Nucleic acid treatment reagent, detection reagent, detection kit, microfluidic system, detection method and application thereof

Abstract

The invention belongs to the technical field of biology, and discloses a nucleic acid treatment reagent, a detection reagent, a detection kit, a microfluidic system, a detection method and application thereof. According to the nucleic acid treatment reagent disclosed by the invention, the hydrolase, the surfactant, the guanidine compound, the surfactin, the phenol red, the oligosaccharide, the sugar alcohol and the magnesium sulfate in a specific mass ratio have a synergistic effect, and genome nucleic acid is fully released; and the kit has a good inhibition effect on PCR inhibitors existing in respiratory tract samples, sputum samples and other samples, and provides an inhibition-resistant buffer system for subsequent qPCR amplification reaction. In actual detection, a mixed solution obtained by mixing the nucleic acid treatment reagent with common samples such as a respiratory tract sample and a sputum sample can be directly subjected to qPCR amplification reaction, so that a complicated sample pretreatment step can be omitted, sample pretreatment and qPCR amplification can be completed within 5 minutes, rapid nucleic acid detection of the samples can be realized, and the detection sensitivity is high. Therefore, the method can be well applied to on-site rapid detection and has a huge application prospect.

Description

Technical Field

[0001] The present invention belongs to the field of biotechnology, and in particular relates to a nucleic acid processing reagent, a detection reagent, a detection kit, a microfluidic system, a detection method and applications thereof. Background Art

[0002] In vitro nucleic acid amplification technology refers to a technology that amplifies specific nucleic acid sequences in vitro (i.e. inside non-living organisms). It is widely used in scientific research, medicine, food science and other fields. It can be specifically divided into polymerase chain reaction, cDNA end rapid amplification technology and isothermal amplification technology.

[0003] Among them, polymerase chain reaction (PCR) refers to the use of thermal cycling methods of denaturation, annealing and extension to achieve the dissociation of DNA double strands, the binding of primers and the extension of DNA daughter strands, thereby achieving the amplification of trace target DNA, and qPCR technology is the most widely studied and used technology. At present, a variety of methods such as membrane filtration, nuclease treatment, organic solvent extraction, centrifugation, precipitation and column chromatography are used to pre-treat the test samples to obtain nucleic acid templates, and poor quality nucleic acid templates will greatly affect the amplification efficiency and may even cause amplification failure. Therefore, it is necessary to adopt complex sample pre-treatment steps to achieve sufficient extraction of nucleic acids in the test samples and effective removal of PCR inhibitors, so as to obtain high-quality nucleic acid templates.

[0004] However, the complex pre-processing steps greatly limit the application of qPCR in rapid on-site testing and have great limitations. Summary of the invention

[0005] The first purpose of the present invention is to provide a nucleic acid treatment reagent, which can not only achieve a good lysis effect on pathogens and fully release genomic nucleic acids through the synergistic effect of hydrolases, surfactants, guanidine compounds, surfactants, phenol red, oligosaccharides, sugar alcohols and magnesium sulfate in a specific mass ratio; at the same time, it has a good inhibitory effect on PCR inhibitors present in common samples such as respiratory samples and sputum samples, and can provide an inhibition-resistant buffer system for subsequent qPCR amplification reactions. In actual detection, the mixed solution obtained by mixing the above-mentioned nucleic acid treatment reagent with common samples such as respiratory samples and sputum samples can directly perform qPCR amplification reactions, which can avoid complex sample pre-treatment steps, achieve rapid qPCR amplification of nucleic acids, and can be well applied to rapid on-site detection, with great application prospects.

[0006] The second object of the present invention is to provide a nucleic acid detection kit.

[0007] The third object of the present invention is to provide a microfluidic system.

[0008] The fourth object of the present invention is to provide a method for nucleic acid detection.

[0009] A fifth object of the present invention is to provide the use of the above-mentioned nucleic acid processing reagent, nucleic acid detection kit and / or microfluidic system in non-diagnostic nucleic acid detection.

[0010] Specifically, the nucleic acid processing reagent provided by the present invention includes a hydrolase, a surfactant, a guanidine compound, a surfactant, phenol red, an oligosaccharide, a sugar alcohol and magnesium sulfate in a mass ratio of (0.1-0.6):(0.01-1):(1-10):(50-100):(0.01-0.1):(5-50):(10-250):(0.1-1).

[0011] Furthermore, the hydrolase is selected from proteinase K and / or lysozyme.

[0012] Furthermore, the surfactant is selected from nonionic surfactants and / or anionic surfactants.

[0013] Furthermore, the guanidine compound is selected from one or more of guanidine isothiocyanate, guanidine hydrochloride, guanidine thiocyanate and aminoguanidine sulfate.

[0014] Furthermore, the oligosaccharide is selected from one or more of trehalose, sucrose, stachyose, maltose and fructose.

[0015] Furthermore, the sugar alcohol is selected from one or more of mannitol, maltitol, erythritol and xylitol.

[0016] Furthermore, the nucleic acid treating agent comprises hydrolase, surfactant, guanidine compound, surfactin, phenol red, oligosaccharide, sugar alcohol and magnesium sulfate in a mass ratio of (0.1-0.55):(0.06-0.3):(2-9):(50-80):(0.01-0.05):(6-40):(25-200):(0.1-0.75).

[0017] Furthermore, the hydrolase includes proteinase K and / or lysozyme, the surfactant includes Tween and sodium dodecyl sulfate, the guanidine compound includes guanidine hydrochloride and guanidine isothiocyanate, the oligosaccharide includes trehalose and sucrose, and the sugar alcohol is mannitol.

[0018] The nucleic acid detection reagent provided by the present invention comprises the above-mentioned nucleic acid processing reagent and PCR reaction agent.

[0019] Furthermore, the PCR reagents include UNG enzyme, Taq enzyme and reverse transcriptase.

[0020] The microfluidic device provided by the present invention comprises: a main body, wherein the main body comprises a sample injection chamber, a microfluidic channel, a mixing chamber and a qPCR reaction chamber; one end of the microfluidic channel is movably inserted in the sample injection chamber and communicated with the sample injection chamber, and the other end is communicated with the mixing chamber; a PCR reactant is arranged in the mixing chamber, and a puncture part and a sensor are arranged in the qPCR reaction chamber, wherein the puncture part is used to destroy the mixing chamber to release the sample to be tested to the qPCR reaction chamber, and the sensor is used to control the reaction conditions and detect the fluorescent signal; a sample loading column, wherein the sample loading column is movably inserted on a side of the sample injection chamber away from the microfluidic channel, wherein the sample loading column drives the microfluidic channel and the mixing chamber to move in a direction close to the qPCR reaction chamber, and the sample loading column, the microfluidic channel, the sample injection chamber and the qPCR reaction chamber can form a closed space.

[0021] Furthermore, the main body includes an overflow portion arranged at the periphery of the microchannel, and when the microchannel leaves the sample injection chamber, the overflow portion is communicated with the sample injection chamber.

[0022] The nucleic acid detection kit provided by the present invention comprises the above-mentioned nucleic acid processing reagent, nucleic acid detection reagent and / or microfluidic device.

[0023] The nucleic acid detection method provided by the present invention uses the above-mentioned microfluidic device to detect the sample to be tested, specifically comprising: taking the sample to be tested and mixing it with the above-mentioned nucleic acid treatment agent to obtain a test liquid; taking the test liquid and adding it to the microfluidic system and mixing it with the above-mentioned PCR reaction agent, performing qPCR amplification, and obtaining the detection result.

[0024] Furthermore, based on the volume of the sample to be tested, the amount of the nucleic acid treatment agent added is 100-500 μg / μL.

[0025] Furthermore, based on the volume of the test solution, the amount of the PCR reagent added is 1 to 15 μg / μL.

[0026] The present invention also provides the use of the above-mentioned nucleic acid processing reagent, nucleic acid detection reagent, microfluidic device and / or nucleic acid detection kit in non-diagnostic nucleic acid detection. BRIEF DESCRIPTION OF THE DRAWINGS

[0027] Figure 1 A schematic diagram of the structure of the microfluidic device provided in Example 1 of the present invention;

[0028] Figure 2 for Figure 1 Sectional view of AA.

[0029] Figure numerals: 1. main body; 11. first part; 12. second part; 2. sample addition column; 3. sample injection chamber; 4. microfluidic channel; 5. mixing chamber; 6. qPCR reaction chamber; 7. puncture part; 8. sensor; 9. overflow part. DETAILED DESCRIPTION

[0030] Based on the problems existing in existing nucleic acid detection, such as complex sample pretreatment steps and strong PCR inhibition, the inventors of the present invention have conducted in-depth and extensive research and found that a complex obtained by compounding hydrolases, surfactants, guanidine compounds, surfactin, phenol red, oligosaccharides, sugar alcohols and magnesium sulfate in a specific proportion can effectively alleviate the inhibition in the qPCR amplification process while fully releasing the nucleic acids of pathogens in common samples such as respiratory samples and sputum samples, thereby obtaining the technical solution of the present invention.

[0031] The nucleic acid treating agent provided by the present invention specifically includes hydrolases, surfactants, guanidine compounds, surfactins, phenol red, oligosaccharides, sugar alcohols and magnesium sulfate in a mass ratio of (0.1-0.6):(0.01-1):(1-10):(50-100):(0.01-0.1):(5-50):(10-250):(0.1-1), such as 0.1:0.01:1:50:0.01:5:10:0.1, 0.3:1:8:75:0.1:31:41:1, 0.4:0.5:10:100:0.1:50:250:100, 0.5:0.5:10:100:0.1:50:250:1 or any value therebetween.

[0032] In the present invention, the hydrolase refers to an enzyme substance that can catalyze the hydrolysis of pathogens and release genomic nucleic acids; specific examples thereof include but are not limited to: proteinase K and / or lysozyme.

[0033] In the present invention, the surfactant refers to an amphiphilic substance containing both hydrophilic and lipophilic groups in its structure, which can form a thin film on the surface of the liquid and change the surface tension of the liquid; its specific examples include but are not limited to: one or more of non-ionic surfactants, cationic surfactants and anionic surfactants. Among them, the non-ionic surfactant refers to a type of surfactant in which the hydrophilic group and the lipophilic group contained in the molecular structure are combined by hydrogen bonds or other non-ionic methods and will not dissociate in the solution. Its specific examples include but are not limited to: one or more of octylphenol polyoxyethylene ether, stearic acid glyceryl ester, polyethylene glycol 600, Tween 20 and glycerol. The cationic surfactant refers to a type of surfactant that can dissociate into positively charged particles in an aqueous solution, and its specific examples include but are not limited to: one or more of dodecyl trimethyl ammonium bromide, cetyl trimethyl ammonium bromide chloride, cetyl pyridinium chloride and cationic polyacrylamide. The anionic surfactant refers to a type of surfactant that can dissociate into negatively charged particles in an aqueous solution, and its specific examples include but are not limited to: one or more of sodium dodecyl sulfate, sodium dodecylbenzene sulfonate and sodium stearate.

[0034] In some specific embodiments, the surfactant preferably includes a nonionic surfactant and an anionic surfactant. In this case, the nucleic acid treating agent can reduce the formation of non-specific secondary structures of nucleic acids and primers, and effectively alleviate the qPCR inhibition phenomenon.

[0035] In the present invention, the guanidine compound refers to a class of organic compounds containing a guanidine group in the molecule; specific examples thereof include but are not limited to: one or more of guanidine isothiocyanate, guanidine hydrochloride, guanidine thiocyanate and aminoguanidine sulfate.

[0036] In the present invention, the oligosaccharide refers to an oligosaccharide or polysaccharide formed by connecting multiple monosaccharide molecules through glycosidic bonds; specific examples thereof include but are not limited to: one or more of trehalose, sucrose, stachyose, maltose and fructose.

[0037] In the present invention, the sugar alcohol refers to a compound obtained by replacing part or all of the hydroxyl groups in a sugar molecule with hydrogen atoms; specific examples thereof include but are not limited to: one or more of mannitol, maltitol, erythritol and xylitol.

[0038] In the present invention, the nucleic acid treatment agent preferably includes a hydrolase, a surfactant, a guanidine compound, a surfactant, a phenol red, an oligosaccharide, a sugar alcohol and magnesium sulfate in a mass ratio of (0.1-0.55):(0.06-0.3):(2-9):(50-80):(0.01-0.05):(6-40):(25-200):(0.1-0.75); wherein the hydrolase includes proteinase K and / or lysozyme, the surfactant includes Tween and sodium dodecyl sulfate, the guanidine compound includes guanidine hydrochloride and guanidine isothiocyanate, the oligosaccharide includes trehalose and sucrose, and the sugar alcohol is mannitol. At this time, the nucleic acid treatment agent can completely lyse the pathogen and fully release the genomic nucleic acid while having an excellent anti-inhibition effect on the qPCR reaction.

[0039] The nucleic acid detection reagent provided by the present invention specifically includes the above-mentioned nucleic acid treatment reagent and PCR reagent. Among them, the PCR reagent is a reaction system commonly used in existing qPCR amplification, and those skilled in the art can make adaptive selections according to actual needs. The present invention does not impose any particular restrictions on its specific components and their contents.

[0040] In some specific embodiments, the PCR reaction agent preferably includes UNG enzyme, Taq enzyme and reverse transcriptase as a composite enzyme system, which can realize rapid reverse transcription of RNA viruses in the PCR reaction system, and can realize nucleic acid detection of pathogenic bacteria, mycoplasma, DNA viruses and RNA viruses, etc., and has a wider adaptability.

[0041] In some specific embodiments, the specific components of the PCR reagent may include but are not limited to: Tris-HCl (pH=8-8.5), magnesium chloride, dNTP, UNG enzyme, Taq enzyme, reverse transcriptase and primers.

[0042] The microfluidic device provided by the present invention specifically includes: a main body, which includes a sample injection chamber, a microfluidic channel, a mixing chamber and a qPCR reaction chamber; one end of the microfluidic channel is movably inserted in the sample injection chamber and connected with the sample injection chamber, and the other end is connected with the mixing chamber; PCR reactants are arranged in the mixing chamber, and a puncture part and a sensor are arranged in the qPCR reaction chamber, the puncture part is used to destroy the mixing chamber to release the sample to be tested to the qPCR reaction chamber, and the sensor is used to control the reaction conditions and detect the fluorescent signal; a sample loading column, the sample loading column is movably inserted on a side of the sample injection chamber away from the microfluidic channel, the sample loading column drives the microfluidic channel and the mixing chamber to move in a direction close to the qPCR reaction chamber, and the sample loading column, microfluidic channel, sample injection chamber and qPCR reaction chamber can form a closed space.

[0043] In the present invention, when the microfluidic device is used for detection, the sample to be tested is mixed with the above-mentioned nucleic acid treatment agent in advance to obtain a test liquid and added to the sample injection chamber. First, the sample injection column is pushed to drive the test liquid to enter the mixing chamber through the microfluidic channel to be fully mixed with the PCR reactant. Through the cooperation of the sample injection column, the microfluidic channel and the mixing chamber, the accurate injection of the test liquid is achieved. At the same time, through the cooperation of the nucleic acid treatment agent and the microfluidic channel, the pathogen is fully lysed and the nucleic acid is effectively released during the injection process. Then, the sample injection column continues to move to drive the mixing chamber to enter the qPCR reaction chamber until the qPCR reaction chamber is closed to form a closed reaction environment, and the puncture part destroys the mixing chamber to release the test liquid in the qPCR reaction chamber for qPCR amplification reaction and fluorescence signal detection. The use of the microfluidic device can realize the integration of automatic injection, fully closed reaction and reading of test results, which has the advantages of convenience, efficiency and speed, and can be well applied to various scenes such as customs, border inspection, clinics, hospitals and personal homes, and has a wide range of applications.

[0044] In the present invention, the cross-sectional area of ​​the sample injection chamber preferably gradually decreases along the direction close to the microfluidic channel, and the sample loading column and the sample injection chamber are in gap fit. At this time, the sample injection chamber has a flow-guiding effect, so that the liquid to be tested can enter the microfluidic channel well under the drive of the sample loading column, and the sample injection chamber and the sample loading column can jointly apply a force to the liquid to be tested, which can further improve the effect of pathogen lysis and nucleic acid release.

[0045] In the present invention, the channel equivalent diameter of the microfluidic channel is preferably 10 to 50 μm, such as 10 μm, 10.5 μm, 11 μm, 13 μm, 18 μm, 20 μm, 25 μm, 30 μm, 40 μm, 50 μm or any value therebetween; the length is preferably 20 μm to 50 μm, such as 20 μm, 23 μm, 25 μm, 30 μm, 38 μm, 40 μm, 50 μm or any value therebetween. At this time, the microfluidic channel can achieve a better processing effect on the liquid to be tested, and will not have much impact on the accuracy of the injection volume.

[0046] In the present invention, the volume of the mixing chamber is preferably 30 to 50 μL, such as 30 μL, 31 μL, 35 μL, 37 μL, 40 μL, 43 μL, 45 μL, 50 μL or any value therebetween; the mass of the PCR reactant in the mixing chamber is 50 to 500 μg, such as 50 μg, 55 μg, 60 μg, 68 μg, 70 μg, 100 μg, 138 μg, 170 μg, 200 μg, 250 μg, 300 μg, 400 μg, 500 μg or any value therebetween. At this time, the concentrations of the nucleic acid template, enzyme and dNTP in the qPCR reaction system are appropriate, which is conducive to reducing PCR inhibition and achieving better detection effects.

[0047] In the present invention, the main body preferably includes a first part and a second part, the first part and the second part are detachably connected, the sample injection chamber is arranged on the first part, the microfluidic channel, the mixing chamber and the qPCR reaction chamber are arranged on the second part, and the microfluidic channel and the mixing chamber are arranged in one piece. In this case, the PCR reactants can be pre-packaged in the mixing chamber, so that the addition of PCR reactants can be achieved by simply replacing the microfluidic channel and the mixing chamber each time the test is performed, thereby improving the convenience of use of the microfluidic device.

[0048] In the present invention, the sensor provided in the qPCR reaction chamber can be used for controlling the qPCR reaction temperature and measuring and collecting the fluorescence signal. It is a type of device commonly used in existing qPCR detection devices, and the present invention does not impose any particular limitation on it.

[0049] In the present invention, the main body preferably includes an overflow portion arranged at the periphery of the microfluidic channel, and when the microfluidic channel leaves the sample injection chamber, the overflow portion is connected to the sample injection chamber. At this time, if the added volume of the test liquid is greater than the preset mixing chamber volume, the excess test liquid will automatically overflow into the overflow portion through the opening connecting the sample injection chamber and the microfluidic channel, which can further improve the accuracy of the added sample volume.

[0050] The nucleic acid detection kit provided by the present invention specifically includes the above-mentioned nucleic acid processing reagent, nucleic acid detection kit and / or microfluidic device.

[0051] The nucleic acid detection method provided by the present invention uses the above-mentioned microfluidic device to detect the sample to be tested, and more specifically includes the following steps: taking the sample to be tested and mixing it with the above-mentioned nucleic acid treatment agent to obtain a test liquid; taking the test liquid and adding it to the microfluidic system and mixing it with the above-mentioned PCR reactant, performing qPCR amplification, and obtaining the detection result.

[0052] In the present invention, the sample to be tested refers to a substance collected from an organism or the environment and is used for nucleic acid detection. Specific examples thereof include but are not limited to: biological samples and / or environmental samples.

[0053] In some specific embodiments, based on the volume of the sample to be tested, the amount of the nucleic acid treatment agent added is preferably 100-500 μg / μL, such as 100 μg / μL, 112 μg / μL, 140 μg / μL, 185 μg / μL, 200 μg / μL, 300 μg / μL, 400 μg / μL, 500 μg / μL or any value therebetween.

[0054] In some specific embodiments, based on the volume of the test solution, the added amount of the PCR reactant is preferably 1-15 μg / μL, such as 1 μg / μL, 1.5 μg / μL, 1.8 μg / μL, 2 μg / μL, 2.8 μg / μL, 5 μg / μL, 10 μg / μL, 12.5 μg / μL, 15 μg / μL or any value therebetween.

[0055] The present invention also provides the use of the above-mentioned nucleic acid processing reagent, nucleic acid detection reagent, microfluidic device, and nucleic acid detection kit in non-diagnostic nucleic acid detection.

[0056] Embodiments of the present invention are described in detail below, and the examples of the embodiments are intended to be used to explain the present invention, but should not be construed as limiting the present invention. In the embodiments, if specific techniques or conditions are not specified, the techniques or conditions described in the literature in this area or the product specifications are used. If the manufacturer is not specified for reagents or instruments used, they are all conventional products that can be obtained commercially.

[0057] The reagents used in the following preparation examples and comparative examples include:

[0058] Proteinase K (Aladdin, catalog number P274341);

[0059] Lysozyme (Aladdin, catalog number L105521);

[0060] UNG enzyme (Shengyi (Xiamen) Biotechnology Co., Ltd., catalog number CTT09872);

[0061] Taq enzyme (Shengyi (Xiamen) Biotechnology Co., Ltd., catalog number CTAQ001);

[0062] Reverse transcriptase (Shengyi (Xiamen) Biotechnology Co., Ltd., catalog number CMMLV002);

[0063] Influenza A pseudovirus (Shanghai Biotech, catalog number P1387654);

[0064] Influenza B pseudovirus (Shanghai Biotechnology, catalog number P0982313);

[0065] Mycoplasma nucleic acid (Shanghai Biotechnology, catalog number P0093522).

[0066] The samples and their acquisition methods involved in the following embodiments specifically include:

[0067] (1) Respiratory tract pharyngeal swab sample to be tested: Insert the swab completely from the mouth into the throat (or nasal cavity), across the root of the tongue to the posterior pharyngeal wall or the back of the uvula, and wipe the patient's posterior pharyngeal wall and tonsils on both sides with appropriate force. When removing the swab, be careful not to touch the tongue, oral mucosa and saliva; insert the collected swab into 1 mL of normal saline, rotate it against the inner wall of the test tube for about 10 times, then squeeze the swab head along the inner wall of the sample preservation liquid tube, remove the swab, and tighten the tube cap to obtain the respiratory tract pharyngeal swab sample to be tested.

[0068] (2) Sputum sample to be tested: Collect 1 mL of sputum into a sputum bottle, cover it with a lid, gently mix the sputum sample, add 1 mL of sodium hydroxide solution and liquefy it for 30 minutes to obtain the sputum sample to be tested.

[0069] Preparation Example 1

[0070] This preparation example is used to illustrate the preparation of a nucleic acid treatment reagent, specifically comprising: taking proteinase K, lysozyme, Tween 20, sodium dodecyl sulfate, guanidine hydrochloride, guanidine isothiocyanate, surfactin, phenol red, trehalose, sucrose, mannitol and magnesium sulfate in a mass ratio of 0.40:0.01:0.81:1.83:2.17:5.39:80.00:0.04:18.76:15.62:199.64:0.54 and mixing them evenly to obtain the nucleic acid treatment reagent.

[0071] Preparation Example 2

[0072] This preparation example is used to illustrate the preparation of a nucleic acid treatment reagent, specifically comprising: taking lysozyme, Tween 20, sodium dodecyl sulfate, guanidine hydrochloride, guanidine isothiocyanate, surfactin, phenol red, trehalose, sucrose, mannitol and magnesium sulfate in a mass ratio of 0.01:0.07:0.18:2.09:5.39:82.96:0.04:18.76:15.62:199.64:0.54 and mixing them evenly to obtain the nucleic acid treatment reagent.

[0073] Preparation Examples 3 to 5

[0074] Preparation Examples 3 to 5 use the method provided in Preparation Example 1 to prepare nucleic acid treatment reagents, except that the mass ratios of the components in the nucleic acid treatment reagents are different, as shown in Table 1. Other conditions are the same to obtain nucleic acid treatment reagents.

[0075] Table 1. Nucleic acid treatment reagents

[0076] Group Quality Ratio Preparation Example 2 0.1:0.005:0.01:0.05:0.5:1.5:50:0.01:4:2:25:0.1 Preparation Example 3 0.1:0.005:0.01:0.05:0.5:1.5:50:0.01:4:2:25:0.1 Preparation Example 4 0.1:0.005:0.01:0.05:0.5:1.5:50:0.01:4:2:25:0.1

[0077] Preparation Example 6

[0078] This preparation example adopts the method provided in Preparation Example 1 to prepare a nucleic acid treatment reagent, except that an equal mass of dodecyltrimethylammonium bromide is used instead of sodium dodecyl sulfate, and other conditions are the same to obtain a nucleic acid treatment reagent.

[0079] Preparation Example 7

[0080] This preparation example adopts the method provided in Preparation Example 2 to prepare a nucleic acid treatment reagent, except that an equal mass of dodecyltrimethylammonium bromide is used instead of sodium dodecyl sulfate, and other conditions are the same to obtain a nucleic acid treatment reagent.

[0081] Comparative Preparation Example 1

[0082] This comparative preparation example is basically the same as the nucleic acid treatment reagent provided in Preparation Example 1, except that phenol red is replaced with an equal mass of sucrose, and other conditions are the same to obtain a nucleic acid treatment reagent.

[0083] Comparative Preparation Example 2

[0084] This comparative preparation example adopts the method provided in Preparation Example 1 to prepare a nucleic acid treatment reagent, except that sucrose is used in equal parts by mass instead of surfactin, and other conditions are the same to obtain a nucleic acid treatment reagent.

[0085] Comparative Preparation Example 3

[0086] The nucleic acid treatment reagent provided in this comparative preparation example is basically the same as that provided in Preparation Example 2, except that phenol red is replaced with an equal mass of sucrose, and other conditions are the same to obtain a nucleic acid treatment reagent.

[0087] Comparative Preparation Example 4

[0088] The nucleic acid treatment reagent provided in this comparative preparation example is basically the same as that provided in Preparation Example 2, except that phenol red is replaced with an equal mass of sucrose, and other conditions are the same to obtain a nucleic acid treatment reagent.

[0089] Preparation Example 8

[0090] This preparation example is used to illustrate the preparation of a PCR reagent for influenza A virus detection, which specifically includes: mixing Tris-HCl (pH=8.3), magnesium chloride, dATP, dGTP, dCTP, dTTP, dUTP, Flua-F1, Flua-F2 and Flua-P1 according to a mass ratio of 5.75:0.32:0.15:0.23:0.24:0.21:0.58:0.02:0.02:0.02 to obtain a substrate; and mixing the mixture according to a mass ratio of 1.31×10 5 U / 1g substrate addition amount of UNG enzyme added, 1.05×10 6 U / 1g substrate addition amount of Taq enzyme added, 1.97×10 6Reverse transcriptase was added to 100 U / 1 g substrate and lyophilized according to the lyophilization program shown in Table 2. The nucleotide sequences of Flua-F1, Flua-F2 and Flua-P1 were as shown in Table 2 to obtain PCR reactants.

[0091] Table 2. Lyophilization procedure and primer information

[0092]

[0093] Preparation Example 9

[0094] This preparation example is used to illustrate the preparation of a PCR reagent for influenza B virus detection, which specifically includes: mixing Tris-HCl (pH=8.3), magnesium chloride, dATP, dGTP, dCTP, dTTP, dUTP, Flub-F1, Flub-F2 and Flub-P1 according to a mass ratio of 5.75:0.32:0.15:0.23:0.24:0.21:0.58:0.02:0.02:0.02 to obtain a substrate; and mixing the mixture according to a mass ratio of 1.31×10 5 U / 1g substrate addition amount of UNG enzyme added, 1.05×10 6 U / 1g substrate addition amount of Taq enzyme added, 1.97×10 6 Reverse transcriptase was added to 100 U / 1 g substrate and lyophilized according to the lyophilization program shown in Table 2. The nucleotide sequences of Flub-F1, Flub-F2 and Flub-P1 are shown in Table 3 to obtain PCR reactants.

[0095] Table 3. Primer information

[0096] name Nucleotide sequence Flub-F1 TGCCTACTTGCTTTC Flub-F2 ATTAGTGCTTTTTGTATATCA Flub-P1 AGAAAAGTTACACTG

[0097] Preparation Example 10

[0098] This preparation example is used to illustrate the preparation of a PCR reagent for detecting Mycoplasma pneumoniae, which specifically includes: mixing Tris-HCl (pH=8.3), magnesium chloride, dATP, dGTP, dCTP, dTTP, dUTP, MP-F3, MP-R3 and MP-P1 according to a mass ratio of 5.75:0.32:0.15:0.23:0.24:0.21:0.58:0.01:0.01:0.01 to obtain a substrate; and mixing the mixture according to a mass ratio of 1.31×10 5 U / 1g substrate addition amount of UNG enzyme added, 1.05×10 6 U / 1g substrate addition amount of Taq enzyme added, 1.97×10 6 Reverse transcriptase was added to 100 U / 1 g substrate and lyophilized according to the lyophilization program shown in Table 2. The nucleotide sequences of MP-F3, MP-R3 and MP-P1 are shown in Table 4 to obtain PCR reagents.

[0099] Table 4. Primer information

[0100] name Nucleotide sequence MP-F3 GGCGGCATGCC MP-R3 TTTGCTCCCCA MP-P1 AGCAGTAGGGA

[0101] Example 1

[0102] This embodiment is used to illustrate a microfluidic device. Figure 1 The microfluidic device comprises a main body 1 and a sample loading column 2. Figure 2 The main body 1 includes a first part 11 and a second part 12 that are detachably connected. A sample injection chamber 3 is provided on the first part 11, and the cross-sectional area of ​​the sample injection chamber 3 gradually decreases along the direction close to the second part 12 to form a guide portion. The sample addition column 2 is inserted in the sample injection chamber 3 and is gap-matched with the sample injection chamber 3. A microfluidic channel 4, a mixing chamber 5 and a qPCR reaction chamber 6 are provided on the second part 12. The microfluidic channel 4 and the mixing chamber 5 are integrally formed and interconnected. One end of the microfluidic channel 4 away from the mixing chamber 5 is inserted in the sample injection chamber 6 and is connected to the sample injection chamber 3, and the channel equivalent diameter of the microfluidic channel is 10μm and the length is 25μm. The mixing chamber 5 is arranged on one side of the second part 12 close to the qPCR reaction chamber 6, and the volume of the mixing chamber is 40μL. A puncture portion 7 for destroying the mixing chamber to release the sample to be tested and a sensor 8 for controlling the reaction conditions and detecting the fluorescent signal are provided in the qPCR reaction chamber 6. An overflow portion 9 is provided on the peripheral side of the microchannel 4 . When the microchannel 4 leaves the sample injection chamber 3 , the overflow portion 9 can be communicated with the sample injection chamber 3 .

[0103] When conducting nucleic acid testing, the sample column 2 first drives the test liquid in the sample injection chamber 3 to enter the mixing chamber 5 through the microfluidic channel 4, and then the sample column 2 contacts the end of the microfluidic channel 4 close to the sample injection chamber 3, and drives the microfluidic channel 4 and the mixing chamber 5 to move in the direction close to the qPCR reaction chamber 6, so that the mixing chamber 5 enters the qPCR reaction chamber 6 and contacts the puncture part 7 and is destroyed. At the same time, the sample column 2 seals the qPCR reaction chamber 6, and the test sample in the mixing chamber 5 is released into the qPCR reaction chamber 6 for PCR amplification. The conditions of the PCR reaction are controlled by the sensor 8, and the fluorescent signal in the qPCR reaction chamber 6 is measured, thereby realizing the integration of sample injection, fully closed reaction and reading of test results. It has the advantages of convenience, efficiency and speed, and can be well applied to various scenarios such as customs, border inspection, clinics, hospitals and personal homes, and has a wide range of applications.

[0104] It should be noted that the respiratory tract pharyngeal swab samples to be tested in the following examples are all from the same sample and are known to be negative for influenza A virus and influenza B virus.

[0105] Example 2

[0106] This example is used to illustrate a method for nucleic acid detection of influenza A and B viruses in respiratory pharyngeal swab samples to be tested. The method uses the microfluidic device provided in Example 1 for testing, and the mixing chamber 5 is pre-filled with 0.3 mg of the PCR reagent provided in Preparation Example 8 or 9, and the positive samples and negative samples tested are specifically shown in Table 5.

[0107] Table 5. Information of samples to be tested

[0108]

[0109] The method provided in this embodiment specifically includes the following steps:

[0110] S1, respectively taking 325 mg of the nucleic acid treatment reagent provided in Preparation Examples 1 and 3 to 6 and Comparative Preparation Examples 1 and 2 and mixing them evenly with 1 mL of influenza A positive sample, influenza B positive sample, and negative sample to obtain a test solution;

[0111] S2. Take the test solution and add it to the microfluidic device, and perform qPCR amplification according to the procedure shown in Table 6 to obtain the CT value of each sample.

[0112] Table 6. qPCR amplification program

[0113]

[0114] Each group of samples was tested 20 times, and the positive rate (unit: %) was calculated according to the following formula, and a control group was formed by directly adding 40 μL of the test solution into a conventional qPCR instrument using a pipette, and the PCR reagent and reaction procedure used in the control group were kept consistent. The test results are shown in Table 7.

[0115] Detection positive rate = positive samples / total number of samples × 100%

[0116] Among them, positive samples are judged based on the CT value. When the CT value is less than 38, it is judged as a positive sample, otherwise it is excluded.

[0117] Table 7.

[0118]

[0119]

[0120] It can be seen from the test results shown in Table 7 that, compared with comparative preparation examples 1 and 2, the nucleic acid treatment reagent provided by preparation examples 1, 3 to 6 of the present invention has a good treatment effect on respiratory tract pharyngeal swabs, can effectively release and extract nucleic acids, and the treatment reagent is directly introduced into the PCR reaction system. It has a good anti-PCR inhibition effect, and the detection results of positive samples of different concentrations are all positive, the positive detection rate is 100%, and no positive is detected in negative samples, with excellent specificity and accuracy.

[0121] Example 3

[0122] This example is used to illustrate the anti-interference ability of the method for nucleic acid detection of influenza A and B viruses in respiratory pharyngeal swab samples provided in Example 2, specifically comprising: preparing each interference sample according to Table 8, and performing detection with reference to the method provided in Example 2, repeating the measurement 20 times for each group of samples, and obtaining the positive detection rate of each interference sample. The test results are shown in Table 8.

[0123] Table 8.

[0124]

[0125]

[0126]

[0127] It can be seen from the test results shown in Table 8 that, compared with comparative preparation examples 1 and 2, the nucleic acid treatment reagent provided in preparation example 1 of the present invention is used to detect the interference sample. The interfering substances such as α-interferon, zanamivir, oseltamivir, phenylephrine, hemoglobin, mucin, etc. contained in the interference sample have no effect on the test results, and have excellent anti-interference ability.

[0128] It should be noted that the sputum samples to be tested in the following examples are all from the same sample and are known to be mycoplasma negative.

[0129] Example 4

[0130] This example is used to illustrate a method for nucleic acid detection of mycoplasma in a sputum sample to be tested. The method uses the microfluidic device provided in Example 1 for testing. The mixing chamber 5 is pre-filled with 0.3 mg of the PCR reagent provided in Preparation Example 10, and the positive samples and negative samples tested are specifically shown in Table 9.

[0131] Table 9.

[0132]

[0133]

[0134] The method provided in this embodiment specifically includes the following steps:

[0135] S1, respectively taking 325 mg of the nucleic acid treatment reagent provided in Preparation Examples 2 and 7 and Comparative Preparation Examples 3 and 4 and mixing them evenly with 1 mL of the mycoplasma positive sample and negative sample to obtain a test solution;

[0136] S2. Add the test liquid to the microfluidic device, and perform qPCR amplification according to the procedure shown in Table 6 to obtain the CT value of each sample. Repeat the measurement 20 times for each group of samples, and calculate the positive detection rate according to the method provided in Example 2. The results are shown in Table 10.

[0137] Table 10.

[0138]

[0139] It can be seen from the test results shown in Table 10 that, compared with comparative preparation examples 3 and 4, the nucleic acid treatment reagent provided by preparation examples 2 and 7 of the present invention has a good treatment effect on the sputum sample to be tested, and can effectively release and extract nucleic acids. The treatment reagent is directly introduced into the PCR reaction system and has a good anti-PCR inhibition effect. The detection results of positive samples with a concentration of more than 1000 copy / mL are all positive, and the positive detection rate is as high as 100%, and no positive is detected in negative samples, with excellent specificity and accuracy.

[0140] Example 5

[0141] This example is used to illustrate the anti-interference ability of the method for nucleic acid detection of influenza A and B viruses in respiratory pharyngeal swab samples provided in Example 4, specifically comprising: preparing each interference sample according to Table 10, and performing detection with reference to the method provided in Example 4, repeating the measurement 20 times for each group of samples, and obtaining the positive detection rate of each interference sample. The test results are shown in Table 10.

[0142] Table 10.

[0143]

[0144]

[0145]

[0146] It can be seen from the test results shown in Table 10 that, compared with comparative preparation examples 3 and 4, the nucleic acid treatment reagent provided in preparation example 2 of the present invention is used to detect the interference sample. The interfering substances such as α-interferon, zanamivir, oseltamivir, phenylephrine, hemoglobin, mucin, etc. contained in the interference sample have no effect on the test results, and have excellent anti-interference ability.

[0147] Although the embodiments of the present invention have been shown and described above, it is to be understood that the above embodiments are exemplary and are not to be construed as limitations on the present invention. A person skilled in the art may change, modify, replace and modify the above embodiments within the scope of the present invention without departing from the principles and intent of the present invention.

Claims

1. A nucleic acid treating agent, characterized in that The nucleic acid treatment reagent includes hydrolase, surfactant, guanidine compound, surfactant, phenol red, oligosaccharide, sugar alcohol and magnesium sulfate in a mass ratio of (0.1-0.6):(0.01-1):(1-10):(50-100):(0.01-0.1):(5-50):(10-250):(0.1-1).

2. The nucleic acid treating agent according to claim 1, characterized in that The hydrolase is selected from proteinase K and / or lysozyme; Optionally, the surfactant is selected from nonionic surfactants and / or anionic surfactants; Optionally, the guanidine compound is selected from one or more of guanidine isothiocyanate, guanidine hydrochloride, guanidine thiocyanate and aminoguanidine sulfate; Optionally, the oligosaccharide is selected from one or more of trehalose, sucrose, stachyose, maltose and fructose; Optionally, the sugar alcohol is selected from one or more of mannitol, maltitol, erythritol and xylitol; Optionally, the nucleic acid treating agent comprises a hydrolase, a surfactant, a guanidine compound, a surfactant, phenol red, an oligosaccharide, a sugar alcohol and magnesium sulfate in a mass ratio of (0.1-0.55):(0.06-0.3):(2-9):(50-80):(0.01-0.05):(6-40):(25-200):(0.1-0.75); Optionally, the hydrolase includes proteinase K and / or lysozyme, the surfactant includes Tween and sodium dodecyl sulfate, the guanidine compound includes guanidine hydrochloride and guanidine isothiocyanate, the oligosaccharide includes trehalose and sucrose, and the sugar alcohol is mannitol.

3. A nucleic acid detection reagent, characterized in that: The nucleic acid detection reagent comprises the nucleic acid processing reagent according to claim 1 or 2 and a PCR reaction agent.

4. The nucleic acid detection reagent according to claim 3, characterized in that: The PCR reaction reagents include UNG enzyme, Taq enzyme and reverse transcriptase.

5. A microfluidic device, characterized in that: The microfluidic device comprises: The main body comprises a sample injection chamber, a microfluidic channel, a mixing chamber and a qPCR reaction chamber; one end of the microfluidic channel is movably inserted in the sample injection chamber and communicated with the sample injection chamber, and the other end is communicated with the mixing chamber; a PCR reactant is arranged in the mixing chamber, a puncture part and a sensor are arranged in the qPCR reaction chamber, the puncture part is used to destroy the mixing chamber to release the sample to be tested into the PCR reaction chamber, and the sensor is used to control the reaction conditions and detect the fluorescence signal; The sample loading column is movably inserted on a side of the sample injection chamber away from the microfluidic channel. The sample loading column drives the microfluidic channel and the mixing chamber to move in a direction close to the qPCR reaction chamber, and the sample loading column, the microfluidic channel, the sample injection chamber and the qPCR reaction chamber can form a closed space.

6. The microfluidic device according to claim 5, characterized in that: The main body comprises an overflow portion arranged at the periphery of the microchannel, and when the microchannel leaves the sample injection chamber, the overflow portion is communicated with the sample injection chamber.

7. A nucleic acid detection kit, characterized in that: The kit comprises the nucleic acid processing reagent according to claim 1 or 2, the nucleic acid detection reagent according to claim 3 or 4 and / or the microfluidic device according to claim 5 or 6.

8. A method for nucleic acid detection, characterized in that: The detection method uses the microfluidic device described in claim 5 or 6 to detect the sample to be tested, and specifically includes: taking the sample to be tested and mixing it with the nucleic acid treatment agent described in claim 1 or 2 to obtain a test liquid; taking the test liquid and adding it to the microfluidic system and mixing it with the PCR reaction agent, performing qPCR amplification, and obtaining the detection result.

9. The nucleic acid detection method according to claim 8, characterized in that: Based on the volume of the sample to be tested, the amount of the nucleic acid treatment agent added is 100-500 μg / μL; Optionally, based on the volume of the test solution, the amount of the PCR reagent added is 1 to 15 μg / μL.

10. Use of the nucleic acid processing reagent according to claim 1 or 2, the nucleic acid detection reagent according to claim 3 or 4, the microfluidic device according to claim 5 or 6 and / or the nucleic acid detection kit according to claim 7 in non-diagnostic nucleic acid detection.

Images