amino acid residue at position 317 on the B family DNA polymerase 4K8Z from lysine (K) to glutamic acid (E).

[0027] In some specific embodiments, compared to the original B family DNA polymerase 4K8Z, the B family DNA polymerase mutant preferably includes E134K mutation, Y291S mutation and K317E mutation; at this time, the amino acid sequence of the B family DNA polymerase mutant is as shown in SEQ ID NO:11.

[0028] In some specific embodiments, compared to the original B family DNA polymerase 4K8Z, the B family DNA polymerase mutant preferably includes E154A mutation, Y291S mutation and K317E mutation; at this time, the amino acid sequence of the B family DNA polymerase mutant is as shown in SEQ ID NO:12.

[0029] In some specific embodiments, compared to the original B family DNA polymerase 4K8Z, the B family DNA polymerase mutant preferably includes a Y291S mutation and a K317E mutation; in this case, the amino acid sequence of the B family DNA polymerase mutant is as shown in SEQ ID NO:13.

[0030] In some specific embodiments, compared to the original B family DNA polymerase 4K8Z, the B family DNA polymerase mutant preferably includes E154A mutation and K317E mutation; in this case, the amino acid sequence of the B family DNA polymerase mutant is as shown in SEQ ID NO:14.

[0031] Based on the purpose of obtaining the above-mentioned B family DNA polymerase mutant, the present invention also provides a method for constructing a B family DNA polymerase mutant. The construction method specifically includes: S1, taking the coding gene of the B family DNA polymerase 4K8Z and the plasmid vector for recombination treatment to obtain a recombinant plasmid; taking a mutation primer to perform site-directed mutagenesis on the recombinant plasmid to obtain the construct; S2, taking the construct to introduce into a host cell to obtain an expression strain; S3, taking the expression strain for induction expression and purification treatment to obtain the B family DNA polymerase mutant.

[0032] In the present invention, in step S1, the coding gene of the B family DNA polymerase 4K8Z can be deduced based on its amino acid sequence, and the derivation method is a technical means conventionally used in the biological field, and the present invention does not impose any particular limitation on it.

[0033] In some specific embodiments, the encoding gene of the B family DNA polymerase 4K8Z is preferably codon-optimized for Escherichia coli, and its specific nucleotide sequence is shown in SEQ ID NO:2.

[0034] In some specific embodiments, specific examples of the plasmid vector include but are not limited to: one or more of pET-3a, pET-3b, pET-3c, pET-24a, pET-24b and pET-24c.

[0035] In the present invention, in step S1, the recombination treatment refers to a technique of obtaining a recombinant plasmid by appropriately cutting and modifying the target gene and the plasmid vector respectively by using restriction endonucleases, DNA ligases and other modifying enzymes, and then connecting the two together. This technique is a conventionally used technical means in the biological field and is not particularly limited in the present invention.

[0036] In the present invention, in step S1, the mutation primer refers to an oligonucleotide fragment containing a predetermined mutation site and capable of specifically recognizing and binding to the coding gene of B family DNA polymerase 4K8Z, specifically including two or more of E134K mutation primer, E154A mutation primer, Y291S mutation primer and K317E mutation primer.

[0037] In the present invention, in step S1, the E134K mutation primer refers to a nucleotide fragment that can direct the mutation of the codon encoding the 134th amino acid residue in the gene encoding B family DNA polymerase 4K8Z to a codon encoding lysine (K).

[0038] In some specific embodiments, the E134K mutation primers preferably include a forward primer having a nucleotide sequence as shown in SEQ ID NO: 3 and a reverse primer having a nucleotide sequence as shown in SEQ ID NO: 4.

[0039] In the present invention, in step S1, the Y291S mutation primer refers to a nucleotide fragment that can direct the mutation of the codon encoding the 291st amino acid residue in the gene encoding the B family DNA polymerase 4K8Z to the codon encoding serine (S).

[0040] In some specific embodiments, the Y291S mutation primer preferably includes a forward primer having a nucleotide sequence as shown in SEQ ID NO:5 and a reverse primer having a nucleotide sequence as shown in SEQ ID NO:6.

[0041] In the present invention, in step S1, the K317E mutation primer refers to a nucleotide fragment that can direct the mutation of the codon encoding the 317th amino acid residue in the gene encoding the B family DNA polymerase 4K8Z to the codon encoding glutamate (E).

[0042] In some specific embodiments, the K317E mutation primer preferably includes a forward primer having a nucleotide sequence as shown in SEQ ID NO:7 and a reverse primer having a nucleotide sequence as shown in SEQ ID NO:8.

[0043] In the present invention, in step S1, the E154A mutation primer refers to a nucleotide fragment that can direct the mutation of the codon encoding the 154th amino acid residue in the gene encoding the B family DNA polymerase 4K8Z into a codon encoding alanine (A).

[0044] In some specific embodiments, the E154A mutation primer preferably includes a forward primer having a nucleotide sequence as shown in SEQ ID NO:9 and a reverse primer having a nucleotide sequence as shown in SEQ ID NO:10.

[0045] In the present invention, in step S1, the site-directed mutagenesis refers to the use of mutant primers to perform PCR amplification on the coding gene of B family DNA polymerase 4K8Z to introduce corresponding mutations into the PCR amplification product and obtain a large number of mutated nucleotide fragments. This is a technical means commonly used in the biological field and the present invention does not impose any special limitation on it.

[0046] In the present invention, in step S2, the host cell refers to a type of cell having a protein expression system for synthesizing the B family DNA polymerase mutant, which is a technical means conventionally used in the biological field and is not particularly limited in the present invention.

[0047] In the present invention, in step S2, the introduction treatment refers to a technique of introducing the obtained construct into a host cell by means of transformation, transfection or infection, so as to ultimately achieve amplification and expression of the construct in the host cell. This is a technical means conventionally used in the biological field, and the present invention does not impose any particular limitation on it.

[0048] In some specific embodiments, specific examples of the introduction treatment include but are not limited to: one or more of a calcium chloride method, an electroporation method, and a lambda phage infection method.

[0049] In the present invention, the induced expression refers to a technology that uses additional inducers to regulate gene expression in host cells so that the host cells can express a large amount of B family DNA polymerase mutants. This is a technical means commonly used in the biological field and the present invention does not impose any special limitation on it.

[0050] In some specific embodiments, specific examples of the inducing agent used in the inducing expression include but are not limited to: IPTG.

[0051] In some specific embodiments, the conditions for inducing expression include a temperature of preferably 25 to 30°C, such as 25°C, 26°C, 27°C, 28°C, 30°C or any value therebetween; and a time of preferably 16 to 18h, such as 16h, 16.3h, 16.5h, 17h, 17.2h, 18h or any value therebetween.

[0052] In the present invention, in step S3, the purification treatment refers to a technology that can separate the B family DNA polymerase mutant from the cell culture medium and remove other impurities to obtain a high-purity B family DNA polymerase mutant. It is a technical means commonly used in the biological field and the present invention does not impose any special limitation on it.

[0053] In some specific embodiments, specific examples of the purification treatment include but are not limited to: one or more of centrifugation, Ni-NTA column chromatography and dialysis.

[0054] Based on the good amplification performance, fidelity performance and anti-inhibition performance of the above-mentioned B family DNA polymerase mutant, the present invention also provides the use of the above-mentioned B family DNA polymerase mutant in DNA in vitro amplification.

[0055] Embodiments of the present invention are described in detail below, and the examples of the embodiments are intended to be used to explain the present invention, but should not be construed as limiting the present invention. In the embodiments, if specific techniques or conditions are not specified, the techniques or conditions described in the literature in this area or the product specifications are used. If the manufacturer is not specified for reagents or instruments used, they are all conventional products that can be obtained commercially.

[0056] The reagents and their sources involved in the following examples include:

[0057] LB liquid culture medium (Solabio, catalog number L1010).

[0058] LB plate (Solebo, product number L1015).

[0059] Plasmid extraction kit (Merck, catalog number PLN350).

[0060] PCR universal premix (Thermo Fisher Scientific, catalog number A44647100).

[0061] Ni-NTA affinity chromatography column (Shanghai Biotechnology, catalog number C597593).

[0062] PCR buffer (Shanghai Chuangsai Technology, catalog number PM11657).

[0063] DNA Ladder (Thermo Fisher Scientific, catalog number SM0331).

[0064] The enzyme catalyzed reaction system includes: 1 ng salmon sperm DNA, 200 μmol / L dNTPs, 1 μCi [α-32P] dCTP, 20 mmol / L Tris-HCl, 2 mmol / L MgCl2, 5 mmol / L (NH4)2SO4, 10 mmol / L KCl, 0.1 g / L BSA and 0.05% Triton X-100, pH = 8.0.

[0065] 2×SSC buffer includes 300 mmol / L NaCl and 30 mmol / L Na3C6H5O7, pH=7.0.

[0066] Example 1

[0067] This example is used to illustrate a B family DNA polymerase mutant, which is based on the B family DNA polymerase 4K8Z with an amino acid sequence as shown in SEQ ID NO: 1, and is prepared by site-directed mutagenesis of the coding gene of the B family DNA polymerase 4K8Z (nucleotide sequence as shown in SEQ ID NO: 2) using E134K mutation primer, Y291S mutation primer and K317E mutation primer, and is prepared by genetic engineering technology, and its construction specifically includes:

[0068] 1. Construction of constructs: (1) NdeⅠ and XhoⅠ restriction sites were added to both ends of the gene encoding B family DNA polymerase 4K8Z, respectively, and then synthesized, and digested with NdeⅠ and XhoⅠ enzymes and recombined into the vector pET24a(+) to obtain a recombinant plasmid;

[0069] The recombinant plasmid was transformed into Tran5ɑ competent cells and placed in LB liquid culture medium, cultured overnight at 37°C and 200 rpm with shaking, and the plasmid was extracted from the culture medium using a plasmid extraction kit according to the instructions to obtain a large amount of recombinant plasmid.

[0070] (2) The recombinant plasmid was subjected to PCR mutation amplification using E134K mutation primer, Y291S mutation primer and K317E mutation primer to obtain mutation amplification products. The mutation amplification products were digested with DpnⅠ at 37°C for 1 h to remove the template and obtain the construct.

[0071] The specific mutation primers used are shown in Table 1. In addition, the PCR system includes: 25 μL of PCR universal premix, 1 μL of 10 μM forward primer, 1 μL of 10 μM reverse primer, 1 μL of 50 ng / μL recombinant plasmid, and ddH2O is used to make up to 50 μL. The PCR program includes: 95°C pre-denaturation for 3 min, 30 amplification cycles (95°C denaturation for 10 s, 55°C annealing for 520 s, 72°C extension for 90 s), and 72°C extension for 10 min.

[0072] Table 1.

[0073]

[0074] 2. Construction of expression strains: (1) The constructs were transformed into Tran5ɑ competent cells, spread onto LB plates containing 50 μg / mL of kana resistance, and cultured overnight at 37°C. Part of the cells from each single clone were taken for PCR identification and sequencing to screen for single clones containing the construct.

[0075] (2) A large number of constructs were extracted from the single clones, and the constructs were transformed into Escherichia coli BL21 (DE3) competent cells. The transformed cells were inoculated into LB liquid culture medium containing 50 mg / L kanamycin sulfate, and cultured overnight at 37°C and 200 rpm to obtain an expression strain.

[0076] 3. Expression and purification of B family DNA polymerase mutants: (1) Inoculate the expression strain into fresh LB liquid medium containing 50 mg / L kanamycin sulfate at a 1% inoculum volume and culture at 37°C and 200 rpm until the OD 600 =0.8, then add IPTG with a final concentration of 0.1 mmol / mL, and culture at 30°C and 200 rpm for 16 h to obtain the induced expression culture medium.

[0077] (2) The induced expression culture medium was centrifuged at 4°C and 10,000 rpm for 10 min to collect the cell mud; the cell mud was resuspended in 15 mL of 50 mM Tris-HCl buffer (pH = 7.5), and the cells were ultrasonically disrupted in an ice bath for 10 min in the form of working 4 s and resting 4 s, and centrifuged at 4°C and 10,000 rpm for 10 min. The supernatant was collected and purified using a Ni-NTA affinity chromatography column to obtain a B family DNA polymerase mutant.

[0078] The amino acid sequence of the B family DNA polymerase mutant provided in this example is shown in SEQ ID NO:11.

[0079] Example 2

[0080] The B family DNA polymerase mutant provided in this example has E154A mutation, Y291S mutation and K317E mutation compared to the B family DNA polymerase 4K8Z, and its amino acid sequence is specifically shown in SEQ ID NO:12.

[0081] In this embodiment, the method provided in Example 1 is used to construct a B family DNA polymerase mutant, except that the mutant primer system used in "Step 1, construction of construct" is different, specifically including E154A mutant primer, Y291S mutant primer and K317E mutant primer, as shown in Tables 1 and 2, and other conditions are the same to obtain the B family DNA polymerase mutant.

[0082] Table 2.

[0083]

[0084] Example 3

[0085] The B family DNA polymerase mutant provided in this example has a Y291S mutation and a K317E mutation compared to the B family DNA polymerase 4K8Z, and its amino acid sequence is specifically shown in SEQ ID NO:13.

[0086] In this embodiment, the method provided in Example 1 is used to construct a B family DNA polymerase mutant, except that the mutant primer system used in "Step 1, construction of construct" is different, specifically including E154A mutant primer, Y291S mutant primer and K317E mutant primer, as shown in Tables 1 and 2, and other conditions are the same to obtain the B family DNA polymerase mutant.

[0087] Example 4

[0088] The B family DNA polymerase mutant provided in this example has E154A mutation and K317E mutation compared to the B family DNA polymerase 4K8Z, and its amino acid sequence is specifically shown in SEQ ID NO:14.

[0089] In this embodiment, the method provided in Example 1 is used to construct a B family DNA polymerase mutant, except that the mutant primer system used in "Step 1, construction of construct" is different, specifically including E154A mutant primer and K317E mutant primer, as shown in Tables 1 and 2, and other conditions are the same to obtain the B family DNA polymerase mutant.

[0090] Example 5

[0091] This example is used to illustrate the enzymatic activity of the B family DNA polymerase mutants provided in Examples 1 to 4, with the original B family DNA polymerase 4K8Z as a control. The test specifically includes:

[0092] (1) The B family DNA polymerase mutant and the B family DNA polymerase 4K8Z were respectively mixed with nuclease-free water to prepare an enzyme solution with a concentration of 0.05 μg / μL.

[0093] (2) Using salmon sperm DNA as a template / primer, 1 μL of enzyme solution was added to 10 mL of enzyme-catalyzed reaction system, and the enzyme-catalyzed reaction was carried out at 74° C. for 30 min. After the reaction was completed, the reaction was immediately terminated on ice to obtain a reaction product.

[0094] (3) Take 5 μL of the reaction product and add it to the ion exchange paper disk. After the spot is dried, rinse it three times with 2×SSC buffer, and finally wash it once with anhydrous ethanol after ice bath and dry it. The infiltrated radioactive substances are measured by liquid scintillation counter. Among them, 1 enzyme activity unit is defined as the amount of enzyme that catalyzes the incorporation of 10 nmol of dNTPs into DNA. The results are shown in Table 1.

[0095] Table 3.

[0096] Group Enzyme activity (U / μL) Example 1 18.94 Example 2 19.01 Example 3 16.75 Example 4 13.96 B family DNA polymerase 4K8Z 12.03

[0097] From the test results shown in Table 1, it can be seen that compared with the currently known B family DNA polymerase 4K8Z, the enzyme activity of the B family DNA polymerase mutant provided in the present invention is 13.96-19.01 U / μL, and the enzyme catalytic activity is significantly improved.

[0098] Example 6

[0099] This example is used to illustrate the amplification performance of the B family DNA polymerase mutants provided in Examples 1 to 4, and the original B family DNA polymerase 4K8Z is used as a control. The test specifically includes:

[0100] (1) The B family DNA polymerase mutant and the B family DNA polymerase 4K8Z were respectively mixed with nuclease-free water to prepare an enzyme solution with a concentration of 0.05 μg / μL.

[0101] (2) Human genomic DNA was used as a template and PCR amplification was performed using the primer system shown in Table 4 to obtain PCR amplification products of 1 kb, 2 kb, 4 kb, 8 kb and 16 kb in length. The PCR reaction system included: 2.5 μL human genomic DNA (4 mg / L), 0.5 μL dNTPs (10 mmol / L), 2.5 μL PCR amplification buffer, 2.5 μL BSA (1 mg / L), 0.5 μL each of upstream and downstream primers (10 nmol / L), 1 μL enzyme solution, and ddH2O was added to make up to 25 μL. The PCR reaction procedure included: 95°C pre-denaturation for 3 min; 95°C denaturation for 15 s; 58°C annealing for 15 s; 72°C extension for 2 min; 30 cycles; 72°C extension for 5 min.

[0102] Table 4.

[0103] name sequence Amplification length Universal forward primer ATGTGTGTAACACTAACATAGCTTA - Primer 1kb-R AATAATGTAGATCAGGCATGGTGTC 1kb Primer 2kb-R TCCGTGGCCTGTTAGGAACCAGGCT 2kb Primer 4kb-R AGAGAAGTTTGGCAGAGGAAATTGT 4kb Primer 8kb-R CTGCACCCCAGCCTGGTGAAAAAGC 8kb

[0104] (3) 0.5 μL of PCR amplification product and DNALadder were taken for gel electrophoresis respectively. The grayscale of the gel electrophoresis bands was analyzed by Image J and normalized with reference to the total intensity of the DNALadder bands to obtain the normalized intensity of each band. The results are shown in Table 5.

[0105] Table 5.

[0106]

[0107] It can be seen from the test results shown in Table 5 that, compared with the currently known B family DNA polymerase 4K8Z, the B family DNA polymerase mutant provided in the embodiments of the present invention has better amplification performance.

[0108] Example 7

[0109] This example is used to illustrate the fidelity performance of the B family DNA polymerase mutants provided in Examples 1 to 4, and the original B family DNA polymerase 4K8Z is used as a control. The test specifically includes:

[0110] (1) The B family DNA polymerase mutant and the B family DNA polymerase 4K8Z were respectively mixed with nuclease-free water to prepare an enzyme solution with a concentration of 0.05 μg / μL.

[0111] (2) Plasmid pUC19 was used as a template and the primer system shown in Table 6 was used for PCR amplification to obtain PCR amplification products. The PCR reaction system included: 2.5 μL of plasmid pUC19 (4 mg / L), 0.5 μL of dNTPs (10 mmol / L), 2.5 μL of PCR amplification buffer, 2.5 μL of BSA (1 mg / L), 0.5 μL of upstream and downstream primers (10 nmol / L), 1 μL of enzyme solution, and ddH2O was added to 25 μL. The PCR reaction procedure included: 95°C pre-denaturation for 3 min; 95°C denaturation for 15 s; 58°C annealing for 15 s; 72°C extension time for 2 min; 30 cycles; 72°C extension for 5 min.

[0112] Table 6.

[0113] name sequence Primer pUC19F CCAGGCTTTACACTTTATGC Primer pUC19R TGGCTTAACTATGCGGCATC

[0114] (3) The PCR amplification product was transformed into Escherichia coli DH5α competent cells and spread onto a solid LB plate containing 100 mg / mL ampicillin. The plate was cultured overnight at 37°C to obtain single colonies. The number of blue colonies and white colonies on the plate culture medium was recorded, where the blue colonies were normal and the white colonies were mutants. The mismatch rate was calculated and the results are shown in Table 7.

[0115] Table 7.

[0116] Group <![CDATA[Mismatch rate (×10 -6 )]]> Example 1 7.38 Example 2 8.10 Example 3 6.52 Example 4 4.37 B family DNA polymerase 4K8Z 12.5

[0117] It can be seen from the test results shown in Table 7 that, compared with the currently known B family DNA polymerase 4K8Z, the B family DNA polymerase mutant provided by the embodiments of the present invention has excellent fidelity performance.

[0118] Example 8

[0119] This example is used to illustrate the inhibitory performance of the B family DNA polymerase mutants provided in Examples 1 to 4, and the original B family DNA polymerase 4K8Z is used as a control. The test specifically includes:

[0120] (1) The B family DNA polymerase mutant and the B family DNA polymerase 4K8Z were respectively mixed with nuclease-free water to prepare an enzyme solution with a concentration of 0.05 μg / μL.

[0121] (2) 1 mL of the collected sputum was mixed with 0.1 mL of sodium hydroxide solution (0.1 M), liquefied for 30 min, and 10 mL of Tris-HCl buffer (1 mM, pH = 7.5) was added and mixed evenly to obtain an interference solution; human genomic DNA was added in an amount of 4 mg / L and mixed with the interference solution to obtain a DNA sample to be tested.

[0122] (3) The enzyme solution and the primer system shown in Table 4 were used to perform PCR amplification on the DNA sample to be tested, and a PCR amplification product with a length of 1 kb was obtained. The PCR reaction system includes: 2.5 μL of the DNA sample to be tested, 0.5 μL of dNTPs (10 mmol / L), 2.5 μL of PCR amplification buffer, 2.5 μL of BSA (1 mg / L), 0.5 μL of each upstream and downstream primer (10 nmol / L), 1 μL of enzyme solution, and ddH2O was added to make up to 25 μL. The PCR reaction program includes: 95°C pre-denaturation for 3 min; 95°C denaturation for 15 s; 58°C annealing for 15 s; 72°C extension time for 2 min; 30 cycles; 72°C extension for 5 min.

[0123] (4) 0.5 μL of PCR amplification product and DNA Ladder were respectively taken for gel electrophoresis, and the grayscale of the gel electrophoresis bands was analyzed using Image J and normalized with reference to the total intensity of the DNA Ladder bands to obtain the normalized intensity of each band. The results are shown in Table 8.

[0124] Table 8.

[0125] Group Normalized intensity of band Example 1 1.02 Example 2 0.67 Example 3 0.71 Example 4 0.59 B family DNA polymerase 4K8Z 0.13

[0126] It can be seen from the test results shown in Table 8 that, compared with the currently known B family DNA polymerase 4K8Z, the B family DNA polymerase mutant provided by the embodiments of the present invention has good anti-inhibition performance.

[0127] Although the embodiments of the present invention have been shown and described above, it is to be understood that the above embodiments are exemplary and are not to be construed as limitations on the present invention. A person skilled in the art may change, modify, replace and modify the above embodiments within the scope of the present invention without departing from the principles and purpose of the present invention.

[0128] The amino acid sequences and nucleotide sequences involved in the present invention are specifically shown in Table 9.

[0129] Table 9.

[0130]

[0131]

[0132]

[0133]

Claims

1. A B family DNA polymerase mutant, characterized in that: Compared with the B family DNA polymerase 4K8Z with an amino acid sequence as described in SEQ ID NO: 1, the B family DNA polymerase mutant includes two or more of E134K mutation, E154A mutation, Y291S mutation and K317E mutation.

2. The B family DNA polymerase mutant according to claim 1, characterized in that The B family DNA polymerase mutants include E134K mutation, Y291S mutation and K317E mutation.

3. The B family DNA polymerase mutant according to claim 1, characterized in that The B family DNA polymerase mutants include E154A mutation, Y291S mutation and K317E mutation.

4. The method for constructing a B family DNA polymerase mutant according to any one of claims 1 to 3, characterized in that: The construction method comprises: S1, taking the coding gene of the B family DNA polymerase 4K8Z and a plasmid vector for recombination treatment to obtain a recombinant plasmid; taking a mutation primer for site-directed mutation of the recombinant plasmid to obtain the construct; S2, taking the construct for introduction treatment into a host cell to obtain an expression strain; S3, taking the expression strain for inducing expression and purification treatment to obtain the B family DNA polymerase mutant.

5. The method for constructing a B family DNA polymerase mutant according to claim 4, characterized in that: In step S1, the nucleotide sequence of the gene encoding the B family DNA polymerase 4K8Z is shown in SEQ ID NO: 2; Optionally, the plasmid vector is selected from one or more of pET-3a, pET-3b, pET-3c, pET-24a, pET-24b and pET-24c.

6. The method for constructing a B family DNA polymerase mutant according to claim 4, characterized in that: In step S1, the mutation primers include two or more of E134K mutation primers, E154A mutation primers, Y291S mutation primers and K317E mutation primers; Optionally, the E134K mutation primers include a forward primer having a nucleotide sequence as shown in SEQ ID NO: 3 and a reverse primer as shown in SEQ ID NO: 4; Optionally, the Y291S mutation primers include a forward primer having a nucleotide sequence as shown in SEQ ID NO: 5 and a reverse primer as shown in SEQ ID NO: 6; Optionally, the K317E mutation primers include a forward primer having a nucleotide sequence as shown in SEQ ID NO: 7 and a reverse primer as shown in SEQ ID NO: 8; Optionally, the E154A mutation primers include a forward primer having a nucleotide sequence as shown in SEQ ID NO:9 and a reverse primer as shown in SEQ ID NO:

10.

7. The method for constructing a B family DNA polymerase mutant according to claim 5, characterized in that: In step S2, the introduction treatment includes one or more of a calcium chloride method, an electroporation method, and a lambda phage infection method.

8. The method for constructing a B family DNA polymerase mutant according to claim 5, characterized in that: In step S3, the inducing agent for inducing expression is IPTG; Optionally, the induction expression temperature is 25-30°C and the time is 16-18 hours.

9. The method for constructing a B family DNA polymerase mutant according to claim 5, characterized in that: In step S3, the purification treatment includes one or more of centrifugation, Ni-NTA column chromatography and dialysis.

10. Use of the B family DNA polymerase mutant according to any one of claims 1 to 3 in in vitro DNA amplification.

Images