Application of protein DcFT1 in inhibition of flowering and growth of plants

Abstract

The invention discloses application of protein DcFT1 in inhibition of flowering and growth of plants. The amino acid sequence of the protein DcFT1 is as shown in SEQ ID NO: 2. Experiments prove that the overexpression of the DcFT1 gene in wild arabidopsis thaliana can inhibit flowering and growth, the flowering inhibition shows that the flowering time is delayed and the quantity of rosette leaves is increased during flowering, and the growth inhibition shows that the plant height is reduced; overexpression of the DcFT1 gene in nicotiana benthamiana can inhibit flowering and growth, flowering inhibition shows that flowering time is delayed, and growth inhibition shows that plant height is reduced and leaf area is reduced. Therefore, the protein DcFT1 can regulate and control flowering and growth of plants. The method has an important application value.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology, and particularly relates to application of protein DcFT1 in inhibiting plant flowering and growth. Background Art

[0002] Carrot (Daucus carota var. sativa Hoffm.) is a green vernalized long-day crop. When it reaches a certain size during the vegetative growth period, it encounters a certain period of low temperature in spring and summer and undergoes vernalization in advance, causing bolting and even flowering. This phenomenon is called premature bolting. After premature bolting of carrots, the fleshy roots quickly harden and lose their edible value, causing great economic losses to the majority of growers. Discovering genes related to flowering regulation in carrots is of great significance for quickly and effectively solving the problem of premature bolting of carrots.

[0003] FT and TFL belong to PEBPs (phosphatidyl ethanolamine-binding proteins). PEBP family proteins are widely present in bacteria, animals and plants, and mainly play a role in signal transduction pathways in growth and differentiation pathways. In angiosperms, FT / TFL is very conserved in protein sequence and function. For example, the homologous proteins of Arabidopsis AtFT, apple MdFT1, MdFT2, poplar PnFT1, PnFT2, pea PsFTa1, PsFTa2 promote flower bud differentiation, while the homologous proteins of AtTFL1, apple MdTFL1, pea PsTFL1a, PsTFL1c delay flower bud differentiation. During the evolution of FT homologous genes, some genes have evolved the function of inhibiting flower organ differentiation. For example, the wild sunflower genome has only one HaFT1 gene that promotes flower bud differentiation, while the cultivated sunflower genome contains four FT genes, one of which is a frameshift mutant of the HaFT1 gene, and its function is to inhibit flower bud differentiation. The sugar beet genome contains two FT homologs, which have opposite functions in inducing flowering. BvFT1 inhibits flower bud differentiation, while BvFT2 promotes flower bud differentiation. So far, the specific function of the DcFT1 gene in carrots is unclear. Summary of the invention

[0004] The purpose of the present invention is to inhibit the flowering of plants or to delay the flowering time of plants.

[0005] The present invention firstly protects the application of protein DcFT1, which can be S1) or S2) or S3) or S4): S1) inhibiting flowering of plants; S2) Generate transgenic plants with delayed flowering time; S3) inhibit plant growth; S4) Cultivation of transgenic plants with inhibited growth.

[0006] The present invention also protects the use of nucleic acid molecules encoding protein DcFT1, which can be S1) or S2) or S3) or S4): S1) inhibiting flowering of plants; S2) Generate transgenic plants with delayed flowering time; S3) inhibit plant growth; S4) Cultivation of transgenic plants with inhibited growth.

[0007] In any of the above applications, the inhibition of plant flowering may be manifested as a delay in the flowering time of the plant.

[0008] In any of the above applications, the inhibition of plant growth may be manifested as a reduction in plant height and / or leaf area.

[0009] In any of the above applications, the growth may be plant height and / or leaves.

[0010] In any of the above applications, the plant can be any one of the following c1) to c8): c1) dicotyledonous plants; c2) monocotyledonous plants; c3) Solanaceae plants; c4) tobacco; c5) Nicotiana benthamiana; c6) cruciferous plants; c7) Arabidopsis thaliana; c8) wild type Arabidopsis thaliana Columbia-0 subtype.

[0011] The present invention also protects a method for cultivating transgenic plants, which may include the following steps: increasing the expression level and / or activity of protein DcFT1 in a starting plant to obtain a transgenic plant; compared with the starting plant, the flowering time of the transgenic plant is delayed and / or the growth is inhibited.

[0012] In the above method, the expression level and / or activity of the protein DcFT1 in the starting plant can be increased by methods well known in the art such as transgenic, multiple copies, changing promoters, regulatory factors, etc., to achieve the effect of increasing the expression level and / or activity of the protein DcFT1 in the starting plant.

[0013] In the above method, increasing the expression level and / or activity of the protein DcFT1 in the starting plant is achieved by introducing a nucleic acid molecule encoding the protein DcFT1 into the starting plant.

[0014] In the above method, the introduction of the nucleic acid molecule encoding the protein DcFT1 into the starting plant can be achieved by introducing a recombinant vector into the starting plant; the recombinant vector can be a recombinant plasmid obtained by inserting the nucleic acid molecule encoding the protein DcFT1 into an expression vector. The expression vector can specifically be the overexpression vector SUP1300.

[0015] In the above method, the recombinant vector can be specifically the recombinant plasmid SUP1300-DcFT1. The recombinant plasmid SUP1300-DcFT1 can be specifically the recombinant plasmid obtained by replacing the small DNA fragment between the recognition sequences of the restriction endonucleases HindⅢ and KpnI of the overexpression vector SUP1300 with the DNA molecule shown in SEQ ID NO: 1 from position 1 to 531 from the 5' end.

[0016] The transgenic plant may be specifically the one mentioned in Example 2 OEDcFT1-2 or OEDcFT1-4 ; The starting plant at this time is wild-type Arabidopsis thaliana ( Arabidopsis thaliana ) (Columbia-0 subtype).

[0017] The transgenic plant may be specifically the one mentioned in Example 3 OEDcFT1-1 , OEDcFT1-2 and OEDcFT1-4 ; The starting plant at this time is Nicotiana benthamiana.

[0018] The present invention also protects a plant breeding method, which may include the following steps: increasing the content and / or activity of the protein DcFT1 in the plant, thereby delaying flowering time and / or inhibiting growth.

[0019] In any of the above methods, the growth may be plant height and / or leaves.

[0020] In any of the above methods, the growth inhibition may be manifested as a reduction in plant height and / or a reduction in leaf area.

[0021] Any of the above-mentioned proteins DcFT1 may be a1) or a2) or a3): a1) the amino acid sequence is the protein shown in SEQ ID NO: 2; a2) A fusion protein obtained by connecting a tag to the N-terminus or / and C-terminus of the protein shown in a1); a3) A protein related to plant flowering and / or growth obtained by substituting and / or deleting and / or adding one or more amino acid residues in the amino acid sequence shown in a1) or a2).

[0022] In a2), the tag may be a Poly-Arg tag (RRRRR), a FLAG tag (DYKDDDDK), a Strep-tag tag (WSHPQFEK) or a c-myc tag (EQKLISEEDL).

[0023] In a3), the substitution and / or deletion and / or addition of one or several amino acid residues is the substitution and / or deletion and / or addition of no more than 10 amino acid residues.

[0024] The protein DcFT1 in a3) can be artificially synthesized, or its encoding gene can be synthesized first and then expressed biologically.

[0025] The protein DcFT1 in a3) can be obtained by deleting one or several codons of amino acid residues in the DNA sequence shown in SEQ ID NO:1, and / or performing missense mutation of one or several base pairs, and / or connecting the coding sequence of any of the above-mentioned tags to its 5′ end and / or 3′ end.

[0026] Among them, SEQ ID NO: 2 consists of 177 amino acid residues.

[0027] Any of the above-mentioned nucleic acid molecules encoding protein DcFT1 may be a DNA molecule as shown in b1) or b2) or b3) or b4) below: b1) the coding region is the DNA molecule shown in SEQ ID NO: 1; b2) the nucleotide sequence is the DNA molecule shown in SEQ ID NO: 1; b3) a DNA molecule that has 75% or more identity with the nucleotide sequence specified in b1) or b2) and encodes the protein DcFT1; b4) A DNA molecule which hybridizes under stringent conditions to the nucleotide sequence defined in b1) or b2) and encodes the protein DcFT1.

[0028] The nucleic acid molecule may be DNA, such as cDNA, genomic DNA or recombinant DNA; the nucleic acid molecule may also be RNA, such as mRNA or hnRNA.

[0029] Wherein, SEQ ID NO: 1 consists of 534 nucleotides, and the DNA molecule shown in SEQ ID NO: 1 encodes the amino acid sequence shown in SEQ ID NO: 2.

[0030] A person skilled in the art can easily mutate the nucleotide sequence encoding the protein DcFT1 of the present invention by using known methods, such as directed evolution and point mutation. Those artificially modified nucleotides having 75% or higher identity with the nucleotide sequence encoding the protein DcFT1 isolated by the present invention are derived from the nucleotide sequence of the present invention and are equivalent to the sequence of the present invention as long as they encode the protein DcFT1.

[0031] The term "identity" as used herein refers to sequence similarity with a natural nucleic acid sequence. "Identity" includes nucleotide sequences that have 75% or more, or 80% or more, or 85% or more, or 90% or more, or 95% or more identity with the nucleotide sequence encoding the amino acid sequence of the present invention, such as the protein DcFT1 shown in SEQ ID NO:2. The identity can be evaluated by the naked eye or by computer software. Using computer software, the identity between two or more sequences can be expressed as a percentage (%), which can be used to evaluate the identity between related sequences.

[0032] Any of the plants described above may be any one of the following c1) to c8): c1) dicotyledonous plants; c2) monocotyledonous plants; c3) Solanaceae plants; c4) tobacco; c5) Nicotiana benthamiana; c6) cruciferous plants; c7) Arabidopsis thaliana; c8) wild type Arabidopsis thaliana Columbia-0 subtype.

[0033] Experiments have shown that overexpression in wild-type Arabidopsis DcFT1 The gene can inhibit flowering and growth. The inhibition of flowering is manifested by delayed flowering time and increased number of rosette leaves at flowering, and the inhibition of growth is manifested by reduced plant height. It is overexpressed in Nicotiana benthamiana DcFT1 The gene can inhibit flowering and growth, and the inhibition of flowering is manifested as delayed flowering time, and the inhibition of growth is manifested as reduced plant height and reduced leaf area. It can be seen that the protein DcFT1 can regulate plant flowering and growth. The present invention has important application value. BRIEF DESCRIPTION OF THE DRAWINGS

[0034] Figure 1 This is the semi-quantitative RT-PCR detection of the expression level of the DcFT1 gene in the DcFT1 gene-transfected Arabidopsis thaliana in step 4 of Example 2.

[0035] Figure 2 Detection of step 5 in Example 2 DcFT1 Overexpression positive strains OEDcFT1-2 and OEDcFT1-4 flowering phenotype.

[0036] Figure 3 This is the semi-quantitative RT-PCR detection of the expression level of the DcFT1 gene in the DcFT1 gene-transfected tobacco in step 4 of Example 3.

[0037] Figure 4 Detection of step 5 in Example 3 DcFT1 Overexpression positive strains OEDcFT1-1 , OEDcFT1-2 and OEDcFT1-4 flowering phenotype. DETAILED DESCRIPTION

[0038] The present invention is further described in detail below in conjunction with specific embodiments, and the examples provided are only for illustrating the present invention, rather than for limiting the scope of the present invention. The examples provided below can be used as a guide for further improvements by those of ordinary skill in the art, and do not constitute a limitation of the present invention in any way.

[0039] The experimental methods in the following examples, unless otherwise specified, are all conventional methods, and are performed according to the techniques or conditions described in the literature in the field or according to the product instructions. The materials, reagents, etc. used in the following examples, unless otherwise specified, can all be obtained from commercial channels.

[0040] The quantitative tests in the following examples were all repeated three times, and the results were averaged.

[0041] Wild-type Arabidopsis thaliana ( Arabidopsis thaliana ) (Columbia-0 subtype) is described in the following literature: Kim H, Hyun Y, Park J, Park M, Kim M, Kim H, Lee M, Moon J, Lee I, Kim JA Genetic link between cold responses and flowering time through FVE in Arabidopsis thaliana .Nature Genetics.2004,36:167-171.DEXH box RNA helicase-mediated mitochondrial reactive oxygen species production in Arabidopsis mediatescrosstalk between abscisic acid and auxin signaling.[J].Plant Cell,2012,24(5):1815-1833. In the following, wild-type Arabidopsis ( Arabidopsis thaliana ) (Columbia-0 subtype) is referred to as wild-type Arabidopsis thaliana.

[0042] Example 1. Acquisition of DcFT1 gene After a large number of experiments, the inventors of the present invention obtained a DNA molecule shown in SEQ ID NO: 1 from the cDNA of the carrot variety Huayu 388 and named it DcFT1 gene.

[0043] The DcFT1 gene encodes the protein DcFT1 shown in SEQ ID NO:2.

[0044] Example 2: Obtaining DcFT1 transgenic Arabidopsis and detecting flowering phenotype 1. Construction of recombinant plasmid SUP1300-DcFT1 1. Using the DNA fragment with nucleotide sequence as shown in SEQ ID NO: 1 as template, primers FT1-F: CGC AAGCTT ATGCCGCCTAGAGCCGATCC (underlined is the recognition site of restriction endonuclease HindⅢ) and primer FT1-R: CGG GGTACC PCR amplification was performed using a primer pair consisting of ATTTGGTGGTCTTCTTCGGC (the underline is the recognition site of the restriction endonuclease KpnI) to obtain a PCR amplification product.

[0045] 2. Double digest the PCR amplification product obtained in step 1 with restriction endonucleases HindⅢ and KpnI, and recover a digestion product of about 534 bp.

[0046] 3. Double digest the overexpression vector SUP1300 (described in the following literature: Z Gong, T Morales-Ruiz, RR Ariza, T Roldán-Arjona, L David, JK Zhu. ROS1, arepressor of transcriptional gene silencing in Arabidopsis, encodes a DNAglycosylase / lyase. Cell, 2002 (111): 803-14.) with restriction endonucleases HindⅢ and KpnI to recover a vector backbone of about 9000 bp.

[0047] 4. Connect the enzyme digestion product recovered in step 2 and the vector backbone recovered in step 3 to obtain the recombinant plasmid SUP1300-DcFT1.

[0048] The recombinant plasmid SUP1300-DcFT1 was sequenced. The sequencing results showed that the recombinant plasmid SUP1300-DcFT1 replaced the small DNA fragment between the recognition sequences of the restriction endonucleases HindⅢ and KpnI of the overexpression vector SUP1300 with the DNA molecule shown in SEQ ID NO: 1 from position 1 to 531 from the 5' end. The recombinant plasmid SUP1300-DcFT1 expressed the protein DcFT1 shown in SEQ ID NO: 2.

[0049] 2. Obtaining recombinant Agrobacterium 1. The recombinant plasmid SUP1300-DcFT1 was introduced into Agrobacterium tumefaciens GV3101 (Weidi Biotechnology, CAT#: AC1001) to obtain recombinant Agrobacterium, named GV3101 / SUP1300-DcFT1.

[0050] 2. The overexpression vector SUP1300 was introduced into Agrobacterium tumefaciens GV3101 to obtain recombinant Agrobacterium, which was named GV3101 / SUP1300.

[0051] 3. Obtaining DcFT1-transgenic Arabidopsis 1. The pollen tube infection method (described in the following literature: Clough, SJ, and Bent, AF. Floral dip: a simplified method for Agrobacterium-mediated transformation of Arabidopsis thaliana. Plant J. (1998) 16, 735-743.) was used to transfer GV3101 / SUP1300-DcFT1 into wild-type Arabidopsis to obtain T1 generation transgenic plants. DcFT1 Gene Arabidopsis seeds.

[0052] 2. Transfer the T1 obtained in step 1 DcFT1 The transgenic Arabidopsis seeds were sown on MS solid medium containing 50 mg / L hygromycin. The Arabidopsis that could grow normally (resistant seedlings) were the T1 generation transgenic plants. DcFT1 Gene positive seedlings, T1 generation DcFT1 The seeds received from the gene-positive seedlings are the T2 generation transgenic DcFT1 Gene Arabidopsis seeds.

[0053] 3. Transform the T2 generation of different strains selected in step 2 DcFT1 The genetic Arabidopsis seeds were sown on MS solid medium containing 50 mg / L hygromycin for screening. If the ratio of the number of Arabidopsis that can grow normally (resistant seedlings) to the number of Arabidopsis that cannot grow normally (non-resistant seedlings) in a certain strain is 3:1, then the strain is DcFT1 The gene is inserted into a line with one copy, and the seeds received from the resistant seedlings in this line are T3 generation transgenic plants. DcFT1 Gene Arabidopsis seeds.

[0054] 4. Transfer the T3 selected in step 3 DcFT1 The Arabidopsis thaliana seeds were sown again on MS solid medium containing 50 mg / L hygromycin for screening, and all resistant seedlings were T3 generation homozygous transgenic seedlings. DcFT1 Gene Arabidopsis thaliana (i.e., DcFT1 gene-transgenic Arabidopsis thaliana). Three T3 generations were homozygous for the DcFT1Arabidopsis thaliana strains were named OEDcFT1-1, OEDcFT1-2 and OEDcFT1-4 , and conduct subsequent experiments.

[0055] According to the above method, GV3101 / SUP1300-DcFT1 was replaced with GV3101 / SUP1300, and the other steps were the same, to obtain T3 generation homozygous empty vector Arabidopsis plants, referred to as empty vector Arabidopsis.

[0056] 4. Semi-quantitative RT-PCR detection of the expression level of DcFT1 gene in transgenic Arabidopsis thaliana The Arabidopsis seeds to be tested were OEDcFT1-1 T3 generation seeds , OEDcFT1-2 T3 generation seeds, OEDcFT1-4 T3 seeds, empty vector Arabidopsis seeds or wild-type Arabidopsis seeds.

[0057] 1. Take the Arabidopsis seeds to be tested, soak them in 70% (v / v) ethanol aqueous solution for 30 seconds, wash them with sterile water for 3 times; then spread them on MS solid culture medium and vernalize them at 4℃ for 2 days.

[0058] 2. After completing step 1, take the Arabidopsis seeds to be tested, and culture them at 21° C. in alternating light and dark conditions (12 h light culture / 12 h dark culture) for 10 days to obtain Arabidopsis seedlings to be tested.

[0059] 3. The total RNA of the Arabidopsis seedlings to be tested was extracted using the Trizo1 method, and then the first-strand cDNA was reverse transcribed. The cDNA was diluted 50 times with sterile water as a template, and the expression level of the DcFT1 gene was detected by semi-quantitative RT-PCR (AtACTIN2 gene was used as an internal reference gene).

[0060] The primers for detecting the DcFT1 gene were 5′-ACGGCTGTGAGTTGAGACCTTC-3′ and 5′-AGGCGAACCCAGATTGTATTGT-3′.

[0061] The primers for detecting the AtACTIN2 gene were 5′-TATGGTCAAGGCTGGGTTCG-3′ and 5′-CCATGCTCGATGGGGTACTT-3′.

[0062] Test results are shown in Figure 1 (Col-0 is wild-type Arabidopsis). The results showed that compared with wild-type Arabidopsis, OEDcFT1-2 and OEDcFT1-4 The expression of DcFT1 gene in the OEDcFT1-2 and OEDcFT1-4 Both DcFT1 Overexpression positive strains.

[0063] 5. Detection DcFT1 Overexpression positive strains OEDcFT1-2 and OEDcFT1-4 Flowering phenotype The Arabidopsis seeds to be tested were OEDcFT1-2 T3 generation seeds, OEDcFT1-4 T3 seeds, empty vector Arabidopsis seeds or wild-type Arabidopsis seeds.

[0064] 1. Take the Arabidopsis seeds to be tested, soak them in 70% (v / v) ethanol aqueous solution for 30 seconds, wash them with sterile water for 3 times; then spread them on MS solid culture medium and vernalize them at 4℃ for 2 days.

[0065] 2. After completing step 1, take the Arabidopsis seeds to be tested, culture them at 21°C with alternating light and dark conditions (12 h light culture / 12 h dark culture), record the culture days when flowering (the first day of culture from the start of alternating light and dark culture at 21°C) and the number of rosette leaves. Analyze the differences using t-test.

[0066] The growth status of wild-type Arabidopsis during flowering is shown in Figure 2 Center A (Col-0 is wild-type Arabidopsis thaliana).

[0067] Wild-type Arabidopsis thaliana, OEDcFT1-2 and OEDcFT1-4 See the cultivation days for flowering Figure 2 Middle B (Col-0 is wild-type Arabidopsis thaliana).

[0068] Wild-type Arabidopsis thaliana, OEDcFT1-2 and OEDcFT1-4 The number of rosette leaves at flowering is shown in Figure 2 Middle C (Col-0 is wild-type Arabidopsis thaliana).

[0069] The results showed that the wild-type Arabidopsis thaliana flowered after about 29 days of cultivation. OEDcFT1-2 and OEDcFT1-4 The number of days of cultivation until flowering is about 33 days; the wild-type Arabidopsis and DcFT1 Overexpression positive strains (such as OEDcFT1-2 , OEDcFT1-4 ) There were significant differences in the number of days of cultivation when flowering occurred. OEDcFT1-2 and OEDcFT1-4 There was no significant difference in the number of culture days at flowering. The number of rosette leaves in wild-type Arabidopsis at flowering was about 12. OEDcFT1-2 and OEDcFT1-4 The number of rosette leaves at flowering is about 14; wild-type Arabidopsis and DcFT1 Overexpression positive strains (such as OEDcFT1-2 , OEDcFT1-4 ) There were significant differences in the number of rosette leaves at flowering. OEDcFT1-2 andOEDcFT1-4 There was no significant difference in the number of rosette leaves at flowering. DcFT1 Overexpression positive strains (such as OEDcFT1-2 , OEDcFT1-4 ) significantly decreased in plant height.

[0070] The above results indicate that overexpression of the DcFT1 gene in wild-type Arabidopsis can inhibit flowering and growth; the inhibition of flowering is manifested as a delay in flowering time and an increase in the number of rosette leaves during flowering; the inhibition of growth is manifested as a decrease in plant height.

[0071] Example 3: Obtaining DcFT1 transgenic tobacco and detecting flowering phenotype 1. Construction of recombinant plasmid SUP1300-DcFT1 Same as step 1 in Example 2.

[0072] 2. Obtaining recombinant Agrobacterium 1. The recombinant plasmid SUP1300-DcFT1 was introduced into Agrobacterium tumefaciens GV3101 (Weidi Biotechnology, CAT#: AC1001) to obtain recombinant Agrobacterium, named GV3101 / SUP1300-DcFT1.

[0073] 2. The overexpression vector SUP1300 was introduced into Agrobacterium tumefaciens GV3101 to obtain recombinant Agrobacterium, which was named GV3101 / SUP1300.

[0074] 3. Obtaining transgenic tobacco with DcFT1 gene 1. Using hygromycin as a screening agent, the Agrobacterium infection method (described in the following literature: Sunilkumar G, Vijayachandra K, Veluthambi K. Preincubation of cut tobacco leaf explants promotes Agrobacterium-mediated transformation by increasing vir gene induction. Plant Science, 1999. 141 (1): 51-58.) was used to transfer GV3101 / SUP1300-DcFT1 to leaves of Nicotiana benthamiana to obtain T3 generation homozygous DcFT1 gene-transfected tobacco (i.e., DcFT1 gene-transfected tobacco). Five of the DcFT1 gene-transfected tobacco lines were named OEDcFT1-1, OEDcFT1-2, OEDcFT1-3, OEDcFT1-4 and OEDcFT1-5 , and conduct subsequent experiments.

[0075] 2. Using hygromycin as the selection agent, GV3101 / SUP1300 was transferred to the leaves of Nicotiana benthamiana by Agrobacterium infection to obtain empty vector tobacco.

[0076] 4. Semi-quantitative RT-PCR detection of the expression level of DcFT1 gene in transgenic tobacco The tobacco seeds to be tested were OEDcFT1-1 T3 generation seeds , OEDcFT1-2 T3 generation seeds, OEDcFT1-3 T3 generation seeds, OEDcFT1-4 T3 generation seeds, OEDcFT1-5 T3 generation seeds, empty vector tobacco seeds or Nicotiana benthamiana seeds.

[0077] 1. Sow the tobacco seeds to be tested in nutrient soil and culture them under alternating light and dark conditions (12 h light culture / 12 h dark culture) at 25°C for 7 days to obtain tobacco seedlings to be tested.

[0078] 2. The total RNA of the tobacco seedlings to be tested was extracted by Trizo1 method, and then the first-chain cDNA was reverse transcribed. The cDNA was diluted 50 times with sterile water as a template, and the expression level of DcFT1 gene was detected by semi-quantitative RT-PCR (NtACTIN2 gene was used as the internal reference gene).

[0079] The primers for detecting the DcFT1 gene were 5′-ACGGCTGTGAGTTGAGACCTTC-3′ and 5′-AGGCGAACCCAGATTGTATTGT-3′.

[0080] The primers for detecting the NtACTIN2 gene were 5′-TACTCACGAGTTGCCATCCAGG-3′ and 5′-CATCACCAGAGTCCAACACCAA-3′.

[0081] Test results are shown in Figure 3 (Col-0 is Nicotiana benthamiana). The results showed that compared with Nicotiana benthamiana, OEDcFT1-1 , OEDcFT1-2 and OEDcFT1-4 The expression of DcFT1 gene in the OEDcFT1-1 , OEDcFT1- 2 and OEDcFT1-4 Both DcFT1 Overexpression positive strains.

[0082] 5. Detection DcFT1 Overexpression positive strains OEDcFT1-1 , OEDcFT1-2 and OEDcFT1-4 Flowering phenotype The tobacco seeds to be tested were OEDcFT1-1 T3 generation seeds, OEDcFT1-2 T3 generation seeds, OEDcFT1-4 T3 generation seeds, empty vector tobacco seeds or Nicotiana benthamiana seeds.

[0083] 1. Sow the tobacco seeds to be tested in nutrient soil and culture them at 25℃ with alternating light and dark conditions (12h light culture / 12h dark culture). Record the culture days when they bloom (the first day of culture is counted as the day of 25℃ alternating light and dark culture). Use t-test to analyze the differences.

[0084] The growth state of Nicotiana benthamiana during flowering is shown in Figure 4 A, B and C (WT is Nicotiana benthamiana).

[0085] Tobacco Benth, OEDcFT1-1, OEDcFT1-2 and OEDcFT1-4 See the cultivation days for flowering Figure 4 Middle D (WT is Nicotiana benthamiana).

[0086] The results showed that the number of days for Nicotiana benthamiana to flower was about 40 days. OEDcFT1-1 , OEDcFT1-2 and OEDcFT1-4 The cultivation days for flowering are about 45 days; DcFT1 Overexpression positive strains (such as OEDcFT1- 1 , OEDcFT1-2 , OEDcFT1-4 ) There were significant differences in the number of days of cultivation when flowering occurred. OEDcFT1-1 , OEDcFT1-2 and OEDcFT1-4 There was no significant difference in the number of days of cultivation when flowering occurred. DcFT1 Overexpression positive strains (such as OEDcFT1-1 , OEDcFT1-2 , OEDcFT1-4 ) had significantly reduced plant height and leaf area.

[0087] The above results indicate that overexpression of the DcFT1 gene in Nicotiana benthamiana can inhibit flowering and growth; the inhibition of flowering is manifested as a delay in flowering time, and the inhibition of growth is manifested as a decrease in plant height and leaf area.

[0088] The present invention has been described in detail above. For those skilled in the art, without departing from the purpose and scope of the present invention, and without the need to carry out unnecessary experimental conditions, the present invention can be implemented in a wide range under equivalent parameters, concentrations and conditions. Although the present invention provides specific embodiments, it should be understood that the present invention can be further improved. In a word, according to the principles of the present invention, the application is intended to include any changes, uses or improvements to the present invention, including departure from the disclosed scope in the application, and changes made with conventional techniques known in the art.

Claims

1. Application of protein DcFT1, as S1) or S2) or S3) or S4): S1) inhibiting flowering of plants; S2) Generate transgenic plants with delayed flowering time; S3) inhibit plant growth; S4) Cultivation of transgenic plants with inhibited growth; The protein DcFT1 is a1) or a2) or a3): a1) the amino acid sequence is the protein shown in SEQ ID NO: 2; a2) A fusion protein obtained by connecting a tag to the N-terminus or / and C-terminus of the protein shown in a1); a3) A protein related to plant flowering and / or growth obtained by substituting and / or deleting and / or adding one or more amino acid residues in the amino acid sequence shown in a1) or a2).

2. Use of a nucleic acid molecule encoding the protein DcFT1 of claim 1, which is S1) or S2) or S3) or S4): S1) inhibiting flowering of plants; S2) Generate transgenic plants with delayed flowering time; S3) inhibit plant growth; S4) Cultivation of transgenic plants with inhibited growth.

3. The use according to claim 2, characterized in that: The nucleic acid molecule encoding the protein DcFT1 in claim 1 is a DNA molecule as shown in the following b1) or b2) or b3) or b4): b1) the coding region is the DNA molecule shown in SEQ ID NO: 1; b2) the nucleotide sequence is the DNA molecule shown in SEQ ID NO: 1; b3) a DNA molecule having 75% or more identity with the nucleotide sequence defined in b1) or b2) and encoding the protein DcFT1 as claimed in claim 1; b4) A DNA molecule which hybridizes with the nucleotide sequence defined in b1) or b2) under stringent conditions and encodes the protein DcFT1 as claimed in claim 1.

4. The use according to any one of claims 1 to 3, characterized in that: The inhibition of plant flowering is manifested as delayed flowering time of the plant; The inhibition of plant growth is manifested in a reduction in plant height and / or leaf area; The growth is plant height and / or leaves.

5. The use according to any one of claims 1 to 4, characterized in that: The plant is any one of the following c1) to c8): c1) dicotyledonous plant; c2) monocotyledonous plant; c3) Solanaceae plant; c4) tobacco; c5) Nicotiana benthamiana; c6) cruciferous plant; c7) Arabidopsis thaliana; c8) wild type Arabidopsis thaliana subtype Columbia-0.

6. A method for cultivating transgenic plants, comprising the following steps: increasing the expression level and / or activity of the protein DcFT1 described in claim 1 in a starting plant to obtain a transgenic plant; compared with the starting plant, the flowering time of the transgenic plant is delayed and / or the growth is inhibited.

7. The method according to claim 6, characterized in that: The "increasing the expression level and / or activity of the protein DcFT1 in claim 1 in the starting plant" is achieved by introducing a nucleic acid molecule encoding the protein DcFT1 into the starting plant.

8. A plant breeding method, comprising the steps of: increasing the content and / or activity of the protein DcFT1 according to claim 1 in a plant, thereby delaying flowering time and / or inhibiting growth.

9. The method according to any one of claims 6 to 8, characterized in that: The growth is plant height and / or leaves; The growth inhibition is manifested in a reduction in plant height and / or a reduction in leaf area.

10. The method according to any one of claims 6 to 9, characterized in that: The plant is any one of the following c1) to c8): c1) dicotyledonous plant; c2) monocotyledonous plant; c3) Solanaceae plant; c4) tobacco; c5) Nicotiana benthamiana; c6) cruciferous plant; c7) Arabidopsis thaliana; c8) wild type Arabidopsis thaliana subtype Columbia-0.

Images