Wheat disease-resistant related protein TaNLR-4B as well as coding gene and application thereof

Abstract

The invention discloses a wheat disease resistance related protein TaNLR-4B as well as a coding gene and application thereof, and belongs to the technical field of gene engineering. The amino acid sequence of the TaNLR-4B provided by the invention is as shown in SEQ ID NO: 1, the ORF sequence of the TaNLR-4B is as shown in SEQ ID NO: 2, the gene TaNLR-4B is inducible to express in a wheat stripe rust affinity interaction system and is not inducible to express in a wheat stripe rust non-affinity interaction system, and the gene TaNLR-4B plays a positive regulation role in affinity interaction of wheat and stripe rust. The gene TaNLR-4B is cloned in Guizhou No.3, overexpression is carried out in a wheat stripe rust susceptible variety Fielder, a TaNLR-4B overexpression plant is obtained, it is verified that the resistance of the TaNLR-4B overexpression plant to stripe rust CYR34 is enhanced, and a new gene resource is provided for wheat stripe rust resistance breeding.

Description

Technical Field

[0001] The invention belongs to the technical field of genetic engineering and relates to a wheat disease resistance-related protein TaNLR-4B and a coding gene and application thereof. Background Art

[0002] Disease resistance proteins are an important component of the plant immune system and play a key role in resisting infection by a variety of pathogens. Wheat stripe rust is a fungal disease caused by Puccinia striiformis f.sp.tritici (Pst), which occurs in almost every major wheat-growing region in the world, posing a serious threat to wheat yields. Since stripe rust has strong genetic variability and its toxicity frequently varies, wheat stripe rust frequently breaks out, and existing disease-resistant varieties often lose their resistance in a short period of time. Therefore, the rational use of disease-resistant genes to create disease-resistant materials has become the most economical and effective sustainable development strategy for preventing and controlling wheat stripe rust.

[0003] Disease resistance proteins with coiled-coil domains, nucleotide binding sites and leucine-rich repeat sequences are named because they contain coiled-coil domains (CC) at the N-terminus, nucleotide binding sites (NBS) and leucine-rich repeat sequences (LRR) at the C-terminus. They are important members of the plant disease resistance gene family. Disease resistance proteins can recognize pathogen effector molecules and activate plant defense responses, thereby enhancing plant disease resistance. Studies have found that disease resistance proteins with coiled-coil domains, nucleotide binding sites and leucine-rich repeat sequences induce immune responses and initiate multiple defense mechanisms including hypersensitive responses (HR) through direct or indirect interactions with pathogen effectors. This process is usually accompanied by local cell death, thereby limiting the spread of pathogens.

[0004] In wheat, disease-resistant proteins with coiled-coil domains, nucleotide binding sites, and leucine-rich repeat sequences have been shown to be closely related to the defense response against stripe rust. Multiple disease-resistant loci in wheat (such as Yr18, Yr36, etc.) have been found to encode this type of disease-resistant protein, which can recognize effectors released after the invasion of stripe rust, activate downstream signaling pathways, and ultimately initiate disease resistance responses. However, as stripe rust mutates, the effectiveness of some disease-resistant genes will gradually weaken. Therefore, discovering and studying new protein-resistant genes is the key to improving wheat's resistance to stripe rust.

[0005] At present, the prevention and control of wheat stripe rust mainly relies on chemical control. However, the long-term use of chemical pesticides has posed a serious threat to the environment and food safety, and has attracted widespread attention. In contrast, disease-resistant breeding is an economical, effective and environmentally friendly prevention and control strategy. However, due to the long screening cycle of disease-resistant genes, the breeding of disease-resistant varieties is difficult, and the stripe rust toxicity mutates rapidly, making the long-term control of this disease a huge challenge. Therefore, creating broad-spectrum and long-lasting disease-resistant materials, especially using the disease-resistant mechanism of proteins, is the fundamental way and key technology to prevent and control wheat stripe rust. This will not only help maintain the stability of wheat production, but also provide a strong guarantee for the sustainable development of agriculture. Summary of the invention

[0006] In view of the above-mentioned prior art, the present invention provides a wheat disease resistance-related protein TaNLR-4B and its encoding gene and application. Overexpression of the wheat disease resistance-related protein gene TaNLR-4B can improve the resistance of wheat to stripe rust, and has important application value in the breeding of wheat stripe rust-resistant varieties.

[0007] In a first aspect, the present invention provides a wheat disease resistance-related protein TaNLR-4B, wherein the amino acid sequence of the wheat disease resistance protein TaNLR-4B is shown in SEQ ID NO:1.

[0008] Furthermore, the present invention screened out a disease-resistant protein TaNLR-4B containing a coiled-coil domain, a nucleotide binding site and a leucine-rich repeat sequence by performing a GWAS whole-genome association analysis on 500 wheat samples inoculated with stripe rust.

[0009] In a second aspect, the present invention provides a wheat disease resistance-related protein gene TaNLR-4B, the nucleotide sequence of the wheat disease resistance-related protein gene TaNLR-4B is shown in SEQ ID NO:2.

[0010] In a third aspect, the present invention provides an expression vector comprising the wheat disease resistance-related protein gene TaNLR-4B.

[0011] Furthermore, the expression vector is required to overexpress the wheat disease resistance-related protein gene TaNLR-4B, and the primers for overexpressing the wheat disease resistance-related protein gene TaNLR-4B are shown in SEQ ID NO: 3 and SEQ ID NO: 4.

[0012] In a fourth aspect, the present invention provides a method for breeding wheat varieties resistant to stripe rust, overexpressing the wheat disease resistance-related protein gene TaNLR-4B to obtain stripe rust-resistant wheat.

[0013] Furthermore, in the method for breeding resistant wheat varieties provided by the present invention, the expression vector is transformed into wheat, the transformation method is Agrobacterium-mediated genetic transformation, and the wheat variety is wild-type wheat Fielder.

[0014] In a fifth aspect, the application of the wheat disease resistance-related protein gene TaNLR-4B described in the present invention in the breeding of wheat resistant to stripe rust.

[0015] Furthermore, the wheat disease resistance-related protein gene TaNLR-4B is overexpressed to improve the resistance of wheat to stripe rust.

[0016] Compared with the prior art, the technical solution provided by the present invention has at least the following beneficial effects or advantages:

[0017] (1) Compared with traditional disease-resistant breeding technology, plant disease-resistant genetic engineering technology can break through the reproductive isolation and incompatibility of distant hybridization between species, achieve targeted improvement of target traits in a shorter period of time, and provide more comprehensive, continuous and broad-spectrum protection for crops. Through gene function research, the present invention found that the disease-resistant protein TaNLR-4B plays a positive regulatory role in the defense response of wheat invaded by stripe rust, that is, overexpression of the TaNLR-4B gene can improve the ability of wheat to resist stripe rust.

[0018] (2) The present invention provides a method for breeding wheat stripe rust-resistant varieties. The method uses genetic engineering technology to overexpress the disease-resistant protein TaNLR-4B in wheat plants to enhance the resistance of wheat to stripe rust pathogens. It has been verified that the transgenic wheat obtained by the method of the present invention shows resistance to the physiological race CYR34 of stripe rust fungi. The present invention provides a new technical idea for breeding wheat stripe rust-resistant varieties from the perspective of molecular biology, and effectively solves the technical problems of the present invention. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] Figure 1 The schematic diagram of the overexpression vector of gene TaNLR-4B. Among them, LB is the left border of T-DNA; OsAct1, PvUbi1 and ZmUbi1 are promoters; Bar is the screening marker for plant transgenes; GUSPlus is the reporter gene for plant gene expression; Acv5 is used to screen or identify specific cells; TaNLR-4B is the target gene; 35ST, NOST and OCST are terminators; RB is the right border of T-DNA, which is the end point of T-DNA integration in the plant genome.

[0020] Figure 2 The PCR test results of transgenic wheat TaNLR-4B-OE positive plants. Among them, L1, L2 and L3 are transgenic wheat TaNLR-4B-OE; M is DNA Marker.

[0021] Figure 3 The results of the induced expression profile analysis of wheat disease resistance protein gene TaNLR-4B infected by stripe rust. MX169 is Mingxian 169 variety, GX3# is Guixie 3 variety; *** means P<0.001.

[0022] Figure 4 Schematic diagram of the phenotypic results of transgenic wheat TaNLR-4B-OE inoculated with stripe rust CYR32. Among them, TaNLR-4B-OE is transgenic wheat, CYR32 means inoculated with stripe rust CYR32, WT is the wild-type wheat variety Fielder, and L1, L2 and L3 are different strains. DETAILED DESCRIPTION

[0023] The technical scheme of the present invention is described below in conjunction with the embodiments, but the present invention is not limited to the following embodiments. The experimental methods and detection methods described in each embodiment are conventional methods unless otherwise specified; the reagents and materials described are all commercially available unless otherwise specified.

[0024] In order to fully and unambiguously understand the technical solution of the present invention, it should be noted that the non-oblique font "TaNLR-4B" in the present invention represents the TaNLR-4B protein, and the oblique font "TaNLR-4B" represents the TaNLR-4B gene. Of course, those of ordinary skill in the art can clearly and completely understand the meaning of the expression of the relevant genes and their encoded proteins based on the records of the present invention.

[0025] Example 1

[0026] This example provides the isolation and identification of a disease resistance protein gene TaNLR-4B having a coiled-coil domain, a nucleotide binding site and a leucine-rich repeat sequence.

[0027] 500 wheat samples were inoculated with stripe rust, and then a genome-wide association study (GWAS) was performed to discover genetic variations closely related to wheat stripe rust resistance. After data screening and bioinformatics analysis, the disease resistance protein gene TaNLR-4B containing a coiled-coil domain, a nucleotide binding site, and a leucine-rich repeat sequence was obtained. There was a significant difference in the expression level of the gene TaNLR-4B between disease-resistant varieties and susceptible varieties, indicating the core role of this gene in the mechanism of wheat resistance to stripe rust. In this example, the gene TaNLR-4B in a wheat variety with strong disease resistance was cloned, and the obtained TaNLR-4B amino acid sequence is shown in SEQ ID NO: 1, and the nucleotide sequence encoding the gene TaNLR-4B is shown in SEQID NO: 2.

[0028] 1. Collection of wheat stripe rust samples and phenotypic data

[0029] Three strains were selected for the wheat mutant material, and 6 to 10 seeds with full grains were selected for each strain and numbered; the wild-type Fielder wheat variety was used as a control. Seeds were soaked before planting, and soaked in 0.2% hydrogen peroxide solution for 18 to 24 hours to promote seed germination. After the seeds turned white, they were transplanted into 10×10cm plastic pots and planted in separate strains, with one strain of one gene planted in each pot. After recording the number, they were placed in a culture room with a temperature of 16°C and a light-dark cycle of 16 / 8 for 12 to 14 days. When planting, the seeds were placed as dispersed and evenly as possible to facilitate subsequent inoculation and identification. When the wheat mutant material grew to the two-leaf and one-heart stage, the stripe rust fungus CYR31 was inoculated on the fully expanded second leaf. Before inoculation, the leaves to be inoculated were marked, and the fresh summer spores of the stripe rust fungus CYR31 were poured into the electronic incubation solution and gently mixed to make a 4mg / mL spore suspension. Use a pipette to absorb 20-30 μL of spore suspension and slowly and evenly spread it on the inoculated leaves. After the inoculation is completed, spray a small amount of water on the wheat leaves, and place the inoculated wheat seedlings in an incubator with a temperature of 14°C and a relative humidity of 100% to protect from light and moisturize. Take it out after 24 hours, transfer it to a culture room with a temperature of 16°C and a light-dark cycle of 16 / 8 to continue cultivating. During the culture period, a small amount of water can be sprayed every day to keep it moist. About 14 days after inoculation, when the wild-type Fielder is fully diseased (the percentage of the area of ​​lesions on the leaves to the total leaf area reaches more than 80%), observe the disease conditions of the inoculated leaves of other mutant materials, take pictures of the plant lines to record the disease conditions, and identify their reaction types according to the McNeal grading standard.

[0030] 2. Genomic DNA extraction and genome-wide association analysis of resistant and susceptible varieties

[0031] This embodiment uses the CTAB method to extract DNA from mutant materials. After the inoculation and identification is completed, an appropriate amount of leaves from the gene-dividing and strain-dividing lines are placed in a 2.0 mL centrifuge tube, and are quickly placed in liquid nitrogen after being marked. The samples are crushed using a crushing grinder. 1 to 2 steel balls are placed in each sample before crushing. The crushing time is 30 to 60 seconds, and the crushing is immediately placed on ice; 800 μL of CTAB (containing 0.2% thiol reducing agent) preheated to 65°C is added to each sample, and after vigorous shaking, it is placed in a 65°C water bath for 1 hour. Take out the sample and place it on ice. After cooling to room temperature, add 800 μL of DNA extraction solution and mix evenly. After shaking vigorously for 5 minutes, let it stand for 3 minutes, and then centrifuge at a speed of 12000 rpm for 10 minutes. Transfer the supernatant to a 2.0 mL centrifuge tube, add chloroform (supernatant: chloroform = 1:1, v / v), mix evenly, let it stand for 2 minutes, and then centrifuge at a speed of 12000 rpm for 10 minutes. Transfer the supernatant to a 1.5mL centrifuge tube, add pre-cooled isopropanol and sodium acetate (supernatant: isopropanol: sodium acetate = 10:10:1, v / v), and mix gently. Store in a -20℃ ultra-low temperature refrigerator overnight. Centrifuge at 12000rpm for 10min, discard the supernatant, add 500μL 75% ethanol, and suspend and wash the DNA precipitate. Centrifuge at 12000rpm for 5min, discard the supernatant, add 500μL anhydrous ethanol, and suspend and wash the DNA precipitate. Centrifuge at 12000rpm for 5min, discard the supernatant, and let stand at room temperature for 10 to 30min (to allow the anhydrous ethanol to fully evaporate). Add 100μL of preheated sterile ddH2O to the DNA precipitate to fully dissolve the DNA precipitate. Take 1-5 μL DNA sample, add loading buffer in proportion and mix thoroughly, then perform agarose nucleic acid electrophoresis (1% agarose gel, 160V, 20min) to detect whether the extracted DNA sample has tailing and degradation. Take 1 μL DNA sample and use Nanodrop 2000 spectrophotometer to detect DNA concentration and quality. If the measured OD 260nm / 280nm The value is between 1.8 and 2.0, OD 260nm / 230nm If the value is greater than 2.0, the purity of the DNA sample is good. The DNA samples with good concentration and quality are stored in a -20℃ ultra-low temperature refrigerator.

[0032] Genome-wide association study (GWAS)

[0033] First, the materials with obvious phenotypes are statistically collected. DNA is extracted from each sample and genotyped. Whole genome sequence data, including SNPs, InDels, CNVs and other variations, are obtained through whole genome sequencing technology. GWAS analysis involves a large amount of data, so strict quality control is required to ensure the accuracy of the results. Remove low-quality samples, remove samples with too small sample size, inaccurate phenotypic data and significant errors, use statistical methods to remove outliers, check whether the samples have inconsistent phenotypic or genotypic data, remove suspected duplicate or erroneous samples, remove SNPs with high missing rates (such as missing data exceeding 5%), because this may lead to false positive results, remove SNPs with extremely low allele frequencies (such as less than 5% frequency), because these SNPs are usually not well represented in the sample and may not have sufficient statistical power. Check whether each SNP in the population conforms to Hardy-Weinberg equilibrium (HWE). SNPs that deviate from equilibrium may be markers of data errors or inconsistent with the genetic structure of the population. Check the sample population structure to avoid genotype differences between populations affecting the results.

[0034] The PCA (Principal Component Analysis) method was used to detect the population structure in the sample. PCA can identify different populations or subpopulations that may exist in the sample, and different population structures can be represented by calculating the principal components. The PCA results can be added as covariates in subsequent regression analysis. The mixed linear model (MLM) corrects for population structure and family effects. MLM can take into account the kinship and environmental effects between populations, thereby improving the accuracy of GWAS analysis. The GEMMA software tool was used to perform association analysis on 500 genotype data and phenotype data through linear regression analysis, chi-square test and mixed linear model (MLM) to identify genetic variations associated with traits. The statistical software GEMMA was used to perform genome-wide association analysis, and the strength of association between each SNP and the phenotype was calculated, expressed as a p-value. Multiple comparison correction was performed to avoid false positives, and the false discovery rate was controlled by FDR correction to find SNPs that were significantly associated with the phenotype. According to the genomic location of the SNP, the relevant candidate genes were screened. Gene Ontology (GO) analysis was used to explore the functions of these candidate genes and their role in biological processes.

[0035] Example 2

[0036] This example provides a method for preparing transgenic wheat TaNLR-4B-OE.

[0037] The transgenic background material used in this example is wild-type wheat Fielder, which overexpresses the gene TaNLR-4B and uses Agrobacterium-mediated genetic transformation to create TaNLR-4B gene-edited plants. The preparation method of TaNLR-4B gene-edited plants is as follows:

[0038] (1) Construction of overexpression vector

[0039] The primers designed to overexpress the gene TaNLR-4B are shown in SEQ ID NO: 3 and SEQ ID NO: 4:

[0040] TaNLR-4B-F: GGGGACAAGTTTGTACAAAAAAGCAGGCTTCATGGATT ACAAGGATGACGACGATATGGCTGAAGCTTCCCGGCGAG (SEQ ID NO: 3);

[0041] TaNLR-4B-R: GGGGACCACTTTGTACAAGAAAGCTGGGTCTTATCGGC CTTCTGGATGTG (SEQ ID NO: 4).

[0042] The full-length gene sequence was amplified using primers to construct the TaNLR-4B overexpression vector, and the amplified fragment was constructed into the expression vector pANIC6E through homologous recombination Gateway reaction to obtain the TaNLR-4B-pANIC6E overexpression vector.

[0043] like Figure 1As shown in the figure, the starting part of the overexpression vector is the left border (LB) of T-DNA, which is the starting point when T-DNA is transferred from the plasmid to the plant genome during the Agrobacterium-mediated plant transformation process. It marks the beginning of the T-DNA sequence and is the key signal for the vector to be integrated into the plant genome. The overexpression vector contains the rice promoter Actin 1 (OsAct1) to drive the efficient expression of the selection marker gene Bar in the plant. The selection marker gene Bar encodes a phosphotransferase, which makes the plant resistant to glyphosate and is used to quickly identify cells that have successfully transferred the target gene. After the gene Bar, the 35S terminator (35ST) of the cauliflower mosaic virus is used to terminate the transcription process of the gene Bar, and a poly-A tail is added to stabilize the structure of the mRNA and improve the expression efficiency of the gene. The overexpression vector also contains the ubiquitin 1 promoter (PvUbi1) of the common bean to drive the gene GUSPlus. The gene GUSPlus encodes β-glucosidase, and the expression of the gene is detected by a color reaction to observe the expression pattern and location of the gene. The nopaline synthase terminator (NOST) of Agrobacterium tumefaciens terminates the transcription of the gene GUSPlus. The maize ubiquitin 1 promoter (ZmUbi1) drives the target gene TaNLR-4B, the element Acv5 is used to screen the target gene, and the octopine synthase gene terminator (OCST) of Agrobacterium tumefaciens terminates the transcription of the gene TaNLR-4B. The end of the overexpression vector is the right border (RB) of the T-DNA.

[0044] (2) Obtaining transgenic wheat

[0045] The overexpression vector TaNLR-4B-pANIC6E was transferred into wheat immature embryos by Agrobacterium-mediated genetic transformation, and transgenic wheat TaNLR-4B-OE was obtained by culture.

[0046] Take 100 μL of Agrobacterium competent cells EHA105 and place them on ice until they are completely thawed; add the overexpression vector TaNLR-4B-pANIC6E to the Agrobacterium competent cells and shake gently to mix the two thoroughly; preheat the water bath to 37°C and perform the transformation in the following order: place in an ice box at low temperature for 5 minutes; place in liquid nitrogen for 5 minutes; place in a 37°C water bath for 5 minutes; place in an ice box at low temperature for 5 minutes; add 800 μL of LB without antibiotics The liquid culture medium was gently mixed and then shaken at 28°C, 160rpm for 2-3h; 5000rpm for 5min to collect the bacteria; the supernatant was discarded in an ultra-clean workbench, and about 100μL of the supernatant was reserved and transferred to a flat plate containing Kan (50mg / L) and Rif (25mg / L), and the culture medium was evenly spread and allowed to stand for 2-3min to dry; the culture plate was sealed with a sealing film, and inverted in a 28°C incubator, incubated in the dark for 2-3 days. Transgenic overexpression plants were obtained through the Agrobacterium-mediated genetic transformation system.

[0047] (3) PCR verification

[0048] In this example, PCR verification was performed on three strains of transgenic wheat TaNLR-4B-OE T1 generation, L1, L2 and L3. Transgenic positive plants were detected using Blp-F / R primers, and the obtained PCR products were detected by 1% agarose gel electrophoresis. Blp-F / R primers are as follows:

[0049] Blp-F: GCAAGACCTCTCTCTATAAGG;

[0050] Blp-R:TCAGATCTCGGTGACGGGCAGGACC.

[0051] The DNA extracted from transgenic wheat TaNLR-4B-OE was positively tested. According to the reaction system shown in Table 1, the reaction samples and reagents were added to the PCR tube in sequence:

[0052] Table 1 PCR verification reaction system

[0053]

[0054] Add the above samples and reagents to the PCR tube in sequence, centrifuge briefly to mix, and set the PCR reaction program as shown in Table 2:

[0055] Table 2 PCR validation reaction procedure

[0056] program Pre-denaturation transsexual annealing extend Final extension save temperature 95℃ 95℃ 58℃ 72℃ 72℃ 16℃ time 5min 30s 30s 30s 10min forever

[0057] The denaturation-annealing-extension cycle was repeated 35 times. After the reaction was completed, 5 to 10 μL of the PCR product was taken for agarose nucleic acid electrophoresis (1% agarose gel, 160 V, 20 min), and the gel running was observed by a gel imager.

[0058] Figure 2 This is the PCR verification result of transgenic wheat TaNLR-4B-OE. Figure 3 The middle is the electrophoresis verification result of the overexpression line. It can be seen that L1, L2 and L3 all amplified a 750bp fragment, indicating that the TaNLR-4B gene transgenic wheat was successfully obtained.

[0059] Example 3

[0060] This example provides the expression of the disease resistance protein gene TaNLR-4B induced by stripe rust.

[0061] When the transgenic wheat of the TaNLR-4B gene obtained in Example 2 grows to the two-leaf and one-heart stage, the stripe rust fungus CYR32 is inoculated on the fully expanded two leaves. Mark the leaves that need to be inoculated before inoculation, pour the fresh summer spores of the stripe rust fungus CYR32 into the electronic hatching solution, mix gently, and make a 4mg / mL spore suspension. Use a pipette to draw 20-30μL of the spore suspension and slowly and evenly spread it on the inoculated leaves. After the inoculation is completed, spray a small amount of water on the wheat leaves, and place the inoculated wheat seedlings in an incubator with a temperature of 14°C and a relative humidity of 100% to keep them away from light and moisturize. Take it out after 24h, transfer it to a culture room with a temperature of 16°C and a light-dark cycle of 16 / 8 for continued cultivation, and spray a small amount of water every day during the culture period to keep it moist. At different time points (6h, 12h, 24h, 36h, and 48h after inoculation), inoculated leaf samples and control group samples (wheat leaves not inoculated with stripe rust) were collected for subsequent RNA extraction.

[0062] Samples were quickly cut from infected wheat leaves and immediately frozen in liquid nitrogen or stored in a -80°C freezer. Total RNA was extracted using a commercial RNA extraction kit according to the instructions. RNA concentration was measured using a NanoDrop instrument, and RNA integrity was confirmed using agarose gel electrophoresis.

[0063] The extracted RNA was transcribed into cDNA using a reverse transcription kit. Real-time PCR was used for cDNA quality control, and the internal reference gene TaEF1-α was selected for verification. Specific primers for the disease resistance protein gene TaNLR-4B were designed. Primers for the internal reference gene TaEF1-α were designed. The specific primers for the gene TaNLR-4B and TaEF primers are as follows:

[0064] TaEF-F:TGGTGTCATCAAGCCTGGTATGGT;

[0065] TaEF-R:ACTCATGGTGCATCTCAACGGACT.

[0066] TaNLR-4B-qRT-F: TGCAAGAGGCCGGCGAGAGA;

[0067] TaNLR-4B-qRT-R:GAATGACAGTGAGTCTGAAC.

[0068] Prepare the qRT-PCR reaction system, add appropriate amounts of cDNA template, primers, SYBR Green fluorescent dye, and other necessary reagents. Set appropriate annealing temperature and cycling conditions according to the characteristics of the primers. Detect the relative expression of the disease resistance protein gene TaNLR-4B by real-time PCR and standardize it with the internal reference gene. Calculate the relative expression using the Delta Delta Ct method and draw the expression change curve. Analyze the expression difference of the disease resistance protein gene TaNLR-4B in samples at different time points.

[0069] In this example, the induced expression profile of gene TaNLR-4B was analyzed at different stages of the affinity and incompatibility systems between wheat and stripe rust. Figure 3 The results of the induced expression analysis of gene TaNLR-4B. qRT-PCR was used to detect the induced expression of gene TaNLR-4B at different time points (6h, 12h, 24h, 36h, 48h) when wheat varieties Guixie No. 3 (GX3#) were inoculated with stripe rust CYR34 (affinity) and Mingxian 169 (MX169) were inoculated with stripe rust CYR34 (non-affinity). The results showed that the expression level of gene TaNLR-4B was the highest at 24h of stripe rust infection in the affinity system, indicating that gene TaNLR-4B responded to the interaction between wheat and stripe rust.

[0070] Example 4

[0071] This example provides an analysis of the stripe rust resistance of transgenic wheat TaNLR-4B-OE.

[0072] The resistance of TaNLR-4B gene-edited plants to stripe rust was identified by McNeal phenotypic evaluation and qRT-PCR method.

[0073] Genomic DNA was extracted from transgenic wheat TaNLR-4B-OE materials, and primers were designed for PCR amplification. These primers were used to amplify the cDNA of the TaNLR-4B gene. The PCR products were analyzed by agarose gel electrophoresis. After positive identification, the positive materials were subjected to genome editing analysis to determine the editing status.

[0074] The amplification primers for the target gene TaNLR-4B are as follows:

[0075] TaNLR-4B-cDNA-F: ATGGCTGAAGCTTCCCGGCGAG;

[0076] TaNLR-4B-cDNA-R:TTATCGGCCTTCTGGATGTG.

[0077] Gene expression analysis (qRT-PCR), RNA extraction Total RNA was extracted from the gene-edited plants. Make sure to select healthy wheat tissues (such as leaves), use an RNA extraction kit to extract RNA, and use a reverse transcription kit to transcribe the extracted RNA into cDNA for subsequent PCR analysis. Select the target gene TaNLR-4B and the internal reference gene for quantitative PCR, and use TaNLR-4B specific primers for qRT-PCR. The expression level of TaNLR-4B in transgenic plants and control plants was compared by the Delta Delta Ct method. After the expression of the TaNLR-4B gene in the gene-edited plants was confirmed in Example 3, the transgenic wheat TaNLR-4B-OE was tested for stripe rust CYR32 resistance to observe whether the edited gene increased the plant's resistance to stripe rust.

[0078] For each strain of TaNLR-4B-OE material, 6 to 10 seeds with full grains were selected and numbered; wild-type Fielder wheat varieties were used as controls; seeds were soaked before planting, and soaked in 0.2% hydrogen peroxide solution for 18 to 24 hours to promote seed germination; seeds were transplanted into 10×10 cm plastic pots after they turned white, and planted in separate lines. One strain of one gene was planted in each pot, and the number was recorded and placed in a culture room with a temperature of 16°C and a light-dark cycle of 16 / 8 for 12 to 14 days. When planting, the seeds were placed as dispersed and evenly as possible to facilitate subsequent inoculation and identification; when the wheat mutant material grew to the two-leaf one-heart stage, the stripe rust fungus CYR32 was inoculated on the fully expanded two leaves. Before inoculation, the leaves to be inoculated were marked, and the fresh summer spores of stripe rust fungus CYR32 were poured into the electronic incubation solution, gently mixed, and a spore suspension of 4 mg / mL was prepared. Use a pipette to absorb 20-30 μL of spore suspension, and slowly and evenly spread it on the inoculated leaves; after the inoculation is completed, spray a small amount of water on the wheat leaves, and place the inoculated wheat seedlings in an incubator with a temperature of 14°C and a relative humidity of 100% to protect from light and moisturize. Take it out after 24 hours, transfer it to a culture room with a temperature of 16°C and a light-dark cycle of 16 / 8 to continue cultivating. During the culture period, a small amount of water can be sprayed every day to keep it moist; about 14 days after inoculation, when the wild-type Fielder is fully diseased (the percentage of the lesion area on the leaves to the total leaf area reaches more than 80%), observe the disease situation of the inoculated leaves of the TaNLR-4B-OE material, take photos of the plant lines to record the disease situation, and identify its reaction type according to the selected grading standard.

[0079] The phenotypic results of transgenic wheat L1, L2 and L3 after inoculation with stripe rust virus race CYR32 for 14 days are shown in Figure 2. Figure 4 As shown, a large number of spores were produced on the leaf surface of wild-type Fielder wheat plants, while fewer spores were produced on the leaf surface of transgenic wheat L1, L2 and L3, indicating that transgenic wheat L1, L2 and L3 were resistant to stripe rust virus race CYR32. The above results show that TaNLR-4B-OE overexpressing plants have enhanced resistance to stripe rust.

[0080] The embodiments described above are part of the embodiments of the present invention, but not all of them. The detailed description of the embodiments of the present invention is not intended to limit the scope of the invention claimed for protection, but only represents selected embodiments of the present invention. All other embodiments obtained without creative work and related deductions and substitutions made by ordinary technicians in the field under the conditions of the concept of the present invention belong to the scope of protection of the present invention.

Claims

1. Wheat disease resistance-related protein TaNLR-4B, characterized in that: The amino acid sequence of the wheat disease resistance protein TaNLR-4B is shown in SEQ ID NO:

1.

2. Wheat disease resistance-related protein gene TaNLR-4B, characterized in that: The nucleotide sequence of the wheat disease resistance-related protein gene TaNLR-4B is shown in SEQ ID NO:

2.

3. An expression vector, characterized in that: It comprises the wheat disease resistance-related protein gene TaNLR-4B as described in claim 2.

4. The expression vector according to claim 3, characterized in that The wheat disease resistance-related protein gene TaNLR-4B is overexpressed, and the primers for overexpressing the wheat disease resistance-related protein gene TaNLR-4B are shown in SEQ ID NO: 3 and SEQ ID NO:

4.

5. A method for breeding wheat varieties resistant to stripe rust, characterized in that: Overexpression of the wheat disease resistance-related protein gene TaNLR-4B.

6. The method according to claim 5, characterized in that The expression vector according to claim 3 is transformed into wheat to obtain wheat resistant to stripe rust.

7. The method according to claim 6, characterized in that The transformation method is Agrobacterium-mediated genetic transformation.

8. The method according to claim 6, characterized in that The variety of wheat is wild type wheat Fielder.

9. Use of the wheat disease resistance-related protein gene TaNLR-4B according to claim 2 in the cultivation of wheat resistant to stripe rust.

10. The use according to claim 9, characterized in that: Overexpression of the wheat disease resistance-related protein gene TaNLR-4B improves the resistance of wheat to stripe rust.

Images