SNP molecular marker related to immune traits of yak and application of SNP molecular marker

Abstract

The invention relates to the technical field of molecular biological detection, in particular to an SNP molecular marker related to immune traits of yaks and application of the SNP molecular marker. According to the invention, the SNP molecular marker related to the immune traits of yaks is obtained through screening and is located at the 55577127th position on the 22 # chromosome of a yak reference genome LUBosgruv3.0 version, and a mutant basic group is G or A. The content of immune globulin A, immune globulin G and immune globulin M of a yak individual can be obtained by utilizing the SNP molecular marker, a new SNP molecular marker resource is provided for non-diagnostic yak immune character marker-assisted selection, and a basis is provided for high-immunity yak breeding.

Description

Technical Field

[0001] The present invention relates to the technical field of molecular biology detection, and in particular to SNP molecular markers related to yak immune traits and applications thereof. Background Art

[0002] In the yak farming industry, diseases pose a serious threat to their health and cause economic losses. Although some diseases can be prevented by improving feeding management and using drugs and vaccines, these measures have not been able to effectively control the spread of infectious diseases. At the same time, the widespread use of drugs may lead to the development of drug resistance, which in turn affects the safety of livestock products.

[0003] From a long-term perspective, research on the genetic basis of disease resistance, screening for disease resistance-related genes, and conducting disease-resistant breeding at the molecular level to improve yaks' resistance and immunity to pathogens are important ways to fundamentally solve this problem. The potential economic benefits of disease-resistant breeding and its prospects in studying animal models of human diseases are driving the development of this field. With the advancement of molecular biology, molecular genetics, and genetic engineering technology, disease-resistant breeding has played an increasingly important role in yak breeding.

[0004] Yaks live in plateau areas and face harsh environmental conditions, which requires them to have stronger disease resistance to adapt to environmental pressures such as high altitude, low air pressure, strong ultraviolet rays, hypoxia and malnutrition. Therefore, improving the disease resistance of yaks is crucial to improving their adaptability.

[0005] Immune indicators are an important basis for reflecting the disease resistance of animals, which mainly depends on the health status and function of the immune system. The immune system is responsible for identifying and eliminating pathogens that invade the body, such as bacteria and viruses. When pathogens invade, the immune system will respond quickly and initiate a series of immune responses to resist and eliminate pathogens. Immune indicators usually include multiple parameters such as antibody levels, number of immune cells, inflammatory indicators, and cytokines. Antibodies are produced by B cells, are specific, and can effectively bind to and neutralize pathogens, thereby enhancing the efficiency of the overall immune response. In addition, the number and function of immune cells are important indicators for assessing the health status of the immune system. When attacked by pathogens, immune cells will be quickly activated and begin to proliferate to enhance their ability to respond to infections. At the same time, the levels of inflammatory indicators and cytokines also reflect the response status of the immune system, helping to monitor and regulate the intensity and duration of immune responses, ensuring that the immune system can effectively respond to challenges and maintain overall health.

[0006] Therefore, immune indicators can be used as an important reference for evaluating the disease resistance and health status of animals. By monitoring the changes in immune indicators, animal immune problems can be identified in a timely manner, and corresponding measures can be taken to improve their disease resistance, prevent and treat diseases.

[0007] Finding mutation sites related to disease resistance at the genetic level and using genetics and genetic engineering techniques to conduct association analysis to discover the relationship between genes and traits and conduct early selection will greatly improve the efficiency and accuracy of seed selection and has broad application prospects. Summary of the invention

[0008] The purpose of the present invention is to provide SNP molecular markers related to yak immune traits and applications thereof.

[0009] In order to achieve the above-mentioned object of the invention, the present invention provides the following technical solutions:

[0010] The present invention provides a SNP molecular marker associated with yak immune traits. The SNP molecular marker is located at the 55577127th base on chromosome 22 of the yak reference genome LU_Bosgru_v3.0 version, and the mutant base is G or A.

[0011] Preferably, the genotype of the yak with the mutant base G is GG or GA; the genotype of the yak with the mutant base A is AA; the content of immunoglobulin A in yak individuals with genotypes AA and GA is significantly higher than that in yak individuals with genotype GG; the content of immunoglobulin G in yak individuals with genotype AA is significantly higher than that in yak individuals with genotype GG; the content of immunoglobulin M in yak individuals with genotype AA is significantly higher than that in yak individuals with genotypes GA and GG; the content of immunoglobulin M in yak individuals with genotype GA is significantly higher than that in yak individuals with genotype GG.

[0012] The present invention provides the use of the SNP molecular marker in preparing a product for detecting yak immunity or a product for yak auxiliary breeding.

[0013] The present invention provides a primer pair for amplifying the SNP molecular markers described in the claims, and the sequence of the primer pair is shown in SEQ ID NOs: 1-2.

[0014] The present invention provides application of the primer pair in preparing a product for detecting yak immunity or a product for yak auxiliary breeding.

[0015] The invention provides a kit for detecting yak immunity, comprising a reagent for detecting the SNP molecular marker or the primer pair.

[0016] The invention provides a kit for yak assisted breeding, comprising a reagent for detecting the SNP molecular marker or the primer pair.

[0017] The present invention provides a method for marker-assisted selection of yak immune traits for non-diagnostic purposes, comprising the following steps:

[0018] (1) Extracting yak genomic DNA;

[0019] (2) using the yak genomic DNA obtained in step (1) as a template, and performing amplification using the primer pair to obtain an amplified product;

[0020] (3) Performing genotyping analysis on the amplified products to obtain yaks with different genotypes; correlating the genotypes of the yaks with immune indicators; the immune indicators are one or more of immunoglobulin A, immunoglobulin G and immunoglobulin M.

[0021] Preferably, the amplification system in step (2) comprises 25 μL in total, 12.5 μL of 2×L-Exp TaqMasterMix (dye plus), 8.5 μL of RNase free water, 1 μL of upstream primer, 1 μL of downstream primer, and 2 μL of template.

[0022] Preferably, the amplification program in step (2) is: 94°C for 1 min, 98°C for 10 s, 58°C for 30 s, 72°C for 1 min, for a total of 35 cycles; and extension at 72°C for 2 min.

[0023] By adopting the above technical solution, the present invention has the following beneficial effects:

[0024] The present invention provides SNP molecular markers related to yak immune traits and their role in breeding. Through research, the present invention finds that the SNP site related to yak immunity is located at the 55577127th base on chromosome 22 of the yak reference genome LU_Bosgru_v3.0 version, the variation type is G / A, and there are 3 genotypes. When the 55577127th base on chromosome 22 is G, the genotype is GG or GA: when the 55577127th base on chromosome 22 is A, the genotype is AA.

[0025] Through the association analysis between different genotypes and the contents of immunoglobulin A, immunoglobulin G and immunoglobulin M, it was found that the content of immunoglobulin A in yak individuals with genotypes of AA and GA was significantly higher than that in yak individuals with genotypes of GG (p<0.05); the content of immunoglobulin G in yak individuals with genotypes of AA was significantly higher than that in yak individuals with genotypes of GG (p<0.05); the content of immunoglobulin M in yak individuals with genotypes of AA was significantly higher than that in yak individuals with genotypes of GA and GG (p<0.05); the content of immunoglobulin M in yak individuals with genotypes of GA was significantly higher than that in yak individuals with genotypes of GG (p<0.05).

[0026] The present invention can obtain the content of immunoglobulin A, immunoglobulin G and immunoglobulin M of individual yaks by detecting the base at the 55577127th nucleotide site on chromosome 22 of yaks. The present invention provides a new SNP molecular marker resource for marker-assisted selection of yak immune traits for non-diagnostic purposes and provides a basis for breeding yaks with high immunity. BRIEF DESCRIPTION OF THE DRAWINGS

[0027] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments or the description of the prior art will be briefly introduced below. Obviously, the drawings described below are only embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on the provided drawings without paying creative work.

[0028] Figure 1 is the PCR amplification product: M represents Marker; 1, 2, and 3 represent 3 groups of repetitions;

[0029] Figure 2 The peak diagram and sequence obtained after sequencing the PCR product. DETAILED DESCRIPTION

[0030] The present invention provides a SNP molecular marker associated with yak immune traits. The SNP molecular marker is located at the 55577127th base on chromosome 22 of the yak reference genome LU_Bosgru_v3.0 version, and the mutant base is G or A.

[0031] In the present invention, the genotype of the yak with the mutant base G is GG or GA; the genotype of the yak with the mutant base A is AA; the content of immunoglobulin A in yak individuals with genotypes AA and GA is significantly higher than that in yak individuals with genotype GG; the content of immunoglobulin G in yak individuals with genotype AA is significantly higher than that in yak individuals with genotype GG; the content of immunoglobulin M in yak individuals with genotype AA is significantly higher than that in yak individuals with genotypes GA and GG; the content of immunoglobulin M in yak individuals with genotype GA is significantly higher than that in yak individuals with genotype GG.

[0032] The present invention also provides the use of the SNP molecular marker in preparing products for detecting yak immunity or yak assisted breeding products.

[0033] The present invention also provides a primer pair for amplifying the SNP molecular markers described in the claims, and the sequence of the primer pair is shown in SEQ ID NOs: 1-2.

[0034] In the present invention, the sequence SEQ ID NO: 1 in the primer pair is the upstream primer, and the specific sequence is 5'-CCTCCCCATAAACAGAACCTGG-3'; the sequence SEQ ID NO: 2 in the primer pair is the downstream primer, and the specific sequence is 5'-ACAAGTAAGGAAATAGTCCCCAAAT-3'.

[0035] The present invention provides application of the primer pair in preparing a product for detecting yak immunity or a product for yak auxiliary breeding.

[0036] The invention provides a kit for detecting yak immunity, comprising a reagent for detecting the SNP molecular marker or the primer pair.

[0037] The invention provides a kit for yak assisted breeding, comprising a reagent for detecting the SNP molecular marker or the primer pair.

[0038] The present invention provides a method for marker-assisted selection of yak immune traits for non-diagnostic purposes, comprising the following steps:

[0039] (1) Extracting yak genomic DNA;

[0040] (2) using the yak genomic DNA obtained in step (1) as a template, and performing amplification using the primer pair to obtain an amplified product;

[0041] (3) Performing genotyping analysis on the amplified products to obtain yaks with different genotypes; correlating the genotypes of the yaks with immune indicators; the immune indicators are one or more of immunoglobulin A, immunoglobulin G and immunoglobulin M.

[0042] In the present invention, the amplification system described in step (2) is 25 μL in total, including 12.5 μL of 2×L-Exp TaqMasterMix (dyeplus), 8.5 μL of RNase free water, 1 μL of upstream primer, 1 μL of downstream primer, and 2 μL of template.

[0043] In the present invention, the amplification program described in step (2) is: 94°C for 1 min, 98°C for 10 s, 58°C for 30 s, 72°C for 1 min, for a total of 35 cycles; and extension at 72°C for 2 min.

[0044] The technical solutions provided by the present invention are described in detail below in conjunction with the embodiments, but they should not be construed as limiting the protection scope of the present invention.

[0045] Example 1

[0046] 1. Sample collection

[0047] The invention uses the Niangya yak breed as the detection object, collects 5 mL of blood samples from 190 fasting yaks from the Jiali County ranch in Nagqu City, Tibet Autonomous Region, and puts them in a clean pro-coagulant vacuum blood collection tube, lets them stand for 30 minutes, and then centrifuges them at 3500r / min for 10 minutes, draws the supernatant into a PE tube, seals it and stores it in a -20°C low-temperature refrigerator; another 5 mL of blood sample is collected and added to a blood collection tube containing EDTA-K2 anticoagulant. After the blood sample is collected, it is quickly mixed, temporarily stored in a sampling box containing an ice pack, and transported back to the laboratory and frozen in a -20°C refrigerator for DNA extraction.

[0048] 2 Main reagents and instruments

[0049] EDTA-K2 vacuum blood collection tubes were purchased from Jiangsu Yuli Medical Instrument Co., Ltd.; blood genome extraction kits were purchased from Tiangen Biochemical Technology (Beijing) Co., Ltd.; Nano Drop 2000 spectrophotometer was purchased from Thermo Fisher Scientific, USA; DL2000 Marker, agarose, and nucleic acid dyes were purchased from Beijing Solebold Technology Co., Ltd.; 2×L-Exp TaqMasterMix (dye plus) was purchased from Hunan Aikerui Bioengineering Co., Ltd.; electrophoresis instrument was purchased from Beijing Liuyi Instrument Factory; PCR instrument was purchased from BioRad. IgA (MB-4907A), IgG (MB-4616A), and IgM (MB-4908A) detection kits were purchased from Jiangsu Enzyme Biotechnology Co., Ltd.

[0050] 3 Methods

[0051] 3.1 Immunoglobulin IgA, IgG, and IgM detection

[0052] According to the IgA, IgG, and IgM detection kits of Jiangsu Enzyme Biotechnology Co., Ltd., the double antibody one-step sandwich method was used for determination. First, the required strips were taken out from the aluminum foil bag after equilibration at room temperature for 20 minutes, and the remaining strips were sealed with a self-sealing bag and returned to 4°C. Set up standard wells and sample wells, and add 50μL of different concentrations of standard wells to each standard well; first add 10μL of the sample to be tested to the sample well, and then add 40μL of sample diluent; blank wells are not added. In addition to the blank wells, 100μL of horseradish peroxidase (HRP)-labeled detection antibody is added to each well of the standard well and sample well, and the reaction wells are sealed with a sealing film, and incubated at 37°C water bath or constant temperature box for 60min. Discard the liquid, pat dry on absorbent paper, fill each well with washing solution, let stand for 1min, shake off the washing solution, pat dry on absorbent paper, and repeat the washing 5 times (you can also use a plate washer to wash the plate). Add 50μL of substrate A and B to each well and incubate at 37°C in the dark for 15min. Add 50 μL of stop solution to each well, and measure the OD value of each well at a wavelength of 450 nm within 15 minutes. Finally, draw a standard curve: in an Excel worksheet, use the concentration of the standard as the horizontal axis and the corresponding OD value as the vertical axis to draw a linear regression curve of the standard, and calculate the IgA, IgG, and IgM concentration values ​​of each sample according to the curve equation.

[0053] 3.2 Extraction of genomic DNA from blood

[0054] The blood genome extraction kit of Tiangen Biochemical Technology (Beijing) Co., Ltd. was used to extract genomic DNA from the blood samples. The extracted DNA was placed under an ultraviolet spectrophotometer to detect the concentration and purity. The concentration was >20ng / μL and OD 260 / OD 280 A value between 1.7 and 1.9 meets the experimental requirements and can be stored at -20°C for future use.

[0055] 3.3 Primer design

[0056] With reference to the gene sequence of chromosome 22 of the yak genome LU_Bosgru_v3.0 version (Ensemble accession number: ENSBGRG00000014471), the Pick Primers online tool provided by the NCBI website was used to design specific primers, including the g55577127G>A SNP site.

[0057] Primer sequences

[0058] F: 5'-CCTCCCCATAAACAGAACCTGG-3' (SEQ ID NO: 1);

[0059] R: 5'-ACAAGTAAGGAAATAGTCCCCAAAT-3' (SEQ ID NO: 2).

[0060] The length of the amplified fragment was 485 bp, and the primers were synthesized by Beijing Qingke Biotechnology Co., Ltd.

[0061] 3.4 PCR amplification and sequencing

[0062] PCR amplification system 25 μL: 2×L-Exp Taq MasterMix (dye plus) 12.5 μL, RNase free water 8.5 μL, upstream primer 1 μL, downstream primer 1 μL, template 2 μL.

[0063] PCR amplification program: 94°C for 1 min, 98°C for 10 s, 58°C for 30 s, 72°C for 1 min, for a total of 35 cycles; extension at 72°C for 2 min.

[0064] The PCR products were tested by 1% agarose gel electrophoresis. After the PCR products passed the agarose gel electrophoresis test, they were sequenced by direct sequencing, and the sequencing was completed by Beijing Qingke Biotechnology Co., Ltd. Figure 1 shown. Figure 1 The results showed that the length of the sequence obtained by PCR amplification was 485 bp, and sequencing showed that a G / A mutation occurred in the 144th nucleotide sequence of the amplified product (base 55577127 on chromosome 22 of the genome LU_Bosgru_v3.0 version). The amplified product band was clear without any other bands, and had good specificity.

[0065] The site was preliminarily identified as a SNP marker site of yak, named g55577127G>A SNP. The sequence obtained by PCR amplification is shown in SEQ ID NO:3, and the 144th position of the sequence is a G mutation. The size of the PCR amplification product fragment is consistent with the expected size, and the next step of the experiment can be carried out.

[0066] SEQ ID NO:3

[0067] CCTCCCCATAAACAGAACCTGGCTGTGCTTGGGGTGGCCATGTGCCCAGCACAGAAAACTCATCTCCCAGCCACCCCTGTGACTGGGGTGGCCACGTGACATGGTTCTGGTTAACAAGATGTACAAGGAAAATGCTGAATGGAG CTTCAGAAGAGCACTTTAAAAGGCGGTCAGGACTGTTATCTTTCTTCTTCTTACTGCCTGGTATGCAGCTACAGTGTTGCAAGTGGAAACCAAGAAGTGTATGAAGCAGTGTTGAGTAGAAAGACAGAAGGAACTGGGTTTCTGGGCACTGTGTAGTTAACTTAGCTGTTCTGGAATGTCCACT TCAAGATTTGTTATTAGAAAAGAAAACTCAAAGCCTCGTTAGGATCAGCTACTAAAAGCTGCCCTTTGTGTTACATGCAGCCAAACACATTCCTAATTGGTTTTTAAAAAATTTCTTCCACCAATTTATTTGGGGACTATTTCCTTACTTGT

[0068] The biological analysis software MEGA 11.0 was used to compare the sequencing results of PCR products, analyze the sequencing peak graph, and complete the typing.

[0069] 4 Statistical analysis

[0070] According to the genotyping results, the number of individuals with different genotypes at each site was counted. Popgen32 software was used to calculate the g55577127G>A gene frequency, genotype frequency, effective allele number (Ne), site heterozygosity (He), and Hardy-Weinberg equilibrium test, and PIC (polymorphism information content, referred to as PIC) calculation software was used to calculate the polymorphic information content. The general linear model in IBM SPSS Statistics 26 software was used to analyze the association between different genotypes of yaks and immunoglobulins IgA, IgG, and IgM. The results are expressed as "mean ± standard error".

[0071] 5 Results

[0072] 5.1 PCR amplification and sequencing results

[0073] The amplified product of the g55577127G>A SNP site on chromosome 22 of yak was detected by 1% agarose gel (see Figure 1 ), the bands were clear without any other bands, the specificity was good, and the PCR product fragment size was 485bp, which was in line with the expected size, so the next step of the experiment could be carried out.

[0074] The peak diagram and sequence obtained after the PCR product was purified and sequenced are shown in Figure 2 .Depend on Figure 2It can be seen that a G-A mutation occurred at the g55577127G>A SNP locus, and there are three genotypes: GG, GA, and AA.

[0075] 5.2 Statistical analysis results

[0076] From the perspective of population genetics, the genotypes and allele frequencies of the g55577127G>A SNP locus on chromosome 22 of yaks were analyzed. As shown in Table 1, at the g55577127G>A SNP locus, the GG genotype frequency was the highest, being the dominant genotype, and the G allele frequency was 73.4%, showing as the dominant allele. By χ 2 The fitness test showed that the SNP locus significantly deviated from the Hardy-Weinberg equilibrium state (P<0.05) (Table 1). The expected heterozygosity of this locus was 0.390, and the PIC was 0.314. Since 0.25<PIC<0.50, it belongs to moderate polymorphism.

[0077] Table 1 Polymorphism of the g55577127G>A SNP locus on chromosome 22 of yaks

[0078]

[0079]

[0080] 5.3 Association analysis of different genotypes with immunoglobulins IgA, IgG, and IgM

[0081] The general linear model in IBM SPSS Statistics 26 software was used to analyze the association between different genotypes of yaks and the contents of immunoglobulins IgA, IgG, and IgM. The results showed that the IgA content of yak individuals with AA and GA genotypes was significantly higher than that of GG genotype individuals (p<0.05), the IgG content of yak individuals with AA genotype was significantly higher than that of GG genotype individuals (p<0.05), there was no significant difference in the IgA and IgG contents between AA and GA genotype individuals (p>0.05), and there was also no significant difference between GA and AA genotype yak individuals (p>0.05). The IgM content of yak individuals with AA genotype was significantly higher than that of GA and GG genotype individuals (p<0.05), and the IgM content of yak individuals with GA genotype was significantly higher than that of GG genotype individuals (p<0.05). It shows that the bases at the g55577127G>A SNP locus on chromosome 22 of yaks are significantly correlated with yak IgA, IgG, and IgM, and are SNP markers related to yak IgA, IgG, and IgM. The results are shown in Table 2.

[0082] Table 2 Correlation analysis between different genotypes and immunoglobulins IgA, IgG, and IgM

[0083]

[0084] Note: Different lowercase letters between data in the same row indicate significant differences (P<0.05).

[0085] The SNP molecular marker described in the present invention is located at the 55577127th base on chromosome 22 of the yak genome LU_Bosgru_v3.0 version; the variation type is G / A, named g55577127G>A, and there are three genotypes. When the 55577127th base on chromosome 22 is G, the genotype is GG or GA; when the 55577127th base on chromosome 22 is A, the genotype is AA; through the association analysis of different genotypes with the content of immunoglobulins IgA, IgG, and IgM, it is found that the immunoglobulin I of yak individuals with the AA and GA genotypes is higher than that of AA and GA genotypes. The immunoglobulin IgA of yak individuals with AA genotype was significantly higher than that of individuals with GG genotype (p<0.05), the immunoglobulin IgG of yak individuals with AA genotype was significantly higher than that of individuals with GG genotype (p<0.05), the immunoglobulin IgA and IgG of yak individuals with AA and GA genotypes did not show significant differences (p>0.05), and the immunoglobulin IgM of yak individuals with AA genotype was significantly higher than that of individuals with GA and GG genotypes (p<0.05), and the immunoglobulin IgM of yak individuals with GA genotype was significantly higher than that of individuals with GG genotype (p<0.05). The present invention can determine the content of immunoglobulin IgA, IgG, and IgM of yak individuals by detecting the bases at the 55577127th nucleotide site on chromosome 22 of yak. ​​The present invention provides a new SNP molecular marker resource for marker-assisted selection of yak immune traits for non-diagnostic purposes.

[0086] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principle of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention.

Claims

1. A SNP molecular marker associated with yak immune traits, characterized in that: The SNP molecular marker is located at the 55577127th base on chromosome 22 of the yak reference genome LU_Bosgru_v3.0 version, and the mutant base is G or A.

2. The SNP molecular marker according to claim 1, characterized in that: The genotype of yaks with a mutation base of G is GG or GA; the genotype of yaks with a mutation base of A is AA; The content of immunoglobulin A in yak individuals with genotypes AA and GA was significantly higher than that in yak individuals with genotype GG; the content of immunoglobulin G in yak individuals with genotype AA was significantly higher than that in yak individuals with genotype GG; the content of immunoglobulin M in yak individuals with genotype AA was significantly higher than that in yak individuals with genotypes GA and GG; the content of immunoglobulin M in yak individuals with genotype GA was significantly higher than that in yak individuals with genotype GG.

3. Use of the SNP molecular marker described in claim 1 or 2 in the preparation of products for detecting yak immunity or products for yak assisted breeding.

4. A primer pair for amplifying the SNP molecular marker according to claim 1 or 2, characterized in that: The sequences of the primer pairs are shown in SEQ ID NOs: 1-2.

5. Use of the primer pair according to claim 4 in preparing a product for detecting yak immunity or a product for yak assisted breeding.

6. A kit for detecting yak immunity, characterized in that: It comprises a reagent for detecting the SNP molecular marker according to claim 1 or 2 or a primer pair according to claim 4.

7. A kit for yak assisted breeding, characterized in that: Contains a reagent for detecting the SNP molecular marker according to claim 1 or 2 or a primer pair according to claim 4.

8. A method for marker-assisted selection of yak immune traits for non-diagnostic purposes, characterized in that: The steps include: (1) Extracting yak genomic DNA; (2) using the yak genomic DNA obtained in step (1) as a template, and performing amplification using the primer pair described in claim 4 to obtain an amplified product; (3) Performing genotyping analysis on the amplified products to obtain yaks with different genotypes; correlating the genotypes of the yaks with immune indicators; the immune indicators are one or more of immunoglobulin A, immunoglobulin G and immunoglobulin M.

9. The method according to claim 8, characterized in that The amplification system described in step (2) contains a total of 25 μL, 2×L-ExpTaq MasterMix (dye plus) 12.5 μL, RNase free water 8.5 μL, upstream primer 1 μL, downstream primer 1 μL, and template 2 μL.

10. The method according to claim 8, characterized in that The amplification program described in step (2) is: 94°C for 1 min, 98°C for 10 s, 58°C for 30 s, 72°C for 1 min, for a total of 35 cycles; and extension at 72°C for 2 min.

Images