Primer probe composition, kit and micro-fluidic chip for detecting different types of botulinum

Abstract

The invention relates to a primer probe composition, a kit and a micro-fluidic chip for detecting different types of botulinum. The primer probe composition comprises an upstream primer, a downstream primer and a probe for detecting botulinum type A, an upstream primer, a downstream primer and a probe for detecting botulinum type B, an upstream primer, a downstream primer and a probe for detecting botulinum type E and / or an upstream primer, a downstream primer and a probe for detecting botulinum type F. Furthermore, the kit also comprises upstream and downstream primers and a probe for amplification control. The invention also provides micro-fluidic chips respectively coated with A-type, B-type, E-type and F-type clostridium botulinum for detecting the A-type, B-type, E-type and F-type clostridium botulinum. The primer probe composition provided by the invention can be used for detecting single type of clostridium botulinum, can also be used for detecting four types of clostridium botulinum in a combined manner, and can be flexibly combined. The micro-fluidic chip for simultaneously detecting four botulinum is provided, time is saved, detection cost is low, rapid screening is achieved, detection specificity is high, sensitivity is high, and missing detection can be effectively avoided.

Description

Technical Field

[0001] The invention relates to a primer-probe combination, a kit and a microfluidic chip for detecting different types of botulinum toxins, and belongs to the technical field of biological detection. Background Art

[0002] Clostridium botulinum belongs to the class of Clostridium in the phylum Firmicutes of the bacterial kingdom and is an anaerobic and deadly pathogen. Clostridium botulinum is widely distributed in nature and can often be detected in soil and occasionally in animal feces. It secretes botulinum toxin during reproduction. Botulinum toxin is a neurotoxin that can penetrate the mucous membranes of various parts of the body. After being absorbed by the gastrointestinal tract, botulinum toxin spreads through the lymph and blood, acting on the cranial nerve nuclei, peripheral neuromuscular junctions and autonomic nerve endings, blocking the release of acetylcholine, affecting the transmission of nerve impulses, and causing muscle relaxation paralysis. It is one of the most toxic bacteria. The most suitable growth temperature for botulinum toxin is 25-37℃, and the most suitable temperature for producing toxins is 20-35℃. It can survive in an oxygen-free and low-temperature environment, but it cannot continue to reproduce and produce toxins when the temperature is below 15℃ or above 55℃. However, the botulinum toxin it produces has higher heat resistance and acid resistance. According to the different antigenicity of the toxins produced, botulinum toxin is divided into 8 types: A, B, Ca, Cb, D, E, F, and G. Types A, B, E, and F can cause human diseases, among which types A and B are the most common. The human gastrointestinal tract is a good oxygen-deficient environment, suitable for botulinum toxin to live.

[0003] Clostridium botulinum belongs to anaerobic bacteria, strictly anaerobic. It can decompose glucose, maltose and fructose in the gastrointestinal tract, produce acid and gas, and digest and decompose meat residues, making them black and corrupt and smelly. In an anaerobic environment, this bacterium can secrete strong botulinum toxin, which can cause special neurotoxic symptoms, and the disability rate and mortality rate are extremely high. Clostridium botulinum spores are very resistant. Dry heat of 180 degrees Celsius for 5-15 minutes, wet heat of 100 degrees Celsius for 5 hours, and high-pressure steam of 121 degrees Celsius for 30 minutes can kill the spores. Botulinum toxin is particularly resistant to acid. Gastric acid solution cannot destroy it within 24 hours, so it can be absorbed by the gastrointestinal tract and damage physical and mental health. Therefore, toxin-producing Clostridium botulinum toxin is more harmful, and timely discovery or detection is of great significance to human safety and physical health.

[0004] Generally, the discovery of botulism in processed food or processing equipment indicates that the hygiene conditions are very poor. Existing methods for detecting botulism include traditional pathogen isolation, ELISA, PCR, etc. Since botulism poisoning cases often require rapid diagnosis and testing, traditional botulism isolation and toxin identification require anaerobic culture and animal testing, of which serum toxin detection takes 5 days and fecal bacterial culture takes 14 days. Anaerobic operation technology requires a special anaerobic operation platform, not a general exhaust cabinet laboratory. When culturing bacteria, a specific anaerobic environment is required to prevent the air from entering the culture dish, so that the culture dish maintains an oxygen-free environment. Therefore, the detection process is not only cumbersome and time-consuming, but when botulism poisoning occurs, if there is no real-time specific medical treatment, the mortality rate is quite high. In terms of epidemic prevention timeliness, rapid identification, and real-time medical care, traditional types of culture and identification methods cannot meet the needs.

[0005] In the prior art, a single fluorescent quantitative PCR is commonly used that can only detect one antigen type, namely botulinum toxin type A, and cannot screen and detect four types at the same time. Although the existing botulinum toxin that can detect four types can achieve simultaneous detection, its detection sensitivity is low, which can easily lead to false positives and missed detections, and it cannot determine whether it has been contaminated, which may cause irreparable losses. Summary of the invention

[0006] 1. Technical issues to be resolved

[0007] In order to solve the above problems in the prior art, the present invention provides a primer-probe combination, a kit and a microfluidic chip for detecting different types of Clostridium botulinum toxin.

[0008] (II) Technical solution

[0009] In order to achieve the above object, the main technical solutions adopted by the present invention include:

[0010] A primer-probe composition for detecting different types of botulinum toxin, comprising an upstream and downstream primer and probe for detecting botulinum toxin type A, an upstream and downstream primer and probe for detecting botulinum toxin type B, an upstream and downstream primer and probe for detecting botulinum toxin type E, and / or an upstream and downstream primer and probe for detecting botulinum toxin type F; wherein the upstream primer sequence of botulinum toxin type A is shown in SEQ ID No. 1, the downstream primer sequence is shown in SEQ ID No. 2, and the probe sequence is shown in SEQ ID No. 3;

[0011] The upstream primer sequence of the botulinum toxin type B is shown in SEQ ID No.4, the downstream primer sequence is shown in SEQ ID No.5, and the probe sequence is shown in SEQ ID No.6;

[0012] The upstream primer sequence of the Clostridium botulinum type E is shown in SEQ ID No.7, the downstream primer sequence is shown in SEQ ID No.8, and the probe sequence is shown in SEQ ID No.9;

[0013] The upstream primer sequence of the Clostridium botulinum F type is shown in SEQ ID No.10, the downstream primer sequence is shown in SEQ ID No.11, and the probe sequence is shown in SEQ ID No.12.

[0014] Furthermore, preferably, the 5' end of each probe is labeled with a fluorescent group, and the 3' end is labeled with a quenching group.

[0015] When used for multiplex fluorescence quantitative PCR to simultaneously detect four different types of botulinum toxin, the 5' end and 3' end of each probe can be labeled with FAM-BHQ1, Texred-BHQ2, CY5-BHQ3 and JOE-TAMRA, respectively.

[0016] A kit for detecting different types of botulinum toxin, comprising the primer-probe combination as described above, and further comprising a positive control for botulinum toxin type A, which is a plasmid containing a nucleotide sequence as shown in SEQ ID No. 16, a positive control for botulinum toxin type B, which is a plasmid containing a nucleotide sequence as shown in SEQ ID No. 17, a positive control for botulinum toxin type E, which is a plasmid containing a nucleotide sequence as shown in SEQ ID No. 18, and a positive control for botulinum toxin type F, which is a plasmid containing a nucleotide sequence as shown in SEQ ID No. 19.

[0017] The kit as described above also includes upstream and downstream primers and probes for amplification control, and genomic DNA of the positive template Bacillus atrophaeus of the amplification control, the upstream primer sequence of the amplification control is shown in SEQ ID No.13, the downstream primer sequence is shown in SEQ ID No.14, and the probe sequence is shown in SEQ ID No.15. The 5' end of all probes is labeled with a fluorescent group (FAM group or ROX group), and the 3' end is labeled with NFQ-MGB.

[0018] The kit as described above further comprises Premix EX TaqTM×2.

[0019] A microfluidic chip for simultaneously detecting different types of botulinum toxin, comprising: each chamber hole on the detection sheet body of the microfluidic chip is coated with an upstream and downstream primer and probe for detecting botulinum toxin type A, an upstream and downstream primer and probe for detecting botulinum toxin type B, an upstream and downstream primer and probe for detecting botulinum toxin type E, and an upstream and downstream primer and probe for detecting botulinum toxin type F; wherein the upstream primer sequence of botulinum toxin type A is shown in SEQ ID No. 1, the downstream primer sequence is shown in SEQ ID No. 2, and the probe sequence is shown in SEQ ID No. 3;

[0020] The upstream primer sequence of the botulinum toxin type B is shown in SEQ ID No.4, the downstream primer sequence is shown in SEQ ID No.5, and the probe sequence is shown in SEQ ID No.6;

[0021] The upstream primer sequence of the Clostridium botulinum type E is shown in SEQ ID No.7, the downstream primer sequence is shown in SEQ ID No.8, and the probe sequence is shown in SEQ ID No.9;

[0022] The upstream primer sequence of the Clostridium botulinum F type is shown in SEQ ID No. 10, the downstream primer sequence is shown in SEQ ID No. 11, and the probe sequence is shown in SEQ ID No. 12;

[0023] The 5' ends of all the probes are labeled with a FAM group or a ROX group, and the 3' ends are labeled with NFQ-MGB.

[0024] The microfluidic chip as described above preferably further comprises upstream and downstream primers, a probe and chamber wells for amplification control positive amplification products, as well as chamber wells with nuclease-free water as negative control and blank control wells; the upstream primer sequence of the amplification control is shown in SEQ ID No.13, the downstream primer sequence is shown in SEQ ID No.14, and the probe sequence is shown in SEQ ID No.15; the positive template of the amplification control is the genomic DNA of Bacillus atrophaeus.

[0025] A method for simultaneously detecting different types of Clostridium botulinum using a microfluidic chip, which uses the microfluidic chip prepared above for detection, and comprises the following steps:

[0026] S1. Sample processing and sample template DNA extraction;

[0027] S2, use Premix EX TaqTM×2, sample template DNA and sterile water to prepare PCR amplification system;

[0028] S3, injecting the amplification system into the sample loading hole in the microfluidic chip, and after the liquid fills the microfluidic chip, sealing the sample loading hole with a sealant;

[0029] S4, placing the microfluidic chip into a nucleic acid amplification analyzer, setting amplification reaction parameters for amplification;

[0030] S5. After amplification is completed, the software of the nucleic acid amplification analyzer performs data processing and compares it with the blank control well. If the test well has an obvious amplification curve on the nucleic acid amplification analyzer, it is judged as positive; if there is no obvious amplification curve, it is judged as negative.

[0031] In the method described above, preferably, the amplification reaction parameters are set as follows: pre-denaturation stage at 95°C, 5 min; amplification stage at 95°C, 10 sec; 60°C, 30 sec; 45 cycles.

[0032] In the method as described above, preferably, the template DNA is extracted using a genomic DNA extraction kit.

[0033] (III) Beneficial effects

[0034] The beneficial effects of the present invention are:

[0035] The present invention provides a primer-probe combination for simultaneously detecting different types of botulinum toxin, which can be used to detect botulinum toxin type A, botulinum toxin type B, botulinum toxin type E and botulinum toxin type F. The primer-probe combination can be used for the detection of a single type of botulinum toxin, and can also be used for screening of simultaneous detection of several botulinum toxins. When used for simultaneous detection of these four pathogens, it has been verified that the detection sensitivity is high and the specificity is strong.

[0036] The present invention also provides a kit for simultaneously detecting different types of botulinum toxin, and at the same time establishes a relatively efficient and sensitive method for simultaneously screening these four types of botulinum toxin. The method can effectively improve the sensitivity of the detection and avoid the occurrence of false negative results. The detection kit provided is easy to use, simple to operate, and has a high degree of automation. It effectively replaces the traditional strain separation and culture to obtain the detection results. The reagents used in the kit are small, and the process of repeated operations is reduced, which also reduces the pollution in the operation process, avoids repeated operations and consumes too much labor, saves time, and can effectively save the detection cost, and realizes rapid screening. The detection effect of the kit used is good, the specificity is strong, and the sensitivity is high, which can effectively avoid missed detection.

[0037] The present invention also provides a microfluidic chip for simultaneously detecting different types of botulinum toxin. After the mixed reaction solution is prepared, only one sample needs to be added to achieve simultaneous detection of four types of botulinum toxin. This can effectively avoid the possibility of sample contamination during subpackaging and testing, greatly reduce the number of operating steps, and is simple to operate, fast to detect, and low in cost. BRIEF DESCRIPTION OF THE DRAWINGS

[0038] Figure 1 This is the sensitivity amplification curve of real-time fluorescence quantitative PCR for detecting Clostridium botulinum type A;

[0039] Figure 2 This is the sensitivity amplification curve of real-time fluorescence quantitative PCR for detecting Clostridium botulinum type B;

[0040] Figure 3 This is the sensitivity amplification curve of real-time fluorescence quantitative PCR for detecting Clostridium botulinum type E;

[0041] Figure 4 This is the sensitivity amplification curve of real-time fluorescence quantitative PCR for detecting Clostridium botulinum type F. DETAILED DESCRIPTION

[0042] In order to better explain the present invention and facilitate understanding, the present invention is described in detail below in conjunction with the accompanying drawings through specific embodiments. The embodiments of the present invention are not limited thereto, and the complementary sequence of the nucleotide sequence provided by the present invention can also implement the present invention. Unless otherwise specified, the reagents used are conventional reagents and can be commercially obtained from regular channels. Therefore, all equivalent replacements in the art made in accordance with the present disclosure belong to the protection scope of the present invention. Unless otherwise specified, the plasmid DNA and Bacillus atrophaeus strain DNA used in the following examples are provided and preserved by the Henan Industrial Microbial Strain Engineering Technology Research Center.

[0043] Example 1 Design of primers and probes

[0044] First, the specific target genes of Clostridium botulinum type A, Clostridium botulinum type B, Clostridium botulinum type E and Clostridium botulinum type F were screened respectively. According to the detection purpose, multiple pathogenic gene sequences of each Clostridium botulinum were downloaded from GenBank, compared and analyzed, and conserved sequences were selected. Then, amplification primers and hybridization probes suitable for fluorescent quantitative PCR reaction system were designed within the conserved sequences.

[0045] Since the present invention utilizes a multiplex fluorescence quantitative PCR amplification system in principle, firstly, the selection of primers and probes is critical. Secondly, the probes designed by the software must be screened, and the probe signals of the four genes cannot interfere with each other. This requires that when designing the probes, it is considered that the amplification products of the four pairs of primers cannot interfere with each other with the four probes.

[0046] Multiple primer sequences and hybridization probe sequences specific to four types of botulinum toxin, namely, botulinum toxin type A, botulinum toxin type B, botulinum toxin type E, and botulinum toxin type F, were designed respectively, and the sequence homology and adaptability analysis and evaluation of the proposed probe and primer combination were performed, and verified through a large number of detection tests, and finally the four types of botulinum toxin-specific primer and probe combinations suitable for multiple fluorescent quantitative reaction systems were selected. The design of the probe in the present invention is particularly critical. The probe can be selected between the fragments amplified by the primer. First, the probe itself cannot form a primer dimer, otherwise it will lead to a false negative test result. Secondly, when used for multiple botulinum toxin detection, there should be no cross-reaction between the fragments and probes amplified by the multiple detection, otherwise it will lead to a false positive result.

[0047] For each amplification primer designed for Clostridium botulinum, a single pathogen amplification test must first be performed. After confirming that there is no non-specific amplification in the amplification test of a single pathogen, multiple pathogen amplifications are then performed. When designing primers, cross reactions need to be avoided as much as possible, and the amplification conditions must be as consistent as possible. Finally, cross reactions are eliminated through hybridization reactions. In order to ensure the accuracy of the detection process, the Bacillus atrophaeus gene is also selected to design primers and probes according to the same requirements as above. Based on the above design, bioinformatics analysis, the inventor's experience design, and a large number of experimental detection test screenings, the following sequences were determined: The results are shown in Table 1.

[0048] Table 1 Primers and probes for various types of Clostridium botulinum

[0049]

[0050] Note: The primer and probe names containing F represent upstream primers, those containing R represent downstream primers, those containing P represent probes, and Y represents C or T.

[0051] The Mascarpone boNT / A gene cluster gene of Clostridium botulinum type A screened by the present invention has a sequence number of DQ310546.1 in GenBank, and the sequence amplified by the designed Clostridium botulinum type A primers is finally determined to be shown as SEQ ID No.16.

[0052] SEQ ID No. 16: ATTAGAGGTTATATGTATCTTAAAGGCCTAGAGG TAGCGTAGTGACTACAAACATTTATTTAAATTCAACTTTGTATATGGG GACAAAATTTA.

[0053] The neurotoxin B gene of Clostridium botulinum type B screened by the present invention has a sequence number of EF033127.1 in GenBank. It was finally determined that the fragment size amplified by the designed Clostridium botulinum type B primers was 117 bp, and the amplified sequence was shown as SEQ ID No.17.

[0054] SEQ ID No. 17: TTGCATCAAGGGAAGGCTTCGGGGGTATAATGCAA ATGAAGTTTTGCCCAGAATATGTAACGGTATTTAATAATGTTCAAGAA AACAAAGGCGCAAGTATATTTAATAGACGTGGAT.

[0055] The neurotoxin E gene of Clostridium botulinum type E screened by the present invention has a sequence number of KF719446.1 in GenBank. It was finally determined that the fragment size amplified by the designed Clostridium botulinum type E primers was 123 bp, and the amplified sequence was shown as SEQ ID No.18.

[0056] SEQ ID No. 18: GAAAATAATGTCAATCTCACCTCTTCAATTGATAC AGCATTATTAGAACAACCTAAAATATATACATTTTTTTCATCAGAATT TATTAATAATGTCAA TAAACCTGTGCAAGCAGCATTATTT.

[0057] The neurotoxin type F light chain gene of Clostridium botulinum type F screened by the present invention has a sequence number of MF407279 in GenBank. It was finally determined that the fragment size amplified by the designed Clostridium botulinum type F primers was 152 bp, and the amplified sequence was shown in SEQ ID No.19.

[0058] SEQ ID No. 19: CCGGCTTCATTAGAGAACGGAAGCAGTGCTTATT ATGATCCTAATTATTTAACCACTGATGCTGAAAAAGATAGATATTTAA AAACAACGATAAAATTATTTAAGAGAATTAATAGTAATCCTGCAGGGGAAGTTTTGTTACAAGAAATATC.

[0059] The primers and probes in the above table were sent to Beijing BGI for synthesis, and the 5′ end of the probe was labeled with a fluorescent group FAM or ROX, and the 3′ end was labeled with NFQ-MGB, and the plasmid was synthesized according to the target gene fragment amplified as above.

[0060] The present invention also labels the 3' end of the probe with MGB (dihydrocyclopyrrole tripeptide), which can non-covalently bind to the minor groove of double-stranded DNA to stabilize the DNA structure. The MGB molecule is coupled to the probe through a CN bond, which can make the oligonucleotide probe bind to the complementary DNA and RNA target sequences more stably; it should be noted that when used for multiplex fluorescence quantitative PCR to simultaneously detect 4 different types of botulinum toxin, the fluorescent groups at the 5' end of each of the above probes are fluorescent groups detected by different channels, such as the 5' end and 3' end of each probe can be labeled with FAM-BHQ1, Texred-BHQ2, CY5-BHQ3 and JOE-TAMRA, respectively.

[0061] Example 2 Detection of the sensitivity of the real-time fluorescence PCR method using primer pairs and probes for each botulinum toxin

[0062] The plasmid DNA of the pathogens of Clostridium botulinum type A, Clostridium botulinum type B, Clostridium botulinum type E and Clostridium botulinum type F synthesized in Example 1 was measured and calculated to determine the copy number, and the bacterial solution was diluted to an initial bacterial solution concentration of 3×10 9 After diluting by 10 times, the dilution gradient of each type of botulinum toxin is 10 -6 -10 -9 Plasmid DNA template; using the primer pair and corresponding probe for single detection of target bacteria in Example 1, the sensitivity of the above DNA templates of different concentrations was tested respectively, and four strains of Clostridium botulinum type A, Clostridium botulinum type B, Clostridium botulinum type E and Clostridium botulinum type F were tested respectively. For example, for single detection of Clostridium botulinum type A, the amplification system can be used

[0063] 1) NTC: nuclease-free water;

[0064] The reaction system used a 25μL reaction system, which consisted of Premix EX TaqTM×2, which was 12.5μL; single botulinum toxin type A-F / R, i.e., upstream and downstream primers (10μM), which were both 0.4μL; botulinum toxin type A-P, i.e., probe (10μM), which was 0.2μL; nuclease-free water, which was 6.5μL; and the sample DNA, which was plasmid DNA of botulinum toxin type A, which was 5μL.

[0065] That is, the sample DNA is detected using the diluted positive template mentioned above, and the preferred amplification conditions are: pre-denaturation stage 95°C, 5min; amplification stage 95°C, 10sec; 60°C, 30sec; 45 cycles; and fluorescence signal is collected at 58°C. Real-time fluorescence quantitative PCR detection is performed on an ABI7500 PCR instrument.

[0066] 2) Make three parallel samples for each gradient.

[0067] Result determination: Ct value ≤ 35 with obvious amplification curve is positive result, Ct value > 40 without obvious amplification curve is negative result. The detection of other types of botulinum toxin is the same as above.

[0068] The fluorescence value diagram of the test results, among which the sensitivity test results of Clostridium botulinum type A are as follows Figure 1 As shown in the figure, the template copy numbers shown by the curves from left to right are 3×10 3 copies / μL, 3×10 2 The results show that the primers and probes used in the present invention can detect the botulinum toxin type A DNA at a concentration of 3 copies / μL. The sensitivity test results of botulinum toxin type B are shown in Figure 2. Figure 2 As shown in the figure, the template copy numbers shown by the curves from left to right are 3×10 3 copies / μL, 3×10 2 The results show that the method established by the present invention can detect the botulinum toxin type B DNA with a concentration of 3 copies / μL. The sensitivity test results of botulinum toxin type E are as follows: Figure 3 As shown in the figure, the template copy numbers shown by the curves from left to right are 3×10 3 copies / μL, 3×10 2 The results show that the method established by the present invention can detect the botulinum toxin E type DNA with a concentration of 3 copies / μL. The sensitivity test results of botulinum toxin F type are as follows: Figure 4 As shown in the figure, the template copy numbers shown by the curves from left to right are 3×10 3 copies / μL, 3×10 2 The results show that the method established by the present invention can detect the botulinum toxin F type DNA with a concentration of 3 copies / μL. It can be seen that the sensitivity of the present invention in detecting botulinum toxin is 3 copies / μL.

[0069] Example 3 Specificity Detection

[0070] The present invention uses plasmid DNA of Clostridium botulinum type A, Clostridium botulinum type B, Clostridium botulinum type E, Clostridium botulinum type F and genomic DNA of Bacillus atrophaeus as DNA templates, and performs specific detection on primers and probes for detecting a single strain (such as Clostridium botulinum type A). Specifically, real-time fluorescent PCR detection is performed according to the real-time fluorescent PCR reaction system configuration and amplification conditions in Example 2. The detection results show that the specificity of single strain detection is good, and only the DNA template of the target strain can be detected as positive, while the DNA templates of other Clostridium botulinum strains are detected as negative. This shows that the primers and probes designed by the present invention have good specificity, no cross reaction, and no false positive results.

[0071] And all primers and probes for different strains in Table 1 in Example 1 were mixed, and the specific dosage of each primer and probe was: 0.4 μL of upstream primer (10 μmol / L), 0.4 μL of downstream primer (10 μmo l / L) and 0.2 μL of probe (10 μM), 1.5 μL of nuclease-free water in the 25 μL PCR reaction system, and other dosages remained unchanged. The DNA templates of the above strains were amplified respectively, and the results showed that only the genomic DNA of Clostridium botulinum type A, Clostridium botulinum type B, Clostridium botulinum type E, Clostridium botulinum type F, and Bacillus atrophaeus were positive, and the others were negative. It shows that the primers and probes designed by the present invention have no cross reaction between the primers and probes, and no false negative results will occur.

[0072] Example 4 Detection kits for four types of Clostridium botulinum

[0073] The detection kit for Clostridium botulinum type A, Clostridium botulinum type B, Clostridium botulinum type E, and Clostridium botulinum type F comprises the following components: an upstream primer sequence for detecting Clostridium botulinum type A is shown in SEQ ID No. 1, a downstream primer sequence is shown in SEQ ID No. 2, and a probe sequence is shown in SEQ ID No. 3;

[0074] The upstream primer sequence for detecting Clostridium botulinum type B is shown in SEQ ID No. 4, the downstream primer sequence is shown in SEQ ID No. 5, and the probe sequence is shown in SEQ ID No. 6;

[0075] The upstream primer sequence for detecting Clostridium botulinum type E is shown in SEQ ID No.7, the downstream primer sequence is shown in SEQ ID No.8, and the probe sequence is shown in SEQ ID No.9;

[0076] The upstream primer sequence for detecting Clostridium botulinum type F is shown in SEQ ID No. 10, the downstream primer sequence is shown in SEQ ID No. 11, and the probe sequence is shown in SEQ ID No. 12. The above probes are all labeled with FAM group at their 5' end and BHQ1 and MGB at their 3' end.

[0077] For the specific type of botulinum to be detected, real-time fluorescence quantitative PCR can be used for detection using separate corresponding primer probes; when simultaneously detecting and screening four types of botulinum toxin, the above four probes can also be labeled with fluorescent groups and quenching groups in different detection channels to achieve simultaneous detection by real-time fluorescence quantitative PCR.

[0078] Furthermore, in order to prevent the reagents from becoming ineffective or contaminated, positive control and negative control reagents were provided, and nuclease-free water was used for the negative control; the upstream primer sequence for amplifying the positive control was shown in SEQ ID No.13, the downstream primer sequence was shown in SEQ ID No.14, and the probe sequence was shown in SEQ ID No.15.

[0079] The amplification positive control uses the genomic DNA of Bacillus atrophaeus. The detection of the amplification positive control is a detection of the entire reaction system process. If the result is positive, it means that there is no problem with the detection process. If it is a negative result, it means that the detection process is improperly operated or has problems, and the detection result is unreliable, so the reaction system should be reconfigured for detection.

[0080] The design of negative controls can effectively verify whether the reagents used are contaminated and avoid false positives. The design of positive controls can effectively verify the effectiveness of the reagents used and avoid false negatives.

[0081] The primers or probes for each type of botulinum toxin mentioned above can be packaged separately one by one, or the primers or probes for one type of botulinum toxin can be configured and mixed together and packaged according to the detection of a single strain, which can save configuration time during the detection operation.

[0082] Another object of the present invention is to provide a microfluidic chip that can be used to simultaneously detect or screen which type of botulinum toxin it is, wherein the structure of the microfluidic chip itself can be adopted to include a detection sheet body, the detection sheet body can be a sheet-like plate body, including a first side surface and a second side surface, a plurality of chamber holes are recessed on the first side surface, a branch injection flow channel connected to the first end of the chamber hole and an exhaust flow channel connected to the second end, and an exhaust hole connected to each exhaust flow channel, a main flow channel connected to each branch injection flow channel, and a sample injection channel located at the starting end of the main flow channel. The microfluidic chip is a microfluidic chip having a through hole structure, wherein the branch injection channel, the exhaust channel and the exhaust hole are non-through hole structures; the opening side of the exhaust hole is covered with a hydrophobic breathable membrane, and a first sealing sheet is compounded on the first side of the detection sheet body to block the branch injection channel, the exhaust channel and the first side of the chamber hole; a second sealing sheet is compounded on the second side of the detection sheet body to block the second side of the chamber hole, so that the chamber hole becomes a sealed chamber; the microfluidic chip also includes a third sealing sheet and a cover plate for closing the exhaust hole and the injection hole after the injection is completed.

[0083] The preparation method of the microfluidic chip for detecting botulinum toxin is as follows:

[0084] S1. Take the microfluidic chip (the second side of the detection chip body has been sealed with a membrane, and the first side is open), first ultrasonically clean it in acetone for 10 minutes, then ultrasonically clean it in anhydrous ethanol for 10 minutes, and then ultrasonically clean it in deionized water for 10 minutes, and finally take it out and dry it in an oven for later use;

[0085] S2. Place the microfluidic chip on a clean work surface, and use a pipette to take 1 μL of a mixture of upper and lower primers and probes for a botulinum typing (0.4 μL of the upstream primer (10 μmol / L), 0.4 μL of the downstream primer (10 μmol / L), and 0.2 μL of the probe (10 μmol / L) for botulinum type A) and spot it into different chambers; at the same time, an amplification positive control (PC) is set up, and the chamber contains the upstream primer (10 μmol / L) of the amplification control. L) 0.35 μL, downstream primer (10 μmol / L) 0.35 μL and probe 10 μmol / L 0.2 μL and amplification control positive template Bacillus atrophaeus DNA template 0.1 μL; negative control and blank control are also provided, and 1 μL of nuclease-free water is added to the negative control chamber; the blank control chamber is not added with any reagent and is naturally dried. The botulinum toxins and amplification positive controls (PC) in Table 1 are arranged and marked in the chip to distinguish the strains to be tested;

[0086] (For strains with a clear purpose of inspection, the mixture of primers and probes for the strains to be tested can be customized as needed)

[0087] S3, a hot press coats the chip to form a closed microfluidic chip;

[0088] S4. Use a vacuum device to evacuate the microfluidic chip and package it, then store it away from light for future use.

[0089] The operation of using the microfluidic chip prepared above for detecting Clostridium botulinum toxin is as follows:

[0090] (1) Sample processing and sample template DNA extraction can be performed using Qiagen DNA extraction reagent (such as Qiagen reagent company).

[0091] (2) Preparation of amplification system

[0092] The PCR amplification system was prepared using the Premix EX TaqTM (Takara Code: D332A) kit. The amplification system included a final concentration of Premix EX TaqTM×1, added with sample template DNA and sterile water, and the amount configured was such that the amount in each chamber was 20-25 μL, the reaction system was prepared (the reaction solution was prepared on ice), oscillated and mixed, and centrifuged briefly.

[0093] (3) Chip loading

[0094] Use a pipette to absorb the amplification system and inject the liquid into the microfluidic chip. After the liquid fills the microfluidic chip, pull out the pipette tip and seal the sample loading hole with sealant.

[0095] (4) PCR amplification

[0096] The microfluidic chip was placed in a nucleic acid amplification analyzer (Tianjin Zhishan Fluorescence Quantitative Chip Amplifier), and the amplification was set according to the pre-denaturation stage at 95°C for 5 min; the amplification stage at 95°C for 10 sec; and the amplification stage at 60°C for 30 sec; and 45 cycles.

[0097] (5) Results analysis

[0098] After amplification, the software of the nucleic acid amplification analyzer performs data processing and compares the test wells with the blank control wells. If there is an obvious amplification curve on the nucleic acid amplification analyzer, it is judged as positive; if there is no obvious amplification curve, it is judged as negative.

[0099] Example 5 Detection of samples

[0100] In order to verify the accuracy of the test results, the microfluidic chip prepared according to Example 4 can use the collected positive samples. Some strains that failed to collect clinical positive samples use plasmid DNA to prepare simulated positive samples for verification. According to the detection method of Example 4, the DNA templates of the separate positive samples are first detected respectively. The test results are that the positions corresponding to the positions marked as botulinum type A, botulinum type B, botulinum type E, and botulinum type F respectively correspond to the botulinum type of the positive sample with amplification curves and PC with amplification curves, that is, the test results are positive, and the results are accurate and reliable.

[0101] At the same time, after all positive samples were mixed, the above method was used for detection. The test results showed that the results corresponding to the positions marked as botulinum toxin type A, botulinum toxin type B, botulinum toxin type E, botulinum toxin type F, and PC all had amplification curves, that is, the test results were all positive. The test results are accurate, and the operation only needs to add the sample once to achieve the typing test of whether there is botulinum toxin type A, botulinum toxin type B, botulinum toxin type E, and botulinum toxin type F on the same sample at one time. There is no need for repeated operations, saving samples and testing costs.

[0102] The above is only a preferred embodiment of the present invention, and does not limit the present invention in other forms. Any person skilled in the art can use the above disclosed technical content to change or modify it into an equivalent embodiment with equivalent changes. However, any simple modification, equivalent change and modification made to the above embodiment according to the technical essence of the present invention without departing from the technical solution of the present invention still belongs to the protection scope of the technical solution of the present invention.

Claims

1. A primer-probe combination for detecting different types of Clostridium botulinum toxin, characterized in that: It includes upstream and downstream primers and probes for detecting botulinum type A, upstream and downstream primers and probes for detecting botulinum type B, upstream and downstream primers and probes for detecting botulinum type E, and / or upstream and downstream primers and probes for detecting botulinum type F; wherein the upstream primer sequence of botulinum type A is shown in SEQ ID No.1, the downstream primer sequence is shown in SEQ ID No.2, and the probe sequence is shown in SEQ ID No.3; The upstream primer sequence of the botulinum toxin type B is shown in SEQ ID No.4, the downstream primer sequence is shown in SEQ ID No.5, and the probe sequence is shown in SEQ ID No.6; The upstream primer sequence of the Clostridium botulinum type E is shown in SEQ ID No.7, the downstream primer sequence is shown in SEQ ID No.8, and the probe sequence is shown in SEQ ID No.9; The upstream primer sequence of the Clostridium botulinum F type is shown in SEQ ID No.10, the downstream primer sequence is shown in SEQ ID No.11, and the probe sequence is shown in SEQ ID No.

12.

2. The primer-probe combination according to claim 1, wherein The 5' end of each probe is labeled with a fluorescent group, and the 3' end is labeled with a quencher group.

3. A kit for detecting different types of Clostridium botulinum toxin, characterized in that: It comprises the primer-probe combination as claimed in claim 1 or 2.

4. The kit according to claim 3, characterized in that in, The positive control for botulinum type A is a plasmid containing a nucleotide sequence as shown in SEQ ID No.16, the positive control for botulinum type B is a plasmid containing a nucleotide sequence as shown in SEQ ID No.17, the positive control for botulinum type E is a plasmid containing a nucleotide sequence as shown in SEQ ID No.18, and the positive control for botulinum type F is a plasmid containing a nucleotide sequence as shown in SEQ ID No.

19.

5. The kit according to claim 3, characterized in that Also includes Premix EX TaqTM × 2.

6. A microfluidic chip for simultaneously detecting different types of botulinum toxin, characterized in that: The microfluidic chip includes a detection sheet body of which each chamber hole is coated with an upstream and downstream primer and probe for detecting botulinum type A, an upstream and downstream primer and probe for detecting botulinum type B, an upstream and downstream primer and probe for detecting botulinum type E, and an upstream and downstream primer and probe for detecting botulinum type F; wherein the upstream primer sequence of botulinum type A is shown in SEQ ID No. 1, the downstream primer sequence is shown in SEQ ID No. 2, and the probe sequence is shown in SEQ ID No. 3; The upstream primer sequence of the botulinum toxin type B is shown in SEQ ID No.4, the downstream primer sequence is shown in SEQ ID No.5, and the probe sequence is shown in SEQ ID No.6; The upstream primer sequence of the Clostridium botulinum type E is shown in SEQ ID No.7, the downstream primer sequence is shown in SEQ ID No.8, and the probe sequence is shown in SEQ ID No.9; The upstream primer sequence of the Clostridium botulinum F type is shown in SEQ ID No. 10, the downstream primer sequence is shown in SEQ ID No. 11, and the probe sequence is shown in SEQ ID No. 12; All probes were labeled with FAM or ROX at the 5' end and NFQ-MGB at the 3' end.

7. The microfluidic chip according to claim 6, characterized in that: It also includes chamber wells with upstream and downstream primers, probes and amplification control positive templates, chamber wells with nuclease-free water as negative controls, and blank control wells; the upstream primer sequence of the amplification control is shown in SEQ ID No.13, the downstream primer sequence is shown in SEQ ID No.14, and the probe sequence is shown in SEQ ID No.15; the amplification control positive template is the genomic DNA of Bacillus atrophaeus.

8. A method for simultaneously detecting different types of Clostridium botulinum using a microfluidic chip, which uses the microfluidic chip of claim 6 or 7 for detection, comprising the following steps: S1. Extraction of template DNA of the sample to be tested; S2, Premix EX TaqTM×2, sample template DNA and sterile water to prepare the PCR amplification system; S3, injecting the amplification system into the sample loading hole in the microfluidic chip, and after the liquid fills the microfluidic chip, sealing the sample loading hole with a sealant; S4, placing the microfluidic chip into a nucleic acid amplification analyzer, setting amplification reaction parameters for amplification; S5. After amplification is completed, the software of the nucleic acid amplification analyzer performs data processing and compares it with the blank control well. If the test well has an obvious amplification curve on the nucleic acid amplification analyzer, it is judged as positive; if there is no obvious amplification curve, it is judged as negative.

9. The method according to claim 8, characterized in that The amplification reaction parameters were set as follows: pre-denaturation stage at 95° C., 5 min; amplification stage at 95° C., 10 sec; 60° C., 30 sec; 45 cycles.

10. The method according to claim 8, characterized in that The template DNA is extracted using a genomic DNA extraction kit.

Images