Application of therapeutic target in preparation of drug for treating targeted therapy resistance of kidney cancer

Abstract

The invention discloses an application of a therapeutic target spot in preparation of a drug for treating targeted therapy resistance of kidney cancer. The therapeutic target spot is SLC27A3. The SLC27A3 comprises an SLC27A3 gene and a coding sequence thereof, an expression product of the SLC27A3 gene and a coding sequence thereof, and the SLC27A3 gene and an active fragment or derivative of the expression product thereof; the nucleotide of the SLC27A3 is as shown in SEQ ID NO. 1. According to the invention, a therapeutic target SLC27A3 is knocked out or silenced, and a compound Parishin for resisting the SLC27A3 protein is provided, so that the resistance of renal clear cell carcinoma cells to the pezopanib is remarkably improved, and the sensitivity of renal carcinoma cells to the pezopanib is enhanced.

Description

Technical Field

[0001] The present invention relates to the field of biomedicine, and in particular to an application of a therapeutic target in the preparation of a drug for coping with resistance to targeted therapy of renal cancer. Background Art

[0002] Renal cell carcinoma is a common malignant tumor of the urinary system. Surgical treatment of early localized renal cancer can achieve relatively satisfactory results. Since renal cancer is insensitive to traditional radiotherapy and chemotherapy, targeted therapy (such as tyrosine kinase inhibitors TKI drugs sunitinib, pazopanib) and immune checkpoint inhibitors (ICI drugs such as PD-1 / PD-L1 antibodies) are currently the main treatments for advanced and metastatic renal cancer.

[0003] However, tumor drug resistance is one of the difficulties faced by clinicians. Tumor treatment has entered the era of precision treatment. Targeted therapy and immunotherapy are currently popular treatments for various advanced tumors. PD-1 / PD-L1 inhibitors have been used for advanced bladder cancer, gastric cancer, breast cancer, etc., and TKI preparations are used for advanced lung cancer, kidney cancer, etc. However, after a period of treatment, some patients will develop drug resistance to TKI and ICI, leading to tumor progression. For example, advanced kidney cancer usually develops drug resistance after using TKI for about 6-12 months.

[0004] Therefore, in-depth research on the intrinsic molecular mechanism of TKI resistance in renal cancer is of great significance for discovering new therapeutic targets and monitoring indicators. At the same time, it is urgent to find relevant targets of resistance to solve this clinical problem. Summary of the invention

[0005] The purpose of the present invention is to provide an application of a therapeutic target in the preparation of a drug for treating renal cancer targeted therapy resistance, so as to solve the technical problem in the prior art that renal cancer cells will develop drug resistance.

[0006] In order to solve the above technical problems, the present invention specifically provides the following technical solutions:

[0007] The present invention provides an application of a therapeutic target in the preparation of a drug for coping with resistance to targeted therapy of renal cancer, wherein the therapeutic target is SLC27A3;

[0008] The SLC27A3 includes the SLC27A3 gene and its coding sequence, the expression product of the SLC27A3 gene and its coding sequence, and the active fragments or derivatives of the SLC27A3 gene and its expression product;

[0009] The nucleotide sequence of the SLC27A3 gene is shown in SEQ ID NO.1.

[0010] As a preferred embodiment of the present invention, the amino acid sequence of the expression product of the SLC27A3 gene is shown as SEQ ID NO.2.

[0011] As a preferred embodiment of the present invention, the active fragments or derivatives of the SLC27A3 gene and its expression products include but are not limited to proteins or active polypeptides whose coding sequences have at least 80% homology with the sequence shown in SEQ ID NO.2 and have the characteristics or functions of SLC27A3.

[0012] As a preferred embodiment of the present invention, the SLC27A3 is used to prepare a medicine for reducing the resistance of renal cancer to renal cancer drugs.

[0013] As a preferred embodiment of the present invention, the drug comprises a SLC27A3 inhibitor and a pharmaceutically acceptable carrier, wherein the SLC27A3 inhibitor can inhibit the activity or expression of SLC27A3 and reduce the resistance of renal cancer to pazopanib;

[0014] The dosage of the SLC27A3 inhibitor is 0.01 μg to 1000 mg / day per patient.

[0015] As a preferred embodiment of the present invention, the SLC27A3 inhibitor includes one or more of a regulator that reduces SLC27A3 expression, a protease that degrades SLC27A3 products, a nuclease, and a regulator that reduces SLC27A3 products.

[0016] As a preferred embodiment of the present invention, the regulator for reducing the expression of SLC27A3 is used to knock out or silence the SLC27A3;

[0017] The regulator for reducing SLC27A3 expression includes siRNA, shRNA or miRNA;

[0018] Wherein, the functional sequence used for knockdown in the shRNA is any one of SEQ ID NO.3 or SEQ ID NO.4.

[0019] As a preferred embodiment of the present invention, the regulator that reduces the SLC27A3 product comprises a SLC27A3 antibody.

[0020] As a preferred embodiment of the present invention, the SLC27A3 inhibitor is the compound Parishin.

[0021] As a preferred embodiment of the present invention, the renal cell carcinoma is ccRCC.

[0022] Compared with the prior art, the present invention has the following beneficial effects:

[0023] The present invention proposes and verifies for the first time that SLC27A3 protein is a new target for gene therapy to solve the drug resistance of ccRCC, including the gene and its coding sequence, the expression product of the SLC27A3 gene and its coding sequence, and the active fragment or derivative of the SLC27A3 gene and its expression product. By detecting the expression level of SLC27A3 in tissues, it has clinical value for the diagnosis of ccRCC and the judgment of its survival period, and is of great significance for the screening of new drugs against renal cancer.

[0024] The present invention provides a regulator compound Parishin for reducing the expression of SLC27A3, which can knock out or silence the SLC27A3, significantly improve the resistance of renal clear cell carcinoma cells to pazopanib, and enhance the sensitivity of renal carcinoma cells to pazopanib;

[0025] The present invention provides multiple implementation methods for blocking the expression of SLC27A3, and provides new ideas for the subsequent establishment of SLC27A3 blocking drugs. BRIEF DESCRIPTION OF THE DRAWINGS

[0026] In order to more clearly illustrate the implementation methods of the present invention or the technical solutions in the prior art, the following briefly introduces the drawings required for the implementation methods or the description of the prior art. Obviously, the drawings in the following description are only exemplary, and for ordinary technicians in this field, other implementation drawings can be derived from the provided drawings without creative work.

[0027] Figure 1 Provided for the present invention is a graph showing the difference in expression of SLC27A3 gene in paired cancer tissues and adjacent normal tissues in TCGA-KIRC database as shown in Verification Example 1;

[0028] Figure 2 Provided for the present invention is a graph showing the difference in expression of SLC27A3 gene in non-paired cancer tissue and adjacent normal tissue in TCGA-KIRC database as shown in Verification Example 1;

[0029] Figure 3 The present invention provides the immunoblot electrophoresis diagram of SLC27A3 after tissue protein extraction of renal cancer and adjacent tissue specimens shown in Verification Example 2;

[0030] Figure 4 Provided for the present invention are graphs showing the results of the clone formation experiment of the parental cell 786-O and the pazopanib-resistant cell 786-O-PR in the presence of pazopanib as shown in Verification Example 3;

[0031] Figure 5The present invention provides a result graph of the protein expression level of the SLC27A3 gene in the parental cell 786-O and the pazopanib-resistant cell 786-O-PR shown in Verification Example 3;

[0032] Figure 6 Provided is a graph showing the results of the area under the receiver operating characteristic (ROC) curve (AUC) of SLC27A3 in the diagnosis of renal cancer as shown in Verification Example 1 of the present invention;

[0033] Figure 7 Provided for the present invention is a graph showing the effect of different expression levels of SLC27A3 on the overall survival (OS) of patients as shown in Verification Example 1;

[0034] Figure 8 Provided for the present invention is a graph showing the effect of different expression levels of SLC27A3 on the progression-free survival (PFI) of patients as shown in Verification Example 1;

[0035] Fig. 9 Provided for the present invention is a graph showing the effect of different expression levels of SLC27A3 on the patient's tumor-specific survival (DSS) as shown in Verification Example 1;

[0036] Fig.10 The present invention provides a knockdown efficiency diagram of protein levels in the knockdown group and the control group after knocking down SLC27A3 in the drug-resistant cell line 786-O-PR using a lentivirus as shown in Example 1;

[0037] Fig.11 The present invention provides a graph showing the experimental results of the effect of stable knockdown of SLC27A3 by lentivirus on the drug resistance of tumor cells to pazopanib in the drug-resistant cell line 786-O-PR as shown in Example 1;

[0038] Fig.12 The present invention provides a statistical graph showing the effect of stable knockdown of SLC27A3 by lentivirus on the drug resistance of tumor cells to pazopanib in the drug-resistant cell line 786-O-PR as shown in Example 1;

[0039] Fig.13 The present invention provides an immunoblot electrophoresis diagram of protein levels in the overexpression group and the control group after overexpression of SLC27A3 in the parental cell 786-O as shown in Comparative Example 1;

[0040] Fig.14 The present invention provides a graph showing the experimental results of the effect of overexpression of SLC27A3 on the resistance of tumor to pazopanib after overexpression of SLC27A3 in parental cell 786-O as shown in Comparative Example 1;

[0041] Fig.15Provided for the present invention is a statistical graph showing the effect of overexpression of SLC27A3 on the resistance of tumor to pazopanib after overexpression of SLC27A3 in parental cell 786-O as shown in Comparative Example 1;

[0042] Fig.16 The present invention provides an immunoblot electrophoresis diagram of protein levels in the overexpression group and the control group after overexpression of SLC27A3 in the parental cell 769-P as shown in Comparative Example 1;

[0043] Fig.17 The present invention provides a graph showing the experimental results of the effect of overexpression of SLC27A3 on the resistance of tumor to pazopanib after overexpression of SLC27A3 in parental cell 769-P as shown in Comparative Example 1;

[0044] Fig.18 The present invention provides a statistical graph showing the effect of overexpression of SLC27A3 on the resistance of tumor to pazopanib after overexpression of SLC27A3 in parental cell 769-P as shown in Comparative Example 1;

[0045] Fig.19 The present invention provides a graph showing the experimental results of the effect of stable knockdown of SLC27A3 by lentivirus on the drug resistance of tumors to pazopanib after constructing a ccRCC kidney orthotopic transplant tumor model at the animal level as shown in Example 2;

[0046] Fig. 20 Provides a cartoon image of the compound Parishin of the present invention;

[0047] Fig.21 Provide a surface image of the compound Parishin of the present invention;

[0048] Fig. 22 Provide a 2D image of the compound Parishin of the present invention;

[0049] Fig.23 Provide a 3D image of the compound Parishin of the present invention;

[0050] Fig.24 The present invention provides a graph showing the experimental results of the compound Parishin in Example 3 binding to the SLC27A3 protein, thereby inhibiting the function of the SLC27A3 protein and reducing the proliferation ability of the tumor cell 786-O. DETAILED DESCRIPTION

[0051] The following will be combined with the drawings in the embodiments of the present invention to clearly and completely describe the technical solutions in the embodiments of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0052] Solute Carrier Family 27Member 3 (SLC27A3), also known as very long-chain acyl-CoA synthetases 3 (ACSVL3), mainly acts as an acyl-CoA ligase, catalyzing the synthesis of acyl-CoA using long-chain and very long-chain fatty acids (LCFA and VLCFA) as substrates. Studies have shown that SLC27A3 expression is elevated in glioblastoma and lung cancer, and promotes tumor growth. However, SLC27A3 has not been studied in ccRCC, and there are few studies on this gene. It is of great value to explore its effect on ccRCC TKI resistance in depth.

[0053] The present invention provides an application of a therapeutic target in the preparation of a drug for coping with targeted therapy resistance of renal cancer. The therapeutic target is SLC27A3, including a gene and its coding sequence, an expression product of the SLC27A3 gene and its coding sequence, and an active fragment or derivative of the SLC27A3 gene and its expression product.

[0054] The expression product of the SLC27A3 gene is the SLC27A3 protein, and the nucleotide sequence of SLC27A3 may be or include the NCBI reference sequence: NM_024330.4, NM_001317929.4. Preferably, the nucleotide sequence of the SLC27A3 gene is as shown in SEQ ID NO.1.

[0055] The amino acid sequence of the SLC27A3 protein may be or include, but is not limited to, the NCBI reference sequence: NP_077306.3, NP_001304858.3 sequence, or an amino acid sequence having at least 80%, 85%, 90% or 95% identity with the NP_077306.3, NP_001304858.3 sequence, and an amino acid sequence having the characteristics or functions of SLC27A3.

[0056] The SLC27A3 protein can be human SLC27A3, and preferably, the amino acid sequence of the SLC27A3 protein is shown in SEQ ID NO. 2. More preferably, the coding sequence of the SLC27A3 protein has a homology of more than 70% with the sequence of SEQ ID NO. 1 and is a protein or an active polypeptide thereof having G protein ligand activity, preferably, the homology is more than 80%, and more preferably, the homology is more than 90%.

[0057] The active fragments or derivatives of the SLC27A3 gene and its expression products include but are not limited to proteins or active polypeptides whose coding sequences have at least 80% homology with the sequence shown in SEQ ID NO.2 and have the characteristics or functions of SLC27A3.

[0058] Preferably, the homology with the sequence shown in SEQ ID NO. 2 is greater than 85%, more preferably greater than 90%, and even more preferably greater than 95%.

[0059] In the present invention, SLC27A3 is used to prepare a drug for reducing the resistance of renal cancer to renal cancer drugs. Specifically, the therapeutic target SLC27A3 is used to prepare a drug for reducing the resistance of renal cancer to pazopanib.

[0060] The drug comprises a SLC27A3 inhibitor and a pharmaceutically acceptable carrier, and the drug further comprises an antioxidant, such as ascorbic acid, sodium sulfite or sodium bisulfate, and an excipient, such as corn starch, wheat starch, methyl cellulose, sodium carboxymethyl cellulose or gelatin.

[0061] The active substance in the drug is a SLC27A3 inhibitor, which can inhibit the activity or expression of SLC27A3 and reduce the resistance of renal cancer to pazopanib. The drug administration routes of the present invention include oral, intravenous, parenteral, intramuscular, subcutaneous, intraperitoneal, intranasal, rectal administration or topical administration.

[0062] In the present invention, the dosage of the drug of the present invention can be determined by factors such as the type of disease to be treated, the severity of the disease, the route of administration, the patient's age, gender, health status, etc. Wherein, the dosage of the SLC27A3 inhibitor is 0.01 μg to 1000 mg / day per patient.

[0063] In the present invention, the SLC27A3 inhibitor includes one or more of a regulator that reduces SLC27A3 expression, a protease that degrades SLC27A3 products, a nuclease, and a regulator that reduces SLC27A3 products.

[0064] Furthermore, the regulator for reducing SLC27A3 expression is used to knock out or silence SLC27A3, and the regulator for reducing SLC27A3 expression includes siRNA, shRNA or miRNA.

[0065] In the present invention, the siRNA refers to a short double-stranded RNA that can induce RNA interference by inducing the degradation of certain mRNAs. The siRNA includes a sense RNA chain having a sequence homologous to the mRNA of the target gene and an antisense RNA chain having a sequence complementary thereto. The siRNA can inhibit the expression of the target gene and can be used for gene knockdown and gene therapy.

[0066] In the present invention, the shRNA (short hairpin RNA) is a single-stranded RNA, which includes a stem portion and a loop portion that form a double-stranded portion through hydrogen bonds. It is processed and converted into siRNA by proteins such as Dicer, and performs the same function as siRNA, and the siRNA sequence that performs the function can be the same as the aforementioned siRNA sequence.

[0067] In the present invention, miRNA refers to 21 to 23 non-coding RNAs that regulate gene expression by promoting degradation of target RNA or inhibiting its translation after transcription. In the present invention, the functional sequence used for knockdown in shRNA is any one of the nucleotide sequences shown in SEQ ID NO.3 or SEQ ID NO.4.

[0068] In a preferred embodiment, the modulator that reduces SLC27A3 production comprises a SLC27A3 antibody.

[0069] In a preferred embodiment, the above renal cancers are all ccRCC.

[0070] The following verification example verifies the function of SLC27A3.

[0071] Validation Example 1: SLC27A3 is highly expressed in cancer tissues and represents a worse survival prognosis

[0072] 1. Bioinformatics technology was used to search the authoritative database TCGA-KIRC renal cancer dataset and compare the expression difference of SLC27A3 between paired and unpaired cancer tissues and adjacent normal tissues. The results showed that the expression of SLC27A3 in cancer tissues was higher than that in normal tissues (see Figure 1 , 2 ).

[0073] 2. Using the database SLC27A3 expression values ​​and clinical diagnosis data, ROC was performed with specificity and sensitivity, and the relevant AUC was calculated, which confirmed that the expression difference of SLC27A3 has important clinical value for the diagnosis of ccRCC (AUC = 0.915, see Figure 6 ).

[0074] 3. The SLC27A3 expression values, follow-up time and clinical prognosis data of ccRCC patients in the existing public database were collected and sorted, and the patients were divided into the SLC27A3 high expression group and the SLC27A3 low expression group. The survival curve was plotted with Log-rank P < 0.01 as the significant difference. The results showed that ccRCC patients with high expression of SLC27A3 had a poor clinical prognosis, and their survival time was shorter than that of the low expression group (see Figure 7 , Figure 8 , Fig. 9 ).

[0075] It can be seen that detecting the expression difference of SLC27A3 in patients has important clinical value for the diagnosis of ccRCC and the estimation of its survival period.

[0076] Verification Example 2: SLC27A3 protein is highly expressed in cancer and adjacent tissues

[0077] The ccRCC cancer and adjacent tissues (11 pairs in total) collected in our center were selected, and the corresponding tissues were fully ground using a tissue grinder, and the tissues were fully lysed using RIPA strong lysis buffer (with protease inhibitors and phosphatase inhibitors added at a ratio of 1:100), and then allowed to stand on ice for 1 hour. After high-speed centrifugation at 4°C, the supernatant was collected, which was the tissue protein.

[0078] Use 10% SDS-PAGE gel, mix the prepared protein sample with 5× loading buffer in proportion, and place in a metal bath at 100℃ for 10min. Pre-stain protein marker, 5μL / lane, take a suitable volume of protein sample and add it to the lane. Use constant voltage 80V for electrophoresis for 30min, and constant voltage 120V until bromophenol blue reaches the bottom of the gel to terminate electrophoresis. Take out the gel, mark and transfer the membrane, immerse the gel in transfer buffer for 10min, cut the PVDF membrane and filter paper according to the size of the gel, place them in transfer buffer for 5min, and soak the PVDF membrane in methanol for 30 seconds before use.

[0079] Place the gel on the negative electrode side, assemble the transfer "sandwich" in order, add one layer at a time, and gently remove the bubbles with a glass rod. Place the transfer tank in ice, put the "sandwich" in accordance with the electrode, add the transfer buffer, 300mA constant current, and set the transfer time according to the molecular weight of the target protein. After the transfer is completed, place the transferred PVDF membrane in TBST buffer for use. Wash the membrane with TBST buffer for 5 minutes, shaking slowly. Place the membrane in TBST containing 5% skim milk and block at room temperature for 1 to 2 hours. Wash the membrane 3 times with TBST, 5 minutes / time, place the membrane in a hybridization bag, add an appropriate amount of primary antibody diluted with antibody diluent, and incubate overnight at 4°C with slow shaking. Wash the membrane 3 times with TBST, 5 minutes / time.

[0080] Place the membrane in a hybridization bag, add an appropriate amount of secondary antibody diluted in TBST, and incubate at 37°C for 1 hour. Wash the membrane 3 times with TBST, 15 minutes each time. Prepare the developer according to the instructions of the development kit, enter the darkroom, place the membrane in the hybridization bag, evenly apply an appropriate amount of developer, close the bag, remove the bubbles in the bag, fix the hybridization bag in the dark box, put the film close to the hybridization bag, do not leave any bubbles, close the dark box, find the appropriate exposure time, scan the film and analyze the image. The antibody dilution ratio refers to the antibody instructions.

[0081] Table 1 Antibodies for immunoblotting

[0082]

[0083] Figure 3 It was shown that the content of SLC27A3 protein in cancer tissue (T) was significantly higher than that in adjacent paracancerous tissue (N).

[0084] The above verification example provides a method for verifying the content of SLC27A3 protein, which is convenient for quickly verifying the content of SLC27A3 protein in cancer tissue and adjacent tissue.

[0085] Verification Example 3: SLC27A3 protein is highly expressed in renal cancer resistant cells

[0086] 1. Inducing the formation of 786-O pazopanib-resistant cells by increasing concentration gradient

[0087] According to existing literature reports, 786-O parental cells were induced with 2 μM of pazopanib hydrochloride as the starting concentration, and the cells were stably passaged at least 5 times. The concentration gradient of pazopanib hydrochloride was 2 μM, 4 μM, 8 μM, 10 μM, and 12 μM, respectively. After 6 months of drug induction, we established a stable pazopanib-resistant cell line 786-O-PR.

[0088] Figure 4 Shown are the cell clone formation detected 14 days after the parental cell 786-O and the resistant cell 786-O-PR were given pazopanib, and the number of clones formed by the resistant cell was significantly greater than that of the parental cell.

[0089] 2. Immunoblotting technology to detect the differential expression of SLC27A3 protein in parental cells and drug-resistant cells. The protein preparation method and immunoblotting technology are the same as those described in the above-mentioned verification example 2.

[0090] Figure 5 It is shown that the protein level of SLC27A3 in the drug-resistant cells 786-O-PR is significantly higher than that in the parental cells 786-O.

[0091] Verification Example 3 shows that after ccRCC develops drug resistance, the protein level of SLC27A3 will further increase.

[0092] The following examples illustrate that knocking down SLC27A3 can reduce the resistance of renal cancer to anticancer drugs after the expression of SLC27A3 is inhibited.

[0093] Embodiment 1:

[0094] 1. Establishment of SLC27A3 gene lentiviral knockdown cell line

[0095] Day 1:

[0096] Prepare cells: Culture cells to the logarithmic growth phase, trypsinize, count cells in the control group and knockdown group, resuspend in cell culture medium and culture equal numbers of cells in 10 cm cell culture dishes. This inoculum of 786-O-PR cells can grow to 80% to 90% confluence on the third day after infection.

[0097] the next day:

[0098] (1) Prepare lentiviral particles - constructed SLC27A3 gene RNA interference lentiviral vector particles (LV-SLC27A3-RNAi) and control group lentiviral vector particles, calculate the amount of lentiviral particles required, take out the lentiviral particles frozen at -80°C, and melt them in an ice bath;

[0099] The functional sequence SLC27A3-RNAi used to knock down SLC27A3 is:

[0100] GGAAGATGTGATCTACCTCGCTCAAGAGGCGAGGTAGATCACATCT TCC (SEQ ID NO. 3);

[0101] as well as

[0102] TGTGCCGATACCTTGTCAACCTCAAGAGGGTTGACAAGGTATCGGCACA(SEQ ID NO.4);

[0103] The inserted sequence of the control group is:

[0104] GCTTCGCGCCGTAGTCTTATCAAGAGTAAGACTACGGCGCGAAGC(SEQ:Vector).

[0105] (2) Infect target cells: Take out the cells from the incubator and observe the cell growth status and cell confluence under a microscope; if the cells are in good condition, start the experiment:

[0106] A. Use a pipette to carefully remove the old culture medium from the 10 cm cell culture dish and add new complete culture medium;

[0107] B. Add the calculated lentiviral particles to the cells, place the culture plate flat on the workbench, and gently mix in a figure-8 pattern;

[0108] C. After mixing, place the cell culture plate in a 37°C, 5% CO2 incubator for overnight culture.

[0109] Day 3:

[0110] Replace the culture medium: 12 to 16 hours after infection, aspirate the culture medium containing lentiviral particles, add 1640 complete culture medium containing 10% serum to the culture plate again, and continue culturing.

[0111] Day 4:

[0112] Continue to culture the cells and observe whether the cell status is abnormal.

[0113] Day 5:

[0114] Observe (evaluate) the infection efficiency of lentiviral particles: cover the 10 cm cell culture dish tightly, clean the outer wall of the culture plate with 75% ethanol, observe the fluorescence under an inverted fluorescence microscope, take pictures and estimate the infection efficiency of lentiviral particles on cells.

[0115] Day 6: When the number of fluorescent cells was found to be more than 50%, puromycin was used to screen positive cells, and SLC27A3 gene lentiviral knockout 786-O-PR cells, namely shSLC27A3-1, 2, were obtained.

[0116] The fluorescence was observed by inverted fluorescence microscope. If the number of fluorescent cells was above 50%, the SLC27A3 gene lentivirus successfully infected 786-O-PR cells. The method for establishing SLC27A3 overexpression cell lines in 786-O and 769-P was the same.

[0117] 2. Determination of the interference efficiency of lentiviral knockdown of SLC27A3 gene in 786-O-PR cells

[0118] Vector and shSLC27A3-1,2 cell lines were collected for total protein extraction and SLC27A3 protein content detection using the same method as described in Validation Example 2.

[0119] Depend on Fig.10 It can be seen that compared with Vector, the protein expression level of shSLC27A3 was significantly decreased, and the SLC27A3 gene lentiviral knockout 786-O-PR cell line was successfully established.

[0120] 3. Effect of SLC27A3 knockdown on pazopanib resistance in ccRCC cells

[0121] Fig.11 The figure shows the plate cloning test of cell resistance to pazopanib. The cells in each group were digested and counted to 1000 cells / well, and then divided into groups with and without pazopanib addition, seeded in 6-well plates, and cultured for 12 days. Fig.12 Shown are the preparation of single cell suspensions of the following cells: SLC27A3 gene lentiviral knockdown 786-O-PR cells (shSLC27A3-1,2) and its control group 786-O-PR cells (Vector), each group was further divided into a group with pazopanib added and a group without pazopanib added, each group was seeded at a density of 3000 cells / well in a 96-well plate, and three replicates were set for each group. 10μL CCK8 reagent was added to each well at different time periods, and the cells were incubated at 37°C in the dark for 1h. The absorbance was detected at a wavelength of 450nm using a microplate reader, and growth curves were prepared using GraphPad Prism 9.0, and the cell proliferation of each group at 0h, 24h, 48h, 72h, and 96h was detected.

[0122] Depend on Fig.11 and Fig.12 The results showed that knockdown of SLC27A3 significantly enhanced the resistance of renal clear cell carcinoma cells to pazopanib.

[0123] Comparative Example 1: Overexpression of SLC27A3 reduces the sensitivity of renal cancer cells to pazopanib

[0124] 1. Determination of SLC27A3 gene overexpression efficiency

[0125] Vector and SLC27A3-OE cell lines were collected for total protein extraction and SLC27A3 protein content detection, using the same method as described in Validation Example 2.

[0126] Depend on Fig.13 , 16 It can be seen that compared with Vector, the protein expression level of SLC27A3-OE was significantly increased, and the 786-O and 769-P cell lines with overexpression of SLC27A3 gene were successfully established.

[0127] 2. Effect of overexpression of SLC27A3 on pazopanib sensitivity of ccRCC cells

[0128] Fig.14 , 15 The plate cloning and cell proliferation CCK-8 detection methods are the same as those described in step 3 of Example 1. Fig.14 and Fig.15 The results showed that overexpression of SLC27A3 significantly attenuated the sensitivity of 786-O cells to pazopanib. Fig.17 , 18The plate cloning and cell proliferation CCK-8 detection methods are the same as those described in step 3 of Example 1. Fig.17 and Fig.18 The results showed that overexpression of SLC27A3 significantly attenuated the sensitivity of 769-P cells to pazopanib.

[0129] Example 2: In vivo experiments

[0130] 1. Establishment of nude mouse renal orthotopic tumor model

[0131] 1) Cell preparation: Screen and expand the 786-O-PR cell line with stable knockdown of SLC27A3, prepare 1×10 cells per nude mouse 6 Cells (including control group and knockdown group) were collected in sterile EP tubes and resuspended in PBS for use;

[0132] 2) Preparation of nude mice: 3-4 week old BALB / c-nu nude mice were selected as experimental subjects and raised in the SPF-grade breeding room of the animal platform of our research center, and all aspects of breeding were strictly ensured to be sterilized and aseptic;

[0133] 3) Model establishment: After anesthesia is completed, fix the nude mice and keep the surgical instruments sterile. Disinfect the surgical area (left back kidney area) with 5% iodine solution, cut the skin and subcutaneous tissue, expose the kidney and fix it. Mix the cells and extract about 100 μL of cell suspension (1×10 6 Cells were mixed with the cell suspension and matrix gel at a ratio of 1:1) and injected under the kidney capsule. After the injection, the needle was withdrawn to observe whether there was active bleeding. After there was no bleeding, the peritoneum, subcutaneous tissue and skin layer of the nude mouse were sutured layer by layer, and the incision was disinfected. After completion, it was marked, weighed and recorded;

[0134] 4) Administration and observation: Mice in the pazopanib group were intraperitoneally injected with pazopanib hydrochloride solution every other day, and the nude mice were observed weekly;

[0135] 5) Specimen collection: One month later, the nude mice were anesthetized and LAR substrate was injected intraperitoneally for tumor imaging. In vivo fluorescence was captured in a small animal imager, and the photographs and fluorescence values ​​were recorded. The nude mice were then killed in strict accordance with animal ethics requirements and the tumor-bearing kidneys were removed.

[0136] 6) Specimen storage: The isolated tumor-bearing kidneys were marked according to the experimental groups, fixed with paraformaldehyde and stored at room temperature for future use.

[0137] Depend on Fig.19 The results showed that compared with the control group, knocking down SLC27A3 under the condition of pazopanib administration could significantly inhibit tumor growth. The fluorescence signal of the tumor in the SLC27A3 knockdown + pazopanib treatment group was the weakest, indicating that tumor growth was significantly inhibited.

[0138] Example 2 shows that knocking down SLC27A3 can reduce the resistance of renal cancer to pazopanib and restore the sensitivity of renal cancer cells to pazopanib, thereby further inhibiting the growth of advanced renal cancer.

[0139] Embodiment 3:

[0140] Based on the pocket sitel (key amino acids LYS304 / ASP546 / GLU423 / GLU562) predicted by Schrödinger software, computer virtual screening was performed in the biologically active drug library (containing 23,000 compounds) and the drug-like library (containing 70,000 compounds). Based on the molecular docking score, the potential compound Parishin that can bind to the SLC27A3 protein and inhibit its function was obtained.

[0141] The cartoon picture of compound Parishin is shown in Fig. 20 The surface diagram of compound Parishin is shown in Fig.21 , the 2D image of compound Parishin is shown in Fig. 22 , the 3D image of compound Parishin is shown in Fig.23 .

[0142] The binding mode of the compound to SLC27A3 is shown in the figure Fig. 22 and Fig.23 shown.

[0143] In the presence of pazopanib, exogenous overexpression of SLC27A3 protein (OE-SLC27A3) in 786-O cells and simultaneous addition of Parishin restricted cell growth to a certain extent, e.g. Fig.24 As shown, the results showed that Parishin could attenuate the proliferation ability of tumor cell 786-O by inhibiting the function of SLC27A3 protein.

[0144] The above examples show that the present invention provides an application of a SLC27A3 protein inhibitor in the preparation of a drug for responding to resistance to targeted therapy of renal cancer. The results show that compared with the control group cells, the proliferation ability of the resistant cell line 786-O-PR cell line after SLC27A3 gene lentiviral knockdown was significantly inhibited in the presence of pazopanib, and tumor growth was significantly inhibited at the animal level; while overexpression of SLC27A3 in the parental cells 786-O and 769-P can enhance their resistance to pazopanib.

[0145] The above embodiments are only exemplary embodiments of the present application and are not intended to limit the present application. The protection scope of the present application is defined by the claims. Those skilled in the art may make various modifications or equivalent substitutions to the present application within the essence and protection scope of the present application, and such modifications or equivalent substitutions shall also be deemed to fall within the protection scope of the present application.

Claims

1. Use of a therapeutic target in the preparation of a drug for treating resistance to targeted therapy of renal cancer, characterized in that: The therapeutic target is SLC27A3; The SLC27A3 includes the SLC27A3 gene and its coding sequence, the expression product of the SLC27A3 gene and its coding sequence, and the active fragments or derivatives of the SLC27A3 gene and its expression product; The nucleotide sequence of the SLC27A3 gene is shown in SEQ ID NO.

1.

2. The use of a therapeutic target according to claim 1 in the preparation of a drug for treating resistance to targeted therapy of renal cancer, characterized in that: The amino acid sequence of the expression product of the SLC27A3 gene is shown in SEQ ID NO.

2.

3. The use of a therapeutic target according to claim 1 in the preparation of a drug for treating resistance to targeted therapy of renal cancer, characterized in that: The active fragments or derivatives of the SLC27A3 gene and its expression products include but are not limited to proteins or active polypeptides whose coding sequences have at least 80% homology with the sequence shown in SEQ ID NO.2 and have the characteristics or functions of SLC27A3.

4. The use of a therapeutic target according to claim 1 in the preparation of a drug for treating resistance to targeted therapy of renal cancer, characterized in that: The SLC27A3 is used to prepare a medicine for reducing the resistance of renal cancer to renal cancer drugs.

5. Use of a therapeutic target according to claim 4 in the preparation of a drug for treating resistance to targeted therapy of renal cancer, characterized in that: The drug comprises a SLC27A3 inhibitor and a pharmaceutically acceptable carrier, wherein the SLC27A3 inhibitor can inhibit the activity or expression of SLC27A3 and reduce the resistance of renal cancer to pazopanib; The dosage of the SLC27A3 inhibitor is 0.01 μg to 1000 mg / day per patient.

6. Use of a therapeutic target according to claim 5 in the preparation of a drug for treating resistance to targeted therapy of renal cancer, characterized in that: The SLC27A3 inhibitor includes one or more of a regulator that reduces SLC27A3 expression, a protease that degrades SLC27A3 products, a nuclease, and a regulator that reduces SLC27A3 products.

7. Use of a therapeutic target according to claim 6 in the preparation of a drug for treating resistance to targeted therapy of renal cancer, characterized in that: The regulator that reduces the expression of SLC27A3 is used to knock out or silence the SLC27A3; The regulator for reducing SLC27A3 expression includes siRNA, shRNA or miRNA; Wherein, the functional sequence used for knockdown in the shRNA is any one of SEQ ID NO.3 or SEQ ID NO.

4.

8. Use of a therapeutic target according to claim 6 in the preparation of a drug for treating resistance to targeted therapy of renal cancer, characterized in that: The modulators that reduce SLC27A3 production include SLC27A3 antibodies.

9. Use of a therapeutic target according to claim 6 in the preparation of a drug for treating resistance to targeted therapy of renal cancer, characterized in that: The SLC27A3 inhibitor is the compound Parishin.

10. Use of a therapeutic target according to claim 4 in the preparation of a drug for treating resistance to targeted therapy of renal cancer, characterized in that: The renal cell carcinoma is ccRCC.

Images