Acid-resistant pichia kudriavzevii and application of acid-resistant pichia kudriavzevii in fermentation of corn deep processing byproducts

Abstract

The invention belongs to the field of microorganisms, and particularly relates to acid-resistant pichia kudriavzevii and application of the acid-resistant pichia kudriavzevii in fermentation of corn deep processing byproducts. The invention provides a Pichia kudriavzevii JS1-JM (pichia kudriavzevii) which is preserved in the general microbiological center of the China Committee for Culture Collection of Microorganisms on September 2, 2024, and the biological preservation number of the Pichia kudriavzevii JS1-JM is CGMCC (China General Microbiological Culture Collection Center) No. 31834. The strain can normally grow in a culture medium with the pH value of 3, keeps biological activity at the temperature of 47 DEG C, and has huge potential in the field of biological energy sources. Experimental determination shows that the strain can effectively reduce the content of reducing sugar in corn soaking water, increase the content of crude protein and dry matter in the corn soaking water, remarkably increase the content of crude protein in fermented guniting corn bran and improve the guniting process of corn steep liquor, and a new thought and a new method are provided for comprehensive utilization of corn deep processing byproducts.

Description

Technical Field

[0001] The invention belongs to the field of microorganisms, and specifically relates to an acid-resistant Pichia kudriavzevii strain and application thereof in fermenting corn deep-processing byproducts. Background Art

[0002] The information disclosed in this background technology section is only intended to enhance the understanding of the overall background of the invention, and should not necessarily be regarded as an admission or any form of suggestion that the information constitutes the prior art already known to a person skilled in the art.

[0003] At present, the scale of my country's animal husbandry industry is constantly expanding. Traditional feeds can hardly meet the growing demand for animal husbandry, and the supply of traditional feed raw materials such as corn and soybeans is tight. In order to alleviate the problem of insufficient feed raw material resources, the development of unconventional feed resources has become an important issue that needs to be solved urgently. Unconventional feed resources include various agricultural by-products, forestry by-products, food processing wastes and some cash crop by-products. These resources have rich potential nutritional value and a wide range of sources, but have not been fully utilized. Among them, corn deep processing by-products are one of the better feed raw materials. In the process of deep processing of corn into starch, the corn is first soaked in a sulfurous acid solution. After the soaked corn soaking water is dried and concentrated, one of the by-products rich in soluble protein, reducing sugar and other nutrients, corn steep liquor, is produced; after the corn germ is crushed, screened, separated and dried, another by-product with rich nutritional value, corn husk, is obtained. Studies have found that the dry matter content of corn soaking water is about 13%, and the reducing sugar content can reach about 2 mg / mL; in corn husk, the crude protein content can reach 112 g / kg. These data show that by-products produced during the deep processing of corn, such as corn pulp and corn husk, have high application value because they are rich in soluble protein, reducing sugar and other nutrients. These by-products can not only provide high-quality protein, carbohydrates and other necessary nutrients for livestock and poultry as feed ingredients, but also have the potential to be developed into other industrial raw materials. Therefore, in-depth research and optimal utilization of the nutritional characteristics and components of corn by-products will help reduce production costs, promote efficient recycling of resources, and promote the sustainable development of the feed industry.

[0004] like Fig. 9As shown in the figure, in the traditional corn deep processing process, the utilization of by-products such as corn soaking water and corn husks is to directly concentrate the corn soaking water and spray it on the corn husks, and use the sprayed corn husks as one of the feed raw materials. However, this process will cause pipeline blockage due to the high sugar content and high viscosity of corn soaking water during the concentration process, which limits the nutritional value of sprayed corn husks and the palatability as a feed raw material. Studies have shown that microorganisms can comprehensively utilize various agricultural and food processing by-products. Through microbial fermentation, the toxicity of by-products can be reduced, and various nutrients in by-products can be increased, making them easy to absorb and utilize. Studies have shown that adding probiotics such as lactic acid bacteria, yeast and Bacillus subtilis to feed raw materials can improve the economic benefits of feed, but there are no reports on microorganisms that ferment and utilize corn deep processing by-products. The possible reason is that in the process of corn deep processing, due to the use of acidic solutions such as sulfurous acid, the pH of corn deep processing by-products is low, making it difficult for many probiotics to survive in them, which in turn makes the fermentation process difficult. Therefore, special strains are urgently needed to improve and optimize the comprehensive utilization process of corn deep processing by-products. At present, there are many strains that can be used for feed fermentation production in China, but most strains are sensitive to changes in temperature and pH. These changes may significantly reduce the fermentation effect and prolong the fermentation time, thus limiting the effective development of corn deep processing by-products. Therefore, exploring strains with strong adaptability to environmental conditions will be an important direction to improve the utilization rate of corn by-products. Summary of the invention

[0006] In order to solve the shortcomings of the prior art, the present invention provides a strain that can efficiently ferment and comprehensively utilize corn deep processing by-products, the strain is acid-resistant Pichia kudriavzevii ( Pichia kudriavzevii )JS1-JM. The fermentation of this strain can reduce the content of reducing sugar in corn soaking water, which is beneficial to the subsequent spraying process. At the same time, it can improve the composition of corn slurry so that it can be made into fermented sprayed corn husk that can be used in feed.

[0007] In order to achieve the above technical objectives, the present invention relates to the following technical solutions: In a first aspect of the present invention, there is provided an acid-tolerant Pichia kudriavzevii ( Pichia kudriavzevii )JS1-JM, the strain was deposited in the General Microbiology Center of China Microbiological Culture Collection Administration on September 2, 2024, and its biological deposit number is CGMCC No.31834.

[0008] The second aspect of the present invention provides a fermentation production method of the acid-resistant Pichia kudriavzevii JS1-JM, which comprises: inoculating the acid-resistant Pichia kudriavzevii JS1-JM into a fermentation medium for fermentation culture.

[0009] The third aspect of the present invention provides a microbial agent, which contains the above-mentioned acid-resistant Pichia kudriavzevii JS1-JM or its fermentation product or metabolite.

[0010] The fourth aspect of the present invention provides the use of the acid-resistant Pichia kudriavzevii JS1-JM or microbial agent in fermenting corn deep-processing by-products.

[0011] A fifth aspect of the present invention provides a method for preparing fermented sprayed corn husks, specifically comprising: inoculating the acid-resistant Pichia kudriavzevii JS1-JM into sterilized corn soaking water, culturing for 45-50 h at 25°C-30°C and a rotation speed of 150-200 rpm, collecting the fermentation liquid, drying and concentrating the fermentation liquid to make corn slurry, and spraying the corn slurry onto corn husks to make fermented sprayed corn husks.

[0012] A sixth aspect of the present invention provides a feed comprising the above-mentioned fermented sprayed corn husk.

[0013] The beneficial effects of one or more of the above technical solutions are as follows: The acid-resistant Pichia kudriavzevii JS1-JM of the present invention has multiple tolerances and unique carbon and nitrogen metabolism. The strain can grow normally in a medium with a pH of 3 and preserve biological activity at a temperature of 47°C, and has great potential in the field of bioenergy. Experimental measurements have shown that the strain can effectively reduce the content of reducing sugars in corn soaking water, while increasing the content of crude protein and dry matter in corn soaking water, and significantly increase the crude protein content in fermented sprayed corn husks, improve the corn slurry spraying process, and provide new ideas and methods for the comprehensive utilization of corn deep processing by-products. BRIEF DESCRIPTION OF THE DRAWINGS

[0014] The accompanying drawings in the specification, which constitute a part of the present invention, are used to provide a further understanding of the present invention. The exemplary embodiments of the present invention and their descriptions are used to explain the present invention and do not constitute improper limitations on the present invention.

[0015] Figure 1 The strain community and the strain morphology under the microscope provided in Example 1; Figure 2 The phylogenetic tree of strain JS1-JM and typical strains of all similar genera was constructed using the proximity method provided in Example 1; Figure 3 The growth curves of the strains measured under different pH and temperature conditions provided in Example 2; Figure 4 The biomass of the strain measured under different pH and temperature conditions provided in Example 2; Figure 5 A comparison chart of nutrient contents of corn soaked water before and after fermentation provided in Example 3; Figure 6 A graph showing the changes in crude protein and amino acid content in fermented sprayed corn husks compared to sprayed corn husks provided in Example 4; Figure 7 A graph showing the change in free and hydrolyzed amino acid content in fermented sprayed corn husks compared with sprayed corn husks provided in Example 4; Figure 8 A comparison diagram of the sprayed corn husk and the fermented sprayed corn husk finished product provided in Example 4; Fig. 9 Schematic diagram of the original process and optimized process in the deep processing of corn. DETAILED DESCRIPTION

[0016] It should be noted that the following detailed descriptions are exemplary and are intended to provide further explanation of the present invention. Unless otherwise specified, all technical and scientific terms used in the present invention have the same meanings as those commonly understood by those skilled in the art to which the present invention belongs.

[0017] It should be noted that the terms used herein are only for describing specific embodiments and are not intended to limit the exemplary embodiments of the present invention. As used herein, unless the context clearly indicates otherwise, the singular form is also intended to include the plural form. In addition, it should be understood that when the terms "comprising" and / or "including" are used in this specification, it indicates the presence of features, steps, operations, devices, components and / or combinations thereof. The first typical embodiment of the present invention provides an acid-resistant Pichia kudriavzevii JS1-JM, which was deposited in the General Microbiology Center of China National Microbiological Culture Collection Administration on September 2, 2024, and its biological deposit number is CGMCC No.31834.

[0018] The colony and bacterial characteristics of the acid-resistant Pichia kudriavzevii JS1-JM of the present invention are as follows: the colony is round, the surface and edge are hyphae-like, the color is milky white, opaque, the surface is rough and convex; under observation under a microscope, it is found that the strain is mostly oblong single cells, and the reproduction method is budding reproduction, which is a typical yeast characteristic.

[0019] The acid-resistant Pichia kudriavzevii JS1-JM of the present invention is obtained by screening according to the following principles: (1) The strain is derived from naturally fermented blueberry enzyme. The strain that can grow normally under low pH conditions is selected for morphological identification to complete the initial screening.

[0020] (2) The strains are subjected to a corn soaking water fermentation experiment, and strains that can grow well in corn soaking water are selected and molecular biological identification is performed to complete re-screening.

[0021] In another specific embodiment of the present invention, a fermentation production method of the acid-resistant Pichia kudriavzevii JS1-JM is provided, and the fermentation production method comprises: inoculating the acid-resistant Pichia kudriavzevii JS1-JM into a fermentation medium for fermentation culture.

[0022] Specifically, the fermentation culture method comprises the following conditions: The fermentation medium is a corn soaked water medium. In a specific embodiment of the present invention, the fermentation culture conditions are: culture at 27° C. for 48 h, and a rotation speed of 180 rpm.

[0023] In another specific embodiment of the present invention, a microbial agent is provided, which contains the above-mentioned acid-resistant Pichia kudriavzevii JS1-JM or its fermentation product or metabolite.

[0024] In the present invention, the term "fermentation" is used to refer to a fermentation product. The corresponding fermentation can be a liquid obtained from the process of fermenting and culturing acid-tolerant Pichia kudriavzevii JS1-JM, and therefore, can also be called a fermentation liquid; the liquid can contain bacteria (bacteria), but does not necessarily need to contain bacteria. The liquid preferably contains metabolites produced by the acid-tolerant Pichia kudriavzevii JS1-JM of the present invention.

[0025] And, in an embodiment of the present invention, the fermentation liquid or culture liquid containing the bacteria is separated from the liquid by centrifugation, filtration, sedimentation or other means known in the art, and the liquid remaining after removing the bacterial cells is the "supernatant", and in the present invention, the supernatant contains the extracellular metabolites of acid-resistant Pichia kudriavzevii JS1-JM. In an embodiment of the present invention, the bacterial agent may also include the supernatant.

[0026] And, in an embodiment of the present invention, the fermentation liquid or culture liquid containing the bacteria is centrifuged, filtered, sedimented or other means known in the art to separate the bacterial cells grown in the fermentation liquid or culture liquid from the liquid to obtain the bacteria, and the bacteria can be crushed to obtain the bacterial crushed material, and the crushing method can be ultrasound (such as ice bath ultrasonic cell crushing) or other means known in the art, or, further, the bacterial crushed material is centrifuged to collect the supernatant, and the supernatant is recorded as a cell-free extract, and in the present invention, the bacterial crushed material or the cell-free extract contains the intracellular metabolites of acid-resistant Pichia kudriavzevii JS1-JM. In an embodiment of the present invention, the bacterial agent may also include the bacterial crushed material or the cell-free extract.

[0027] And, in an embodiment of the present invention, in order to facilitate storage and transportation, improve the survival rate of the strain, etc., the bacterial agent can also be a solid (such as a powder), and further a freeze-dried powder. That is, the acid-resistant Pichia kudriavzevii JS1-JM or its fermentation product or its metabolite is further freeze-dried to obtain the freeze-drying technology (including vacuum freeze-drying technology) can be carried out by conventional methods, which will not be repeated here.

[0028] In another specific embodiment of the present invention, the microbial agent further comprises an auxiliary material acceptable to the agent.

[0029] In another specific embodiment of the present invention, the auxiliary material is selected from one or more of a dispersant, a wetting agent, a disintegrant, a binder, a defoamer, an antifreeze agent, a thickener, a filler and a solvent. The present invention has no special restrictions on the source of the auxiliary materials acceptable to the bacterial agent, and generally commercially available products can be used.

[0030] The dispersant is an anionic dispersant and / or a nonionic dispersant, which can be selected from one or more of sodium lignin sulfonate, sodium naphthalene sulfonate formaldehyde condensate, sodium methylene bisnaphthalene sulfonate, formaldehyde condensate sulfate, polycarboxylate, alkylphenol polyoxyethylene phosphate and fatty acid polyoxyethylene ester.

[0031] The wetting agent can be selected from one or more of sodium dodecyl sulfate, sodium dodecylbenzene sulfonate, saponin powder, soapberry powder, tea dregs powder and lakai powder BX.

[0032] The disintegrant may be selected from one or more of bentonite, ammonium sulfate, aluminum chloride, urea, magnesium chloride and glucose.

[0033] The binder may be selected from one or more of starch, diatomaceous earth, cyclodextrin, rosin, carboxymethyl cellulose, carboxyethyl cellulose and carboxymethyl cellulose salt.

[0034] The defoaming agent can be selected from one or more of C8-C20 fatty alcohol compounds, C10-C20 saturated fatty acid compounds, epoxidized soybean oil, ethanol, silicone compounds and organic silicone oil.

[0035] The antifreeze agent may be selected from one or more of sorbitol, ethylene glycol, polyethylene glycol, propylene glycol, glycerol, urea and sodium chloride.

[0036] The thickener may be selected from one or more of gelatin, xanthan gum, polyethylene glycol and polyvinyl alcohol.

[0037] The filler may be selected from one or more of light calcium carbonate, diatomaceous earth, bentonite, attapulgite and white carbon black.

[0038] The solvent may be selected from water or methyl oleate.

[0039] In another specific embodiment of the present invention, there is provided the use of the acid-resistant Pichia kudriavzevii JS1-JM or microbial agent in fermenting corn deep-processing by-products.

[0040] The corn deep processing by-product is corn soaking water.

[0041] The fermented corn deep processing by-products specifically show the following characteristics: reducing the content of reducing sugar in corn soaking water and increasing the content of crude protein and dry matter in corn soaking water.

[0042] Another specific embodiment of the present invention provides a method for preparing fermented sprayed corn husks, specifically: inoculating the acid-resistant Pichia kudriavzevii JS1-JM into sterilized corn soaking water, culturing for 45-50 h at 25° C.-30° C. and a rotation speed of 150-200 rpm, collecting the fermentation liquid, drying and concentrating the fermentation liquid to prepare corn steep liquor, and spraying the corn steep liquor onto corn husks to prepare fermented sprayed corn husks.

[0043] Another specific embodiment of the present invention provides a feed containing the above-mentioned fermented sprayed corn husk.

[0044] The present invention is further explained by the following examples, but is not intended to limit the present invention. These examples are only used to illustrate the present invention and are not intended to limit the scope of the present invention.

[0045] Example 1 Strain Screening and Identification Initial screening and isolation of strains: Naturally fermented blueberry enzyme was used as the bacterial source. 1 mL of the enzyme sample was inoculated into 100 mL of YPD liquid medium with a pH of 3-4, and cultured at 27°C and 180 rpm for 24 h to enrich the bacteria. The formula of the YPD liquid medium used was: 20 g glucose, 20 g peptone, 10 g yeast extract powder, and 1 L purified water. 1 mL of the enriched bacterial solution was diluted in a 9 mL 0.85% saline test tube for gradient dilution, and then 10 -5 , 10 -6 , 10 -7 The gradient culture solution was evenly spread on the YPD plate and cultured at 27℃ for 24 h. The colonies on the plate that were round, with neat edges, smooth and moist surface, and milky white or grayish white were selected for multiple streaking purification until a single strain was obtained.

[0046] The above experiment screened 3 strains from blueberry enzyme, and the three strains were stored in a -70°C refrigerator for subsequent rescreening.

[0047] Strain rescreening: The three strains obtained from the initial screening were activated as follows: taken out from the -70°C refrigerator, slowly thawed at room temperature, and then inoculated into 100 mL of YPD liquid culture medium with a pH of 3-4 at a 1% inoculum, and placed in a constant temperature shaker at 27°C and 180 rpm for 24 h.

[0048] Preparation of corn soaking water culture medium: corn soaking water, a by-product of corn deep processing, was filled into 500 mL Erlenmeyer flasks with 200 mL in each bottle, sterilized and cooled to room temperature. The corn soaking water used was taken from corn deep processing by-product produced in the starch processing process of Xiwang Sugar Co., Ltd. - corn soaking water, with a pH range of 3-4, and the contents of its main components are shown in Table 1.

[0049] Table 1 Main components and contents of corn soaking water

[0050] The three activated strains were inoculated into sterilized corn soaked water with an inoculation volume of 2%. They were placed in a constant temperature shaker at 27°C and 180 rpm for 24 h. After the culture, the strains that could grow well in the corn soaked water were selected and spread on solid YPD (pH=4) plates to observe the morphological characteristics of the colonies, such as morphology, size, color, and surface texture. At the same time, the cell morphology and arrangement of the strains were observed under a microscope to conduct further morphological identification of the strains and further molecular biological identification. According to morphological identification, the colonies of the strains were round, the surface and edges were hyphae-like, the color was milky white, opaque, the surface was rough and convex; under a microscope, it was found that most of the strains were oblong single cells, and the reproduction method was budding, which was a typical yeast characteristic ( Figure 1Then the strain DNA was extracted and its ITS1 sequence was determined, wherein the ITS1 sequence was: tgtactacactgcgtgagcggaacgaaaacaacaacacctaaaatgtggaatatagcatatagtcgacaagagaaatctacgaaaaacaaacaaaactttcaacaacggatctcttggttctcgcatcgatgaagagcgcagcgaaatgcgatacctagtgtgaattgcagccatcgtgaatcatcgagttcttgaacgcacattgcgcccct cggcattccggggggcatgcctgtttgagcgtcgtttccatcttgcgcgtgcgcagagttgggggagcggagcggacgacgtgtaaagagcgtcggagctgcgactcgcctgaaagggagcgaagctggccgagcgaactagactttttttcagggacgcttggcggccgagagcgagtgttgcgagacaacaaaaagctcgacctcaaatcaggtaggaatacccgctgaacttaagcatatca (SEQ ID NO.1). The obtained PCR sequence was submitted to NCBI for BLAST comparison to obtain species sequences with higher homology. The neighbor-joining method in MEGA 11 was used to establish a phylogenetic tree to clarify the molecular biological classification of the strain. According to the phylogenetic tree, the strain has a similarity of 99% with the model bacteria LC671435.1 Pichia kudriavzevii and 100% with the model bacteria MZ089543.1:11-468 Pichiakudriavzevii, confirming that the strain is Pichia kudriavzevii ( Figure 2 ).

[0051] The applicant named the above-mentioned Pichia kudriavzevii JS1-JM, and deposited it in the General Microbiology Center of China Microorganism Culture Collection Administration on September 2, 2024, and its biological deposit number is CGMCC No.31834.

[0052] Example 2 strain adaptability This example uses different pH and temperature treatments to test the strain's tolerance to temperature and pH, and to measure the bacterial biomass, as follows: (1) Determination of strain growth curve under different pH conditions: 27 bottles of standard YPD liquid culture medium were prepared according to the YPD culture medium formula, each with 200 mL. The pH of the YPD culture medium was adjusted to 3, 4, 5, 6, 7, 8, 9, 10, and 11 with 1M sulfuric acid, and three replicates were set for each pH gradient. The pH-adjusted YPD culture medium was sterilized and cooled to room temperature. It was inoculated with 2% of the inoculation amount of Pichia kudriavzevii JS1-JM and placed in a constant temperature shaker at 27°C and 180 rpm for 48 h. Samples were taken every 4 h during the culture process. The bacterial growth was determined by measuring the bacterial concentration (OD600 of the bacterial solution, OD value at a wavelength of 600 nm), and the strain growth curve was plotted. The results are shown in the figure. Figure 3 As shown in (A), the strain still has a good growth condition at a pH of 3. It can be seen that the strain has a strong tolerance to acidic environment and can be used for corn soaking water that becomes acidic after sulfuric acid treatment.

[0053] (2) Determination of strain growth curve under different temperature conditions. Referring to the determination of strain growth curve under different pH conditions, 18 bottles of YPD liquid culture medium with pH 7 were prepared, sterilized and cooled to room temperature, inoculated with 2% inoculum of Pichia kudriavzevii JS1-JM, placed in a constant temperature shaker, and cultured at 180 rpm at 6 different temperature gradients of 22°C, 27°C, 32°C, 37°C, 42°C and 47°C. Three replicates were used for each group. Samples were taken every 4 h during the culture process. The bacterial growth was determined by measuring the bacterial concentration (OD600 of the bacterial solution, OD value at a wavelength of 600 nm), and the strain growth curve was drawn. The results are shown in the figure. Figure 3 As shown in (B), the strain grows well under conditions of 22°C to 42°C and still maintains biological activity at 47°C. Therefore, it can be seen that the strain is not sensitive to temperature changes and can be used in areas with large changes in environmental temperature, such as industrial production.

[0054] (3) Determination of bacterial biomass: The bacterial biomass was determined by using the bacterial culture fluids treated with the above methods after 48 h of culture. The specific method was as follows: the bacterial suspension was centrifuged at 8000 rpm for 10 min, the supernatant was discarded, and the cells were washed with sterile water. The cells were collected after repeated centrifugation and washing three times, and then dried at 80°C. The cell weight (dry weight) was determined, and this mass was the biomass of Pichia kudriavzevii JS1-JM. The results are shown in Table 1. Figure 4As shown in the figure, the strain's biomass reached the highest value under the conditions of 27°C and pH=7, indicating that its optimal growth conditions are 27°C and pH=7. In addition, even under pH=3, the biomass was still close to 5 g / L, and at pH=11, the biomass reached 7 g / L, indicating that the strain has strong acid-base tolerance. At the same time, when the temperature reached 47°C, the bacteria still survived, further proving that it also has a certain tolerance to high temperatures.

[0055] Example 3 Corn soaking water fermentation effect The above-screened Pichia kudriavzevii JS1-JM was inoculated into the sterilized corn soaking water at a 2% inoculation rate, and placed in a constant temperature incubator at 27°C and 180 rpm for 48 h. After the corn soaking water was fermented for 48 h, the fermentation liquid was collected, and the contents of dry matter, crude protein and reducing sugar in the corn soaking water (original liquid) and the fermentation liquid were determined respectively, and the effect of yeast fermentation on the content of various substances in the corn soaking water was analyzed. The specific test method is as follows: (1) Determination of dry matter content: Take 5-10 g of fermentation broth sample, weigh the initial mass (wet weight) of the sample using an analytical balance, and place the sample in an oven at 105°C to dry to constant weight. Take out the sample, cool it to room temperature, and weigh its mass after drying (dry weight) using a balance. Calculate the dry matter content in the fermentation broth according to the following formula:

[0056] Draw a bar graph of the calculated dry matter content. The result is as follows Figure 5 As shown in the figure (A), compared with the original solution, the dry matter content in the fermentation liquid did not increase significantly, increasing by 0.91%. It is preliminarily speculated that during the fermentation process, yeast transformed the substances in the corn soaking water, which resulted in no significant increase in the dry matter content.

[0057] (2) Determination of crude protein content: The commonly used method for determining crude protein content is the Kjeldahl method, which indirectly estimates the crude protein content by measuring the nitrogen content in the sample. The following is the specific experimental method: Take 10 mL of fermentation broth, add concentrated sulfuric acid and a mixture of K2SO4 and CuSO4 to the fermentation broth, decompose the protein in the sample into ammonia, and fix it in the form of ammonium salt. Cool the digested liquid and add excess NaOH solution to convert ammonium sulfate into ammonia. Heat the sample, distill out ammonia, and absorb it with boric acid solution. After distillation, the ammonia-containing absorption liquid is titrated with standard hydrochloric acid solution to determine the amount of ammonia absorbed. According to the volume of standard hydrochloric acid solution consumed in the titration, calculate the nitrogen content in the sample: Calculate the amount of nitrogen in the sample:

[0058] in: V1 is the volume consumed by the standard acid titration (mL); V2 is the volume of standard acid consumed in the blank test titration (mL); N is the concentration of the standard acid (mol / L); 14 is the molar mass of nitrogen (g / mol).

[0059] The conversion factor used to calculate crude protein content based on nitrogen content is usually 6.25. The formula is as follows: Crude protein content (g) = nitrogen content (g) × 6.25 The crude protein content in the fermentation broth and the original solution was calculated by the above method, and a bar graph was drawn. The results are as follows: Figure 5 As shown in (B), it can be seen from the figure that compared with the original solution, the crude protein content in the fermentation broth increased significantly, increasing by 12.63%. This is because the protein content in yeast is relatively high, which in turn leads to a significant increase in the crude protein content in the fermentation broth.

[0060] (3) Determination of reducing sugar content: The reducing sugar content in the fermentation broth is usually determined using the DNS method (3,5-dinitrosalicylic acid method). The DNS method is a classic colorimetric method that indirectly reflects the reducing sugar content by measuring the color change after the reaction between sugar and the DNS reagent. The specific operation method is as follows: Take 2 mL of fermentation broth sample, add 2 mL of DNS reagent, and mix well. Place the mixture in a boiling water bath for 5-10 minutes to react the reducing sugar with the DNS reagent to generate a reddish-brown substance (3-amino-5-nitrosalicylic acid). Take out the reacted solution, cool it to room temperature with running water, and measure the absorbance (OD value) at 540 nm with a spectrophotometer. The color depth of the reaction is proportional to the reducing sugar content. Use standard reducing sugar to prepare a series of standard solutions of known concentrations, repeat the above steps, and draw a standard curve (absorbance vs reducing sugar concentration). Substitute the absorbance of the sample into the standard curve to calculate the reducing sugar content in the sample.

[0061] The formula is as follows:

[0062] The reducing sugar content in the fermentation broth and the original solution was calculated by the above method, and a bar graph was drawn. The results are as follows: Figure 5 As shown in (C), it can be seen from the figure that compared with the original solution, the reducing sugar content in the fermentation broth decreased significantly, with a decrease of 54.4%.

[0063] Combined with the previous experimental results, the following conclusions can be drawn: yeast uses reducing sugars in corn soaking water to synthesize bacterial protein in the fermentation liquid, resulting in a decrease in reducing sugar content and an increase in crude protein content. The reduction of reducing sugars in corn soaking water helps to reduce the viscosity of the liquid during corn slurry concentration, which is convenient for the subsequent spraying process. The increase in crude protein content significantly improves the nutritional components of corn slurry and further enhances the nutritional value of sprayed corn husks, making it more suitable for use as a feed raw material.

[0064] Example 4: Improvement Effect of Spraying Corn Husk The stock solution and fermentation liquid obtained in Example 3 are placed in a constant temperature oven controlled at 50-70°C for drying and concentration, respectively, until the solid content of the liquid reaches 40%-60%, forming a viscous slurry state. At this time, the water content of the liquid is about 40%-50%, and the resulting viscous liquid is called corn slurry. After drying and concentration, corn slurry is made, and the corn slurry is sprayed onto corn husks to make sprayed corn husks. After the sprayed corn husks are dried, the changes in crude protein content and amino acid content contained therein are analyzed. The specific implementation method is as follows: The corn husks, sprayed corn husks and fermented sprayed corn husks were placed in a constant temperature oven at 80-90°C and dried until they were free of moisture. The dried corn husks were crushed, and the crude protein content in the corn husks was calculated by the Kjeldahl method. The amino acid content in the samples was then detected by high performance liquid chromatography.

[0065] Detection method of hydrolyzed amino acids: accurately weigh 1 g of the sample, carefully add 6 mL of 1:1 analytical pure hydrochloric acid (about 6 mol / L), blow nitrogen gas into the instrument for 15 minutes and seal the tube. Place the sealed sample in an oven at 110°C for hydrolysis for 24 h, take it out and cool it down. Then make the sample volume up to 25 mL. Accurately pipette 2 mL of the sample after volume adjustment and place it on a rotary evaporator for deacidification. Dehydrate at 60°C until dry. Accurately add 2.0 mL of 0.02 mol / L HCl and mix well on a vortex, pass through a 0.22 µm water filter, and put it on the machine. The hydrolyzed amino acid content is calculated according to the following formula:

[0066] When testing free amino acids, it is not necessary to hydrolyze the protein. Therefore, the sample only needs to be treated with dilute hydrochloric acid to extract the free amino acids, centrifuged, and the supernatant needs to be filtered before being directly tested on the machine.

[0067] The chromatograph test results were simply processed and the crude protein and amino acid content changes were plotted. The results are as follows: Figure 6As shown in the figure, compared with the sprayed corn husk produced by the traditional process, the crude protein content in the fermented sprayed corn husk was significantly increased, from 271.25 ± 13.75 g / kg to 333.9 ± 39.37 g / kg, with an increase of 23.1%; based on the chromatographic test results, the free and hydrolyzed amino acid contents of the fermented sprayed corn husk were subtracted from those of the sprayed corn husk to obtain the free and hydrolyzed amino acid content change diagram, and the results are shown in the figure. Figure 7 As shown in the figure, compared with the sprayed corn husks of the traditional process, the free amino acid content in the fermented sprayed corn husks decreased, while the hydrolyzed amino acid content increased. The hydrolyzed amino acid content increased from 196.58 mg / g to 214.18 mg / g, an increase of 8.95%. The above results show that during the fermentation process, Pichia kudriavzevii synthesized bacterial protein using reducing sugars, free amino acids and other components in the corn soaking water, which led to a significant increase in crude protein content, a decrease in free amino acid content and an increase in hydrolyzed amino acid content.

[0068] like Figure 7 As shown in the figure, by analyzing the changes in the content of 17 kinds of amino acids in sprayed corn husks and fermented sprayed corn husks, it can be concluded that in fermented sprayed corn husks, the contents of 7 essential amino acids (lysine, phenylalanine, methionine, threonine, isoleucine, leucine, and valine) are significantly increased, and the change in glutamic acid content is the most obvious. In fermented feed, glutamic acid can improve the flavor and palatability of feed, increase the feed intake of animals; help improve the protein utilization efficiency in animals, promote growth and development; and participate in the tricarboxylic acid cycle (TCA cycle) in animals, help improve energy metabolism efficiency, and thus enhance the health and immunity of animals. The increase in the content of 7 essential amino acids and glutamic acid and other amino acids in fermented sprayed corn husks further illustrates that the fermentation process improves the nutritional structure of sprayed corn husks, and solves the problems of poor feed palatability, low nutritional value, and low animal intake caused by sprayed corn husks as feed raw materials.

[0069] In summary, the present invention provides an acid-resistant Pichia kudriavzevii JS1-JM. Through growth characteristics and tolerance analysis, as well as comprehensive evaluation of its actual fermentation effect, the feasibility of the strain in the comprehensive utilization of corn deep processing by-products is determined. This method provides a new idea for improving the comprehensive utilization process of corn deep processing by-products, and at the same time improves the utilization value of the by-products.

[0070] The above embodiments are only preferred implementation modes of the present invention and should not be used to limit the protection scope of the present invention. Any changes or modifications that are made to the main design concept and spirit of the present invention and have no substantive significance, and the technical problems they solve are still consistent with the present invention, should be included in the protection scope of the present invention.

Claims

1. A strain of acid-tolerant Pichia kudriavzevii ( Pichia kudriavzevii )JS1-JM, the strain was deposited in the General Microbiology Center of China Microbiological Culture Collection Administration on September 2, 2024, and its biological deposit number is CGMCC No.31834.

2. The fermentation production method of acid-resistant Pichia kudriavzevii JS1-JM according to claim 1, characterized in that: The fermentation production method comprises: inoculating the acid-resistant Pichia kudriavzevii JS1-JM into a fermentation medium for fermentation culture.

3. The fermentation production method according to claim 2, characterized in that: The fermentation medium is corn soaked water medium.

4. The fermentation production method according to claim 2, characterized in that: The specific fermentation culture conditions are: culture at 25°C~30°C for 45-50 h, rotation speed: 150-200 rpm.

5. The fermentation production method according to claim 2, characterized in that: The specific fermentation culture conditions are: culture at 27°C for 48 hours, rotation speed: 180 rpm.

6. A microbial agent, characterized in that: The microbial agent contains the acid-resistant Pichia kudriavzevii JS1-JM according to claim 1 or its fermentation product or metabolite.

7. The microbial agent according to claim 5, characterized in that The microbial agent also includes auxiliary materials acceptable to the agent.

8. Use of the acid-resistant Pichia kudriavzevii JS1-JM described in claim 1 or the microbial agent described in any one of claims 6-7 in fermenting corn deep processing by-products; further, the corn deep processing by-products are corn soaking water; further, the fermented corn deep processing by-products are specifically manifested as: reducing the content of reducing sugar in the corn soaking water, and increasing the content of crude protein and dry matter in the corn soaking water.

9. A method for preparing fermented sprayed corn husks, characterized in that: The acid-resistant Pichia kudriavzevii described in claim 1 is inoculated into sterilized corn soaking water, cultured for 45-50 hours at 25°C-30°C and a rotation speed of 150-200 rpm, and the fermentation liquid is collected, dried and concentrated to make corn slurry, and the corn slurry is sprayed onto corn husks to make fermented sprayed corn husks.

10. A feed, characterized in that The invention comprises the fermented sprayed corn husk as claimed in claim 9.

Images